Polo like kinase 1 in hepatocellular carcinoma clinical significance and its potential as a therapeutic target
Tài liệu Báo cáo khoa học: Pyruvate reduces DNA damage during hypoxia and after reoxygenation in hepatocellular carcinoma cells pptx
... hypoxia and reoxygenation have been reported to induce DNA damage [30–32], we examined the effects of pyruvate addition during hypoxia and after reoxygenation on DNA damage HepG2 cells were incubated ... by Singh et al [48], using alkaline electrophoresis, which allows detection of single-strand and double-strand breaks Pyruvate reduces DNA damage during ⁄ after hypoxia Cells cultivated in Petri ... new insights into the role of pyruvate in tumor cells during hypoxia We show here that tumor HepG2 cells are inclined to maintain extracellular pyruvate at a constant level (0.4 mm) Hypoxia inhibits...
- 11
- 479
- 0
Hepatocellular Carcinoma – Clinical Research Edited by Wan-Yee Lau pptx
... orders@intechweb.org Hepatocellular Carcinoma – Clinical Research, Edited by Wan-Yee Lau p cm ISBN 978-953-51-0112-3 Contents Preface IX Part Diagnosis / Differential Diagnosis Chapter Hepatocellular Carcinoma: ... Hepatocellular Carcinoma – Clinical Research Edited by Wan-Yee Lau Published by InTech Janeza Trdine 9, 51000 Rijeka, Croatia Copyright ... Therapy for Growth Factors in Hepatocellular Carcinoma 321 Junji Furuse VII Preface Hepatocellular Carcinoma – Clinical Research covers the clinical aspects of hepatocellular carcinoma Again this book...
- 340
- 1,253
- 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
... ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG ... PPP6C-3¢UTR-mut-antisense PPP6C-siR-Top GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTATTGTGGAGTATGCTGCTGAAATG ATTTCAGCAGCATACTCCACAATAAAAAG ... lab works image acquisition and analysis software was used to quantify band intensities Antibodies were purchased from Tianjin Saier Biotech and Sigma-Aldrich 10 11 Statistical analysis Data are...
- 11
- 396
- 0
Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt
... implies that MYP has a role as a zinc transporter for gametogenesis In vertebrates, vitellogenin, a precursor of yolk protein, is a zinc- bind4994 ing protein that transports the zinc required for oogenesis ... as a substrate for localization of the labeled MYP Statistical analysis Data were expressed as the mean ± SEM Statistical analysis was performed using instat software (GraphPad Software) The ... Zinc- binding protein in the sea urchin T Unuma et al mainly in the digestive tract [8] and in the nutritive phagocytes of the ovary and testis [10], and it is accumulated abundantly in the...
- 14
- 442
- 0
Báo cáo khoa học: HIP/PAP, a C-type lectin overexpressed in hepatocellular carcinoma, binds the RIIa regulatory subunit of cAMP-dependent protein kinase and alters the cAMP-dependent protein kinase signalling ppt
... indicates that the location of HIP/PAP and RIIa is consistent with the relevance of their interaction HIP/PAP has been classified in the group of C-type lectins because it binds lactose and contains ... reticulum Ca2+ATPase (SERCA 2), an integral protein of the endoplasmic reticulum [22], calreticulin, a protein of the endoplasmic reticulum lumen [23], HIP/PAP, the RIIa and the Ca subunits of PKA were ... colocalized, suggesting their presence in a same subcellular compartment The locations of HIP/PAP and RIIa were further analyzed using a fractionation method (Fig 1B) The regulatory RIIa and the...
- 9
- 310
- 0
Báo cáo khoa học: Quantitative assessment of the glyoxalase pathway in Leishmania infantum as a therapeutic target by modelling and computer simulation pot
... glyoxalase pathway in Leishmania infantum A Fig Sensitivity analysis of the glyoxalase pathway in Leishmania infantum The effects of system parameters on the intracellular steady-state concentration ... 6C) The simulation results, based on experimentally determined parameters and a kinetic model of the 2393 The glyoxalase pathway in Leishmania infantum pathway, clearly show that the glyoxalase ... http://jjj.biochem.sun ac.za/database/silva/index.html free of charge Results and Discussion The potential of the glyoxalase system as a possible therapeutic target relies on its role as the main catabolic pathway...
- 11
- 515
- 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... limitation of the process is the identification of those antigens that are the most relevant as targets, as the human auto-antigen-specific T cell repertoire is diverse and the optimal antigen target ... Cite this article as: d’Hennezel et al.: IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and ... cells found in the blood, whether it be in their repertoire, function and state of activation, may not accurately reflect the status and behavior of their counterparts localized in the target...
- 12
- 573
- 0
Báo cáo y học: "B cells as a therapeutic target in autoimmune disease" doc
... non-Hodgkin’s lymphoma as a single agent as well as in combination therapy, emphasizing its high B-cell-depleting potency [8] In patients with lymphoma, rituximab infusion is frequently associated ... by the US National Institutes of Health is in the planning stage 132 Although autoantibodies in autoimmune cytopenias and some other diseases, such as pemphigus and myasthenia gravis, have a ... immunoglobulin levels are usually maintained, possibly as a consequence of plasma cells being spared B-cell depletion in antibody-mediated diseases It is understandable that rituximab has been most...
- 5
- 410
- 0
Báo cáo y học: "Regulation of the JNK pathway by TGF-beta activated kinase 1 in rheumatoid arthritis synoviocytes" pps
... GS: Regulation of c-Jun N-terminal kinase by MEKK-2 and mitogen -activated protein kinase kinase kinases in rheumatoid arthritis J Immunol 2004, 17 2 :16 12 -16 18 Huang Q, Yang J, Lin Y, Walker C, Cheng ... purposes) Arthritis Research & Therapy 10 11 12 13 14 15 16 17 18 19 20 21 Vol No Hammaker et al Mor A, Abramson SB, Pillinger MH: The fibroblast-like synovial cell in rheumatoid arthritis: a key player ... N-terminal kinase is required for metalloproteinase expression and joint destruction in inflammatory arthritis J Clin Invest 20 01, 10 8:73- 81 Davis RJ: Signal transduction by the JNK group of MAP kinases...
- 9
- 371
- 0
Báo cáo y học: "RNA interference against polo-like kinase-1 in advanced non-small cell lung cancers" doc
... strand, while the silencing activity of the siRNA was maintained [18] Polo-like kinase-1 (PLK-1) belongs to the family of serine/threonine kinases and regulates cell division in the mitotic phase ... the systemic siRNA delivery with atelocollagen existed intact for at least days in tumor tissues using a mouse model [62] Preclinical application of RNAi therapy against PLK-1 in a murine advanced ... NSCLC: non-small cell lung cancer; nt: nucleotide; PAZ: Piwi/ Argonaute/Zwille; PLK-1: Polo-like kinase-1; RISC: RNA-induced silencing complex; RNAi: RNA interference; siRNA: small interfering RNA;...
- 6
- 322
- 0
Báo cáo y học: "Targeting insulin-like growth factor axis in hepatocellular carcinoma" ppsx
... insulin-like growth factor 2; IGF-1R: insulin-like growth factor receptor; IGF-2R: insulin-like growth factor receptor; IRS: insulin receptor substrate; IGFBPs: insulin like growth factor binding proteins; ... expression of insulin-like growth factor binding proteins in human hepatocellular carcinoma Mol Cell Biochem 2000, 207:101-104 82 Teishima J: Decreased expression of insulin-like growth factor binding ... insights into the value of IGF inhibition in the treatment of HCC Abbreviations HCC: hepatocellular carcinoma; IGF: insulin-like growth factor; IGF-1: insulinlike growth factor 1; IGF-2: insulin-like...
- 11
- 371
- 0
The roles of histone deacetylases 1 and 2 in hepatocellular carcinoma
... 17 1. 9 Cooperative and distinct functions of HDAC1 and 18 1. 9 .1 Redundancy of HDAC1 and HDAC2 functions 18 1. 9 .2 Distinct functions of HDAC1 and HDAC2 19 1. 10 Inhibition of ... 20 1. 11 Biological effects and mechanisms of action of HDAC inhibitors 20 1. 11. 1 Apoptosis 20 1. 11. 2 Growth arrest 22 1. 11. 3 Mitotic disruption and autophagy ... 23 1. 11. 4 Anti-angiogenesis, anti-metastasis and invasion 24 1. 11. 5 Anti-tumor immunity 25 1. 12 HDAC inhibitors in cancer therapy 26 1. 12 .1 Clinical trials 26 ...
- 168
- 372
- 0
Targeting polo like kinase 1 in glioma propagating cells
... of glioma 1. 4 Re-defining assay criteria for detecting GPCs 10 1. 5 PLK1 regulation and physiological role 11 1. 5 .1 PLK1 regulation 11 1. 5.2 Physiological role of PLK1 13 1. 5.3 PLK1 and tumors 15 ... 1. 9 34 3.3 PLK1 mRNA expression is elevated in glioma tumors PLK1 over-expression is common in several cancers of the breast 116 , ovaries 117 , prostate 118 and skin 119 In addition, PLK1 protein ... implicated in GPC survival, thus validating our screening method; PI3K/AKT, GSK3, CDK1, and TAK1 inhibitors 114 -11 5 Interestingly, a compound targeting PLK1 emerged, potentially identifying PLK1 as...
- 133
- 275
- 0
Polo like kinase 1 in hepatocellular carcinoma clinical significance and its potential as a therapeutic target
... (Polo- like kinase of X laevis); Snk (serum-inducible kinase) ; Fnk (fibroblastgrowth-factor-indiucible kinase) ; Prk (proliferation-related kinase) ; Sak (Snk akin kinase) xvi Table II: Polo- like kinase ... hours after transfection Caspase-3 activity assay was carried out (Fig 8) and intrigued to find that caspase-3 activation in si-PLK1 transfected Huh-7 was absent in the first 12 hours and 24 ... in this phase has been identified as a possible target of ataxia telangiectasia mutated (ATM) or ATM-related proteins (ATR), the transducers of the DNA damage signaling pathway (van Vugt et al.,...
- 84
- 215
- 0
Từ khóa: angiogenesis signaling axis and hif 1 in hepatocellular carcinomametallothionein mt was first identified in 1957 by m margosch and b vallee as a cadmium protein from equine kidney cortex in fact11β hydroxysteroid dehydrogenase type 1 as a therapeutic target for type 2 diabetesmonocytes macrophages in hepatocellular carcinomainteraction of tumour with host stroma in hepatocellular carcinomasignaling pathways and rationale for molecular therapies in hepatocellular carcinomaidentification of cancer stem cell related micrornas in hepatocellular carcinomak noguchi t naguro i ichijo h 2008 apoptosis signal regulating kinase 1 in stress and immune response annu rev pharmacol toxicol 48 199 22560ni 22cr 9mo 3 5cb annealed grade 1 in welded tube plate sheet and strip section iunexplained visceral pain in children pathophysiology clinical features and managementdyspepsia in children epidemiology clinical presentation and causesrole of the host inflammatory response in colon carcinoma initiation progression and liver metastasisclinical biological and laboratory parameters as predictors of severity of clinical outcome and response to anti tnf alpha treatment in ulcerative colitisto like ex 1 look at the pictures ask and answer what these people likeh et al 2012 quot aspirin resistance clinical significance and genetic polymorphism quot j int med res 40 1 pp 282 292Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP