11β hydroxysteroid dehydrogenase type 1 as a therapeutic target for type 2 diabetes
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... age at diagnosis in late-onset Finnish type diabetes subjects Immunogenetics 2 010 , 62 :10 1 -10 7 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara ... 11 9:4 82- 487 18 Roifman CM: Human IL -2 receptor alpha chain deficiency Pediatr Res 20 00, 48:6 -11 19 Bernasconi A, Marino R, Ribas A, Rossi J, Ciaccio M, Oleastro M, Ornani A, Paz R, Rivarola MA, Zelazko ... et al Journal of Translational Medicine 2 010 , 8 :11 3 http://www.translational-medicine.com/content/8 /1/ 113 REVIEW Open Access IL -2 as a therapeutic target for the restoration of Foxp3+ regulatory...
- 12
- 573
- 0
Báo cáo y học: "Th2 cytokines and asthma Interleukin-9 as a therapeutic target for asthma" ppsx
... http://respiratory-research.com/content /2/ 2/080 13 14 15 Conclusion 16 17 18 19 20 21 References 22 23 24 25 26 27 29 30 primary research 28 reports McFadden ER Jr, Gilbert IA: Asthma N Engl J Med 19 92, ... experimental asthma Science 19 98, 28 2 :22 61 22 63 Temann UA, Geba GP, Rankin JA, Flavell RA: Expression of interleukin in the lungs of transgenic mice causes airway inflammation, mast cell hyperplasia, ... breath Am J Respir Crit Care Med 19 95, 15 1 :13 88 13 92 Kon OM, Kay AB: T cells and chronic asthma Int Arch Allergy Immunol 19 99, 11 8 :13 3 13 5 Yssel H, Groux H: Characterization of T cell subpopulations...
- 5
- 246
- 0
Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps
... Primers and probes 11 β- HSD1 Forward primer: AGGAAAGCTCATGGGAGGACTAG Reverse primer: ATGGTGAATATCATCATGAAAAAGATTC Probe: CATGCTCATTCTCAACCACATCACCAACA H6PDH Forward primer: CAGGTGTCCTAGTGCACATTGAC ... GTAGCCCACTCTCTCGTCCAA Probe: AAGGCACGCCCTCCCAGCG GRα Forward primer: GCGATGGTCTCAGAAACCAAAC Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA GRβ Forward primer: AAC ... Hatakeyama H, Inaba S, Miyamori I: 11 beta -hydroxysteroid dehydrogenase activity in human aortic smooth muscle cells Hypertens Res 20 01, 24 :33-37 Hatakeyama H, Inaba S, Takeda R, Miyamori I: 11 beta-hydroxysteroid...
- 10
- 438
- 0
Polo like kinase 1 in hepatocellular carcinoma clinical significance and its potential as a therapeutic target
... 2. 95 16 .15 ± 5 .11 0.570† 49 17 .24 ± 2. 74 21 . 72 ± 6.83 0.436† 41 13 14 .00 ± 13 .10 17 .39 ± 2. 92 19 .69 ± 5.87 0.846‡ 44 12 16 .05 ± 2. 42 24 .22 ± 7.83 0.497† 32 18 5.68 14 .11 ± 6.67 17 .68 ± 2. 93 19 . 72 ... 7) also revealed nuclear fragmentation in apoptotic cells as early as 24 hours after transfection Caspase-3 activity assay was carried out (Fig 8) and intrigued to find that caspase-3 activation ... et al., 20 01; Takahashi et al., 20 03; Weichert et al., 20 0 5a) Endometrial cancer (Takai et al., 20 01b) Esophageal and gastric cancer (Tokumitsu et al., 19 99) Pancreatic cancer (Gray et al., 20 04;...
- 84
- 215
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... mineral status of female mice Biol Trace Elem Res 42, 16 5 17 7 15 Takahashi S, Takahashi I, Sato H, Kubota Y, Yoshida S & Muramatsu Y (20 01) Age-related changes in the concentrations of major and ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... copper-transporting ATPase in NMDA receptor-mediated neuronal toxicity Proc Natl Acad Sci USA 10 3, 14 919 14 924 12 Massie HR, Aiello VR & Iodice AA (19 79) Changes with age in copper and superoxide...
- 9
- 634
- 0
Báo cáo khoa học: Quantitative assessment of the glyoxalase pathway in Leishmania infantum as a therapeutic target by modelling and computer simulation pot
... glyoxalase pathway Mol Biochem Parasit 28 , 12 1 12 7 13 Irsch T & Krauth-Siegel RL (20 04) Glyoxalase II of African trypanosomes is trypanothione-dependent J Biol Chem 27 9, 22 20 922 21 7 14 Martins AM, ... with a prokaryotic ancestry in Leishmania major Proc Natl Acad Sci USA 10 1, 13 18 613 1 91 19 Iozef R, Rahlfs S, Chang T, Schirmer H & Becker K (20 03) Glyoxalase I of the malarial parasite Plasmodium ... Trypanosoma brucei trypanothione synthetase as drug target Free Radic Biol Med 36, 12 8 913 02 28 Oza SL, Tetaud E, Ariyanayagam MR, Warnon SS & Fairlamb AH (20 02) A single enzyme catalyses formation...
- 11
- 515
- 0
Báo cáo y học: "B cells as a therapeutic target in autoimmune disease" doc
... [abstract] FASEB J 19 95, 9 :A2 06 Kosmas C, Stamatopoulos K, Stavroyianni N, Tsavaris N, Papadaki T: Anti-CD20-based therapy of B cell lymphoma: state of the art Leukemia 20 02, 16 :20 04 -2 015 Maloney ... 11 12 13 14 15 16 17 18 None declared 21 Acknowledgements Supported in part by grants from the National Institutes of Health (AR 424 57, AR 419 74 and AI 4 414 2) and by the Mayo Foundation We thank ... Bernasconi NL, Traggiai E, Lanzavecchia A: Maintenance of serological memory by polyclonal activation of human memory B cells Science 20 02, 29 8: 21 9 9 -22 02 Matsumoto I, Maccioni M, Lee DM, Maurice...
- 5
- 410
- 0
Báo cáo y học: "Latent Membrane Protein 1 as a molecular adjuvant for single-cycle lentiviral vaccines" pot
... 2 011 , 8:39 http://www.retrovirology.com/content/8 /1/ 39 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 factor-kappa B, and stress-activated protein kinase J Immunol 19 98, 16 0 :11 16 -11 21 ... LMP1 and LMP1-CD40 as vaccine adjuvants, naming GWS and RSK as inventors Page 11 of 12 Received: February 2 011 Accepted: 18 May 2 011 Published: 18 May 2 011 References Tripp CS, Wolf SF, Unanue ... at MOI Gupta et al Retrovirology 2 011 , 8:39 http://www.retrovirology.com/content/8 /1/ 39 Page of 12 A Plasma Membrane Plasma Membrane LMP1 LMP1 19 0 (LMP1) 22 0 (CD40) N N CD40 Cytoplasm Cytoplasm...
- 12
- 219
- 0
Báo cáo khoa học: 17b-Hydroxysteroid dehydrogenase type 11 is a major peroxisome proliferator-activated receptor a-regulated gene in mouse intestine pdf
... 898.47 936. 51 1000.58 16 92. 87 25 27.58 25 77 .24 26 30.43 29 51. 48 29 84.5 )0. 02 0.03 0. 01 0. 02 0.03 0. 02 0. 02 0. 01 )0.03 0.04 28 3 28 8 28 9 29 6 15 1 16 1 63–70 14 0 15 3 3 24 83 10 5 33–58 16 2 18 9 22 8 25 4 K)HRINVK ... 620 .34 745.46 873. 52 925 .23 970. 62 10 01. 61 111 7. 62 12 29 .64 13 15.68 13 52. 63 15 97.97 17 28 .97 19 85.94 16 86.94 28 20.4 29 69. 42 0 )0.05 0. 02 0 0.03 0.03 0.05 0.07 0. 01 )0.05 0.05 0.05 0.07 )0.03 4 72 476 ... 26 30.44 29 51. 45 29 84.54 P80 620 .34 620 .34 745.49 873.54 925 .53 970. 62 10 01. 61 111 7.65 12 29 .67 13 15.73 15 2. 7 15 97.98 17 28 . 92 19 85.99 19 86.99 28 20.47 29 69.45 Theoretical MH+ Delta Residues Peptide sequence...
- 6
- 272
- 0
Báo cáo khoa học: Regulated expression by PPARa and unique localization of 17b-hydroxysteroid dehydrogenase type 11 protein in mouse intestine and liver pdf
... that 17 b-HSD 11 was identified as the third most abundant protein after adipose differentiation-related protein (ADRP) and long-chain acyl-CoA synthetase (ACSL3) among 17 major proteins associated ... lower case) and 5¢-gcct cgagCTTGTCTTTGTACCCAACAAC (with XhoI site) and cloned into pCGFP2 or pCMVtag 5A To obtain an expression plasmid for 17 b-HSD 11 with a Halo-tag at the C-terminus, a DNA fragment ... 37, 15 34 15 46 17 Robenek MJ, Severs NJ, Schlattmann K, Plenz G, Zimmer KP, Troyer D & Robenek H (20 04) Lipids partition 17 -b -Hydroxysteroid dehydrogenase type 11 18 19 20 21 22 23 24 25 26 27 28 ...
- 11
- 497
- 0
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc
... followed by PCR with Taq DNA polymerase (Promega, Madison, WT, USA) using the primers 5¢-CACACTACACTGGGAAGCAGAGACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG3¢ The cDNA was subcloned into the ... an acyltransferase required for palmitoyla- 17 18 19 20 21 22 23 24 25 26 27 28 tion and activity of the Hedgehog signal Science 29 3, 20 80 20 84 Lee JD & Treisman JE (20 01) Sightless has homology ... Drosophila segment FEBS Journal 27 5 (20 08) 318 –3 31 ª 20 07 The Authors Journal compilation ª 20 07 FEBS 329 A negative regulator for palmitoylation of Shh 10 11 12 13 14 15 16 330 Y Abe et al polarity...
- 14
- 499
- 0
Báo cáo khoa học: "Combination therapy with docetaxel and S-1 as a first-line treatment in patients with advanced or recurrent gastric cancer: a retrospective analysis" docx
... value < median 15 .2 11 .5 - 19 .0 0.4 91 м median 12 .8 7 .1 - 18 .4 Age Gender male 13 .2 9.8 - 14 .8 Female 16 .8 10 .7 - 22 .8 0 -1 15 .2 12 .0 18 .5 2 7.6 - 16 .5 Advanced 15 .2 11 .7 - 18 .8 Recurrent 12 .1 ... W, Narahara H, Hara T, Takagane A, Akiya T, Takagi M, Miyashita K, Nishizaki T, Kobayashi O, Takiyama W, Toh Y, Nagaie T, Takagi S, Yamamura Y, Yanaoka K, Orita H, Takeuchi M: S -1 plus cisplatin ... 9 .1 - 15 .1 differentiated 14 .5 9 .1 - 18 .2 undifferentiated 14 .6 11 .0 - 18 .2 12 .8 10 .1 - 15 .4 2 16 .9 14 .4 - 19 .3 No 16 .0 12 .7 - 19 .3 Yes 10 .4 0.49 3.5 - 17 .3 Performance status 0. 01 Disease status...
- 7
- 407
- 0
Báo cáo khoa học: "Evaluation of the fullerene compound DF-1 as a radiation protector" doc
... Building 10 CRC/B23500, Bethesda, MD 20 8 92, USA and 3Radiation Biology Branch, National Cancer Institute, Building 10 , B2.5, Bethesda, MD 20 8 92, USA Received: 15 March 2 010 Accepted: 11 May 2 010 Published: ... survival analysis was performed in the MRC5, DU145, and MiaPaCa -2 cell lines DF -1 was delivered at 10 μM and 10 0 μM final concentration immediately prior to irradiation As shown in figure 1, DF -1 ... C60(OH )24 was previously evaluated as a protector of radiation and compared to amifostine in rats [27 ] This study evaluated histologic measures of radiation damage but did not evaluate lethality A...
- 9
- 384
- 0
Báo cáo y học: " Is interleukin-1 a good target for therapeutic intervention in intervertebral disc degeneration: lessons from the osteoarthritic experience" pdf
... intra-articular delivery of anakinra (recombinant methionyl human receptor antagonist (r-met HuIL-1ra)) may have beneficial effects on symptoms and structural modifications in animal models of OA ... pain and disease activity A first randomized controlled trial in patients with knee OA demonstrated a good safety profile for one intra-articular injection of IL-1ra (15 0 mg, the maximum tolerated ... structural damage process of OA but also plays an important role in pain transmission Results from in vitro studies and animal models of OA support the dominant role of IL -1 early in the disease...
- 2
- 412
- 0
Báo cáo y học: "Identification of Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a binding protein for a 68-kDa Bacillus thuringiensis parasporal protein cytotoxic against leukaemic cells" potx
... Cry46Aa (parasporin -2) , Cry41Aa (parasporin-3) and Cry45Aa (parasporin-4) also with selective cytotoxic activities against cancer cells [5-7] Recently two more parasporin (PS5Aa1 and PS6Aa1) were ... protein of the saframycin antiproliferative agents PNAS 20 04, 10 1 (16 ):58 62- 5866 21 Lee D, Katayama H, Maeda M, Tanaka R, Yamashita S, Saitoh H, Mizuki E, Ohba M: A 28 kDa protein of the Bacillus thuringiensis ... lines [Abstract] MJMS 20 07, 14 (1 supp) :2 15 Kitada S, Abe Y, Shimada H, Kusaka Y, Matsuo Y, Katayama H, Okumura S, Akao T, Mizuki E, Kuge O, Sasaguri Y, Ohba M, Ito A: Cytocidal Actions of Parasporin -2, ...
- 11
- 366
- 0
Báo cáo y học: " APOBEC3G-UBA2 fusion as a potential strategy for stable expression of APOBEC3G and inhibition of HIV-1 replication" pot
... 5'-ATCCAAGACGGAATTCGTTTTCCTGATTCTGGAG-3' The UBA2 gene fragment was amplified from plasmid pcDNA3.1HHR2 3A by PCR The 5' primer used was 5'ATCCAAGACGGAATTCACGCCGCAGGAGAAAGAAGCTATAG-3'; the 3' primer for the APOPEC3G-UBA2 ... proteasome-interacting factors Rad23 and Rpn10 of Saccharomyces cerevisiae Genetics 19 99, 15 3 (1) :69-79 Hiyama H, Yokoi M, Masutani C, Sugasawa K, Maekawa T, Tanaka K, Hoeijmakers JH, Hanaoka F: ... the APOPEC3G-UBA2 fusion was 5'-ATCGTACTCGAAGCTTCTAACTCAGGAGGAAGTTGGCAG-3'; and the 3' primer for the APOPEC3G-UBA2* fusion was 5'-ATCGTACTCGAAGCTTCTAACTCAGagcGAAGTTGGCAG-3' Purified PCR products...
- 13
- 254
- 0
Báo cáo y học: "High mobility group box protein-1 (HMGB-1) as a new diagnostic marker in patients with acute appendicitis" potx
... cerebral and myocardial ischemia Shock 20 06, 25 :5 71- 574 Albayrak et al Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine 2 011 , 19 :27 http://www.sjtrem.com/content /19 /1/ 27 Page ... literature have yet evaluated an association between HMGB -1 and AA HMGB1 (previously designated HMG1 or amphoterin) [ 12 ] is not a new protein It was discovered > 30 years ago as a nuclear DNA-binding ... study Crit Care 20 07, 11 (4):R76 31 Yang H, Wang H, Trachey KJ: HMG -1 rediscovered as a cytokine Shock 20 01, 15 :24 7 -25 3 32 Yasuda T, Ueda T, Takeyama Y, et al: Significant increase of serum highmobility...
- 6
- 369
- 0
targeting cancer cell metabolism as a therapeutic strategy
... melanoma Barbara Julieta Chaneton, 2 014 37 Chapter - Materials and Methods Barbara Julieta Chaneton, 2 014 38 2 .1 Materials Materials and methods were taken from Chaneton et al, 2 0 12 Nature 2 .1. 1 ... ( 12 0, 12 6 - 12 9) They increase the affinity for PEP as the natural activator FBP does without altering the Km for ADP PKM2 activation has emerged as an appealing therapeutic opportunity in an attempt ... measurements 51 2. 2.3.5 ATP measurement 52 2. 2.4 Statistical analysis and data processing 52 Chapter - Characterisation of Serine as a Natural Ligand and Allosteric Activator...
- 121
- 191
- 0
Probiotics as a novel approach to modulate incretins, insulin secretion and risk factors of type 2 diabetes and complications
... Lacto-F2 TGG AAA CAG ATG CTA ATA CCG 21 nt Lacto-R2 CGT CCA TTG TGG TAG ATT CCC T 22 nt Lacto-S CTG AGA CAC GGC CCA WAC TCC TAC GG 26 nt F_reut_IS ACC GAG AAC AAC GCG TTA TTT 21 nt R_reut_IS CAT AAC ... CCC AAC A 19 nt P 10 24 02 S CAC GAG CTG ACG ACA RCC ATG CA 23 nt tuf-F TGG TCA GGT ACT GGC TAA GC 20 nt tuf-R TCT TTG GAC AGA ATG TAC ACT TCA 24 nt tuf-S CCA TCA AGC CGC ACA CCA AGT TCG 24 nt Lacto-F2 ... 77±9 93±6 16 29 28 5 14 57 24 8 18 19 19 1 Gastric emptying [t½]# 84±34 90±36 78± 32 Treatment adherence* 21 / 21 11/ 11 10 /10 Subjects [female / male] HbA1c [%] Fasting BG [mg/dl] Fasting FFA [µmol/l]...
- 105
- 330
- 0
Báo cáo y học: "A prospective observational study of the relationship of critical illness associated hyperglycaemia in medical ICU patients and subsequent development of type 2 diabetes"
... to the ACC/AHA criteria [26 ,27 ] Statistical analyses MedCalc™ v 9.6 .2. 0 (MedCalc Software, Mariakerke, Belgium) statistical software was used for all statistical analyses Categorical data are presented ... sepsis Arch Surg 19 85, 12 0 :16 6 -17 2 20 Metso AJ, Murros K: Hyperglycaemia and the outcome of stroke Brain 20 07, 13 0:e85 author reply e86 21 Cubbon RM, Rajwani A, Abbas A, Gale CP, Grant PJ, Wheatcroft ... Umpierrez GE: American Association of Clinical Endocrinologists and American Diabetes Association consensus statement on inpatient glycemic control Diabetes Care 20 09, 32 :11 19 -11 31 39 Waeschle RM,...
- 8
- 656
- 1
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25