Detection, formation and reactivity of tetravalent lead corrosion product (pbo2) and its role in water quality in drinking water distribution system

... Mack et al Human 3-methylglutaconyl-CoA hydratase Fig The metabolic pathway of (S) -leucine (L -leucine) and isovalerate Enzymes involved are as follows: 1, EC 2.6.1.42, branched chain amino transferase ... 3-MG-CoA hydratase reaction of leucine catabolism at the protein and DNA levels and developed a novel assay for enzyme analysis in a diagnostic setting The human AUH protein was first recognized by its ... confirmation of AUH deficiency in fibroblast homogenates In summary, our data show that the main biological function of AUH in human metabolism is the hydration of (E)-3-MG-CoA to (S)-HMG-CoA in the leucine...

... that the hypodermis of the body wall, which synthesizes components of the cuticle, may offer a useful target for studies into the mechanism of the development and molting process in the roundworms ... presence of increasing concentrations of inhibitors for 10 days, and the number of molting larvae was determined Molting was manifested by shedding of the L3 cuticle Results Identification of cDNA ... involved in the molting process, we examined the effects of two PPase specific inhibitors, imidodiphosphate (IDP, 1-0631; Sigma) and NaF on development and molting of A suum lungstage L3 to fourth-stage...

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains and a single KH domain similar ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1 (ANKHD1) variants,...

... We interpret this observation as the retainment of newly synthesized proteins in the cytosol due to the inability to import matrix proteins by the fraction of growing and dividing glycosomes The ... lower (not shown) In order to determine the in uence of the reduction of the expression of TbPEX14 on the import of glycosomal matrix proteins, the subcellular distribution of glycolytic enzymes ... identified in yeast) PEX17 Several other peroxins are involved in the subsequent steps of the import The import of matrix proteins seems to involve a cascade of interactions between the cargo-loaded...

... Shin-ichiro and Wakao, Takahiro (1992) Metonymy: reassessment, survey of acceptability, and its treatment in a machine translation system Locating 1.1 Container for Content Dave drank the glasses The ... Metonymic interpretation and associative processes in natural language In Exxon has raised its price again Washington is insensitive to the needs of the people Language and Artificial Intelligence, Makoto ... that the main factors for treating metonymy correctly in a multilingual machine translation system are 1) its universality, which can be a guideline for the analysis component, 2) language dependency,...

... molecular chaperones in the folding of oxidized proteins Refolding of colloidal thyroglobulin by protein disulfide isomerase and immunoglobulin heavy chain-binding protein J Biol Chem 2001, 276:21337-21342 ... Mechanism of hepatocellular dysfunction during early sepsis: key role of increased gene expression and release of proinflammatory cytokines tumor necrosis factor and interleukin-6 Arch Surg 1997, 132:364-370 ... protein disulfide isomerase inhibition on tumor necrosis factor-alpha gene expression and production in RAW 264.7 cells To investigate the role of PDI in the regulation of proinflammatory cytokine...

... v ABSTRACT Liyun Cao MECHANISM OF TISSUE TRANSGLUTAMINASE UPREGULATION AND ITS ROLE IN OVARIAN CANCER METASTASIS Ovarian cancer (OC) is a lethal disease due to metastasis and chemoresistance Our ... activating NF-κB complex, which leads to increased cell invasiveness in vitro and tumor metastasis in vivo The N-terminal fibronectin (FN) binding domain of TG2 (tTG 1-140), lacking both enzymatic and ... Figure 33 Wild-type TG2 and N-terminal fibronectin binding domain of TG2 induce EMT in OV90 cells Figure 34 104 Wild-type TG2 and N-terminal fibronectin binding domain of TG2 promote OV90 cells adhere...

... N-terminal domain of HRI and in an insert region in the protein kinase domain of HRI (63) Heme, in the presence of iron, binds to α and β globin chains in ratio of 1:2:2, respectively In response to iron ... Palam REGULATION OF CHOP TRANSLATION IN RESPONE TO eIF2 PHOSPHORYLATION AND ITS ROLE IN CELL FATE In response to different environmental stresses, phosphorylation of eukaryotic initiation factor-2 ... response to various stresses alters the initiation factor from a substrate to a competitive inhibitor of eIF2B, associating with the regulatory portion of eIF2B and blocking exchange of eIF2- GDP to eIF2- GTP...

... assay 57 3.5.2 Growth of different H pylori strains 57 3.5.3 Inhibitory effect of serine borate complex on H pylori GGT activity 58 3.5.4 Stimulatory effect of GSH and glycyl-glycine on H pylori ... activity of H pylori 100 4.2.2.2 GSH enhances the GGT acitivity of H pylori 101 4.2.2.3 Effects of GGT inhibitor and enhancer on the growth of H pylori 102 4.3 Sequencing of ggt gene of H pylori ... fuction of H pylori GGT thereby providing a new focus in H pylori- mediated IL-8 generation The role that membrane bound GGT plays in affecting growth of H pylori, its effect on hydrogen peroxide and...

... CHARACTERIZATION OF RAB2 2B, AN ASTROGLIAENRICHED RAB GTPASE, AND ITS ROLE IN GOLGI AND POST -GOLGI MEMBRANE TRAFFIC NG, EE LING B APP SC (HONS) (QUEENSLAND UNIVERSITY OF TECHNOLOGY) ... 1.1 An overview of Rab GTPases and membrane trafficking The enormous flux of membrane traffic within a cell at any point of its existence necessitates stringent control of both the rate and specificity ... regulation of trafficking of membrane components by Rab2 2B may play an important role in myelin formation and maintenance in oligodendrocytes 26 Aims and rationale of current work 1.3 Aims and rationale...

... extracellular ligand-binding domain and an intracellular catalytic or enzyme-binding domain The great majority of the receptors are themselves protein kinases or are associated with kinases Binding ... discovered kinases that catalyze the phosphorylation of hydroxyamino acids All of the known protein kinases including tyrosine kinases share a related catalytic domain of about 260 amino acids and are ... may have separate and unique functions in the cell 1.3.3.1.2.4 Fatty acids In the absence of PS and Ca2+, cis-unsaturated fatty acids such as arachidonic, linoleic, linolenic and oleic acid can...