Functional interactions of protein tyrosine phosphatase alpha (PTPa) and src in mouse development and integrin singaling investigation of double PTPa src deficient mice and cells

... Functional Interactions of Protein Tyrosine Phosphatase Alpha (PTPα) and Src in Mouse Development and Integrin Signaling: Investigation of Double PTPα /Src- Deficient Mice and Cells CHEN MIN ... integrin signaling, and plays a negative feedback role in orchestrating integrin signaling To determine how PTPα is regulated upon integrin stimulation and how a signal emanating from integrin ... Phosphorylation of PTPα at Ser180 and Ser204 reduces the affinity of Grb2 SH2 binding to phospho-Tyr789 of PTPα without reducing the affinity of Src SH2 binding, resulting in less Grb2 and more Src binding...

Tài liệu Báo cáo khoa học: Effect of ionic strength and oxidation on the P-loop conformation of the protein tyrosine phosphatase-like phytase, PhyAsr docx

... al Effect of ionic strength and oxidation on PhyAsr A A R258 R258 C252 OCS 252 B B R258 R258 OCS252 C252 Fig (A) Conformation of the P-loop at low ionic strength in the absence of ligand The P-loop ... Structure of PhyAsr under low and high ionic strength conditions To examine the structural effect of ionic strength on the P-loop, X-ray crystal structures of PhyAsr were determined at several ionic strengths, ... [30] The ionic strength P was calculated using the equation I = ½ ciZi2, where I is the ionic strength of the solution, and ci and Zi are the concentration and charge of species i, respectively The...

Báo cáo khoa học: Catalytically active membrane-distal phosphatase domain of receptor protein-tyrosine phosphatase a is required for Src activation doc

... the membrane-distal domain of RPTPa affected the biological function of RPTPa, impairing Src binding and its ability to activate Src Our results indicate that a catalytically active D2 domain is ... that the catalytic activity of RPTPa-D2 plays an important role in Src activation To conﬁrm that the catalytic activity of RPTPa-D2 is required for Src binding and activation, we used an RPTPa-D2 ... pTyr527 and activate Src Taken together, these results indicate that catalytically active RPTPa-D2 is required for binding and activation of Src Discussion Here we report that inactivating mutations...

Báo cáo khoa học: Calpain-mediated degradation of reversibly oxidized protein-tyrosine phosphatase 1B docx

... (àM) 10 30 A Phosphatase activity (% of untreated) Calpain-mediated degradation of reversibly oxidized protein-tyrosine phosphatase 1B 2830 kDa fragments Reversibly oxidized PTP1B IB: anti oxPTP ... Trumpler et al ă Calpain-mediated degradation of reversibly oxidized protein-tyrosine phosphatase 1B A B Fig Oxidation enhances binding of PTP1B to calpain (A) Preoxidized recombinant PTP1B wild-type ... derived from reversibly oxidized PTP1B To further address this question, PTP1B was rst oxidized with H2O2 under conditions which result in the formation of reversibly and irreversibly oxidized species,...

Báo cáo khoa học: Weak oligomerization of low-molecular-weight protein tyrosine phosphatase is conserved from mammals to bacteria pot

... useful discussions This work was partially supported by funds from the Spanish Ministry of Education (BIO2007-63458 to MP) J.B is a recipient of a predoctoral fellowship from the Spanish Ministerio ... such as bacterial stress resistance Conserved weak protein interactions in lmwPTP Comparison of lmwPTPs from phylogenetically distant species (endogenous prokaryotic and eukaryotic forms) is expected ... obtained from a Monte-Carlo analysis of the model as described in Materials and methods The improvement in the ﬁgure of merit v2 from 1.128 to 0.921 is statistically signiﬁcant according to the...

Báo cáo y học: " Characterization of protein tyrosine phosphatase H1 knockout mice in animal models of local and systemic inflammation" docx

... processing of other cytokines and cytokine receptors [32-35] Interestingly, PTPH1 is known to inhibit TACE expression and activity in vitro [36] We therefore analyzed cytokines plasma levels in carrageenan-treated ... Clin Pathol 2008, 129:735-743 doi: 10.1186/1476-9255-7-16 Cite this article as: Patrignani et al., Characterization of protein tyrosine phosphatase H1 knockout mice in animal models of local and ... is SHP-1 (SRC homology (SH2)-containing tyrosine phosphatase 1), that is mainly expressed in hematopoietic and lymphoid cells [8] Lymphocyte specific phosphatase, (LYP) and its mouse orthologue...

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

... anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE and silver stain of proteins isolated from AP sepharose (lane 1) and FN3d–AP sepharose (lane 2) A protein band of approximately 95 kDa is ... nucleolin, mean that calculations of binding affinity are unrealistic at this stage Nucleolin localization in muscle is analogous to PTPr ligand localization To determine whether the nucleolin identified ... This revealed a band at approximately 95 kDa present in the PTPr eluate only These data confirm that nucleolin is a binding partner for PTPr under these conditions PTPr can bind directly to nucleolin...

Báo cáo khoa học: Identiﬁcation, subcellular localization and functional interactions of PilMNOWQ and PilA4 involved in transformation competency and pilus biogenesis in the thermophilic bacterium Thermus thermophilus HB27 ppt

... natural transformation of T thermophilus HB27 Furthermore, we present the ﬁrst information on the subcellular localization of the PilMNOWQ and PilA4 competence proteins and on the effect of mutations ... in pilQ led to the absence of PilW and PilA4 in the inner membrane In addition, pilW mutation resulted in the absence of PilQ and PilA4 in the outer membrane The abilities of PilW, PilQ and PilA4 ... observed binding of gold-labeled antibodies to the pilus (data not shown) This ﬁnding suggests that either PilA4 is not part of the pilus, PilA4 is inaccessible in the native pilus, or the PilA4...

Báo cáo khoa học: The protein tyrosine phosphatase PTP-Basophil/Basophil-like Interacting proteins and molecular functions doc

... bona fide tyrosine phosphatase [15,22] Currently, several proteins are known to serve as substrate for the protein tyrosine phosphatase domain of PTP-Bas/BL Theses proteins are RIL, IjBa and ephrinB, ... role in the assembly of supramolecular protein complexes [21] Finally, the protein tyrosine phosphatase domain is located at the extreme C-terminus of the molecule The complexity of the PTP-Bas/BL ... Four-point-one/Ezrin/Radixin/Moesin (FERM) domain The core of the protein comprises five different PDZ domains The protein tyrosine phosphatase (Phos.) domain is located at the C-terminus The regions of major alternative...

Báo cáo y học: "Rheumatoid arthritis seropositive for the rheumatoid factor is linked to the protein tyrosine phosphatase nonreceptor 22-620W allele" docx

... Arthritis Research & Therapy Vol No Dieudé et al systemic lupus erythematosus and with autoimmune thyroid disease [12-19] The PTPN22 gene encodes for the intracellular tyrosine phosphatase LYP, ... seronegative for rheumatoid factor Transmission, percentage of heterozygous 1858C/T parents transmitting the 1858T allele The plan was to test the hypothesis for RF+ RA; analysis for all RA and ... Table Linkage analysis of the PTPN22-1858T allele to rheumatoid factor -seropositive (RF+) rheumatoid arthritis (RA) using the transmission disequilibrium test (TDT) Families Transmission [% (n)]...

Organometallic scaffolds as protein tyrosine phosphatase 1b inhibitor

... 1.1 Protein Tyrosine Phosphatase 1B as drug target 1.2 Organic inhibitors of Protein Tyrosine Phosphatases 1.3 Metal complexes as inhibitors of Protein Tyrosine Phosphatases ... problems, there has been an intensified search for new therapeutic treatments for T2DM and obesity 1.1 Protein Tyrosine Phosphatase 1B as drug target Protein tyrosine phosphatases (PTPs) belong ... towards PTP -1B, as opposed to TC-PTP, remain a daunting task Chapter 1.2 Organic inhibitors of Protein Tyrosine Phosphatases The organic inhibitors that target the active site of PTPs can be classified...

Tài liệu Báo cáo khoa học: Mitogen-activated protein kinase phosphatase-1 modulated JNK activation is critical for apoptosis induced by inhibitor of epidermal growth factor receptor-tyrosine kinase pdf

... system may be one of the mechanisms responsible for drug -induced apoptosis in a variety of JNK activation is critical for AG1478 -induced apoptosis cancer cells of different histotype [51] Chang ... RA & Davis RJ (2000) Requirement of JNK for stress -induced activation of the cytochrome c-mediated death pathway Science 288, 870–874 JNK activation is critical for AG1478 -induced apoptosis 49 ... Authors Journal compilation ª 2009 FEBS K Takeuchi et al JNK activation is critical for AG1478 -induced apoptosis A B a Fig Induction of apoptosis by AG1478 (A) PC-9 cells were seeded into a 96-well...

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... S103 G145/D137 Y 112 D2 01/ 193 L75/67 G145/D137 E1 41/ 133 K173 /16 5 R207 /19 9 G77/69 D142 /13 4 G197 /18 9 Fig Superposition of PRTFDC1 with HPRT-ImmGP (Protein Data Bank code: 1BZY) (A) Residues in the ... Welin et al Studies of the human PRTFDC1 B A PRTFDC1 25 HPRT 20 10 00 0.2 800 600 400 0 .1 200 –50 50 10 10 50 10 015 0 200 250 S 200 –50 250 50 12 00 10 0 15 0 [Hx] (µM) 2.0 PRTFDC1 50 10 0 15 0 200 250 ... 2.0 0 .16 ± 0.02 10 .5 ± 0.9 7.4 · 10 3 ± 1. 9 · 10 3 (0.26%) 2.9 · 10 6 ± 1. 0 · 10 6 (10 0%) 36 .1 ± 14 .3 9.9 ± 0.2 2.9 ± 0.7 899 ± 11 7 1. 36 ± 0.34 406 ± 53 3.9 · 10 4 ± 9.3 · 10 3 (0.09%) 4.5 · 10 7 ± 1. 0...

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... metal–ligand distances (Table 2) compare very favorably with data in the protein database, from ˚ which an average distance of 2.03 A for Fe–N(His) was inferred [38], and a target distance of ... from genomic DNA of B xenovorans LB400 through a PCR with GAGCGGCATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGGCATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, respectively ... enzymatic transformation revealed that Bxe _A2 876 catalyzed breakdown of the b-diketone substrate via oxidative carbon–carbon bond cleavage to yield methylglyoxal and acetate Kinetic characterization...

Xem thêm

Từ khóa: n kerstjens ha postma ds bischoff r 2009 protein tyrosine nitration selectivity physicochemical and biological consequences denitration and proteomics methods for the identification of tyrosine nitrated proteins j proteome res specific bacteria using amino acids and protein functional groups of heterotrophic bacteria ligand protein interactions of glutamate receptor functional interactions among cytoskeleton membranes and cell wall in the pollen tube of flowering plants receptor interactions of parathyroid hormone and parathyroid hormone related protein functional expression of g protein coupled receptors in yeast the role of receptor protein tyrosine phosphatases in axonal pathfinding functional studies of ribosomal protein mutants from salmonella enterica serovar typhimurium functional analysis of noncoding rnas in trypanosomes rna walk a novel approach to study rna rna interactions bet augmentation of cell growth overexpression of protein tyrosine kinases jm peluffo g radi r 2008 protein tyrosine nitration functional alteration or just a biomarker free radic biol med 45 357 366 srinivasen r uttamchandani m yao s q rapid assembly and in situ screening of bidentate inhibitors of protein tyrosine phosphatases ptps org lett 2006 8 713 716 functional neuroanatomy of pain functional role of iron functional analysis of the cervicalfunctional analysis of intergenic Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ