0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Design, structural and functional characterization of human beta defensin analogs

Design, structural and functional characterization of human beta defensin analogs

Design, structural and functional characterization of human beta defensin analogs

... anionic and cationic peptides 1.1.2.5 Fragments of larger proteins 1.1.3 The family of defensins 1.1.3.1 Expression of defensins 11 1.1.3.2 Expression of Human Beta Defensins 11 1.1.4 Human beta defensin- 3 ... diagrams of Selected Defensins A comparison of structures of different types of defensins (A) Human Neutrophil Peptide (Dimer), (B) Insect defensin A, (C) Human Beta Defensin- 3 and (D) Rhesus Theta defensin ... (Dimer), (B) Insect defensin A, (C) Human Beta Defensin- 3 and (D) Rhesus Theta defensin (Ganz et al., 2003) 10 Primary sequence of HBD-3 showing the helix and beta sheet regions and the proposed...
  • 143
  • 424
  • 0
Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt

Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt

... cross-linking efciency of Iba1 and Iba2 or in the overall morphology of the generated lament bundles Calcium afnity of Iba1 and Iba2 Homodimerization and actin binding of Iba1 and Iba2 were similar ... presented here reveals functional similarities and differences between Iba1 and Iba2 We investigated Ca2+ binding and homodimerization of Iba1 and Iba2 Furthermore, F-actin binding and cross-linking ... Human Iba proteins J O Schulze et al study has revealed expression proles for most of the human transcripts and uncovered different tissuespecic expression of Iba1 and Iba2 [5] For Iba1 ,...
  • 14
  • 546
  • 0
Báo cáo y học:

Báo cáo y học: "Structural and functional characterization of human apolipoprotein E 72-166 peptides in both aqueous and lipid environments" pot

... concentration of DHPC Protein -lipid interactions and Protein-LDLR binding of ApoE- (72-166) Proteins To identify and compare the lipid binding ability of the three apoE- (72-166) peptides, we assessed ... Received: 17 September 2010 Accepted: 10 January 2011 Published: 10 January 2011 References Weisgraber KH, Rall SC Jr, Mahley RW: Human E apoprotein heterogeneity Cysteine-arginine interchanges ... apoE3 and apoE4, and with apoE2-, apoE3-, and apoE4- (72-166) proteins, respectively The VLDL bands were shifted with the binding of apoE proteins Detailed procedures are described in Materials and...
  • 9
  • 333
  • 0
Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

... digestion fragments of untreated and deglycosylated AFP 1222 J C Achenbach and K V Ewart (Eur J Biochem 269) Ó FEBS 2002 Fig Analysis of antifreeze activity Antifreeze activity was evaluated qualitatively ... chemicals were reagent grade Purification of smelt AFP Blood plasma was obtained from a population of rainbow smelt (O mordax) caught in seawater along the northeastern coast of Newfoundland on ... staining when CaCl2 is added to the staining and washing buffer (Fig 1) Measurement of antifreeze activity Antifreeze activity was measured on equimolar amounts of deglycosylated and untreated...
  • 8
  • 518
  • 0
Báo cáo khoa học: Purification and functional characterization of human 11b hydroxylase expressed in Escherichia coli doc

Báo cáo khoa học: Purification and functional characterization of human 11b hydroxylase expressed in Escherichia coli doc

... volume and energetic properties of the binding of CO to hemoproteins Biophys J 66, 89–98 Tuckey RC & Kamin H (1983) Kinetics of O2 and CO Binding to adrenal cytochrome P-450scc Effect of cholesterol, ... was in the range of values determined in previous studies for the interaction between bovine Adx and bCYP11B1 Biacore measurements were performed to investigate the binding behavior between bovine ... the functional and structural consequences of two point mutations (P94L and A368D) in the CYP11B1 gene causing congenital adrenal hyperplasia resulting from 11 -hydroxylase deficiency J Clin Endocrin...
  • 12
  • 428
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Structural and functional characterization of the 5’ upstream region of a glutamine synthetase gene from Scots pine" pdf

... in all compared organisms We have also analyzed the presence of putative elements in the 5’ region of the gene There is a canonical TATA box at –35 bp from the transcription start site and a putative ... were used as controls 2.4 Gel retardation analysis A DNA fragment used for gel retardation analysis containing a sequence from the 5’- untranslated region of GS 1a was obtained by cleavage with ... with the reporter gene uidA and the presence of DNA-protein interactions in the 5’flanking region of GS 1a gene from Scots pine MATERIALS AND METHODS 2.1 Isolation of a genomic clone containing...
  • 6
  • 327
  • 0
Structural and functional characterization of TRX16, a thioredoxinlike protein and altering substrate specificity of a serine protease inhibitor

Structural and functional characterization of TRX16, a thioredoxinlike protein and altering substrate specificity of a serine protease inhibitor

... STRUCTURAL AND FUNCTIONAL CHARACTERIZATION OF TRX16, A THIOREDOXIN-LIKE PROTEIN AND ALTERING SUBSTRATE SPECIFICITY OF SPI1, A PROTEASE INHIBITOR PANKAJ KUMAR GIRI A THESIS SUBMITTED ... Farré and Casado, 2001; Laroux et al., 2001), atherosclerosis and other cardiovascular disorders, inflammation and chronic inflammation (Laroux et al., 2001; Latha and Babu, 2001), burns (Latha ... stress and characterization of its interaction with NF-kB Chapter IV presents the structure based rational design of altered specificity of a protease inhibitor Protease inhibitors play a decisive...
  • 145
  • 254
  • 0
Structural and functional characterization of haditoxin, a novel neurotoxin isolated from the venom of ophiohagus hannah (king cobra

Structural and functional characterization of haditoxin, a novel neurotoxin isolated from the venom of ophiohagus hannah (king cobra

... β-cardiotoxin, an all β-sheet protein isolated from the venom of Ophiophagus hannah (king cobra) Manuscript under preparation xvi (5) Roy A, Sivaraman J, and Kini RM Structural and functional characterization ... forests and mangrove swamps in parts of Southeast Asia, South China and India Chapter One A B C Figure 1.1: Ophiophagus hannah (king cobra) and its geographical distribution (A) An adult king cobra ... hypotensive and vasorelaxant properties Isolated from the venom of Atractaspis engaddensis These isopeptides are structurally and functionally related to mammalian endothelins They are potent vacoconstrictors...
  • 308
  • 442
  • 0
Structural and functional characterization of signaling protein complexes

Structural and functional characterization of signaling protein complexes

... List of Tables Page Table 1.1 List of common and important PTMs 23 Table 1.2 IQ motifs of established and potential CaM target proteins 37 Table 2.1 Data collection and refinement statistics of ... domains that mediate protein- protein, protein- lipid, and protein- DNA interactions (Fig 1.4) The most common protein- protein interaction domains in NRTKs are the Src homology (SH2) and (SH3) domains ... formation, crystallization and data collection Cloning of CaM, ΔNav1.6 Expression of ΔNav1.6 and association with CaM Expression and purification of CaM Pull down assays and gel filtration confirm...
  • 147
  • 397
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... S103 G145/D137 Y 112 D2 01/ 193 L75/67 G145/D137 E1 41/ 133 K173 /16 5 R207 /19 9 G77/69 D142 /13 4 G197 /18 9 Fig Superposition of PRTFDC1 with HPRT-ImmGP (Protein Data Bank code: 1BZY) (A) Residues in the ... Welin et al Studies of the human PRTFDC1 B A PRTFDC1 25 HPRT 20 10 00 0.2 800 600 400 0 .1 200 –50 50 10 10 50 10 015 0 200 250 S 200 –50 250 50 12 00 10 0 15 0 [Hx] (µM) 2.0 PRTFDC1 50 10 0 15 0 200 250 ... 2.0 0 .16 ± 0.02 10 .5 ± 0.9 7.4 · 10 3 ± 1. 9 · 10 3 (0.26%) 2.9 · 10 6 ± 1. 0 · 10 6 (10 0%) 36 .1 ± 14 .3 9.9 ± 0.2 2.9 ± 0.7 899 ± 11 7 1. 36 ± 0.34 406 ± 53 3.9 · 10 4 ± 9.3 · 10 3 (0.09%) 4.5 · 10 7 ± 1. 0...
  • 11
  • 770
  • 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢ For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the ... chain and hides a large amount of the hydrophobic surface area Surface area calculations for the pentamer give a total surface ˚ ˚ area of $ 81 000 A2 with 30% ($ 24 000 A2 ) as contact area Thus, ... Human adenovirus ⁄ 12 penton base chimera C Zubieta et al Fig The hAd2 ⁄ 12 and wild-type hAd2 penton base monomers (A) Ribbon diagram of the hAd2 ⁄ 12 penton base monomer is in blue (left) and...
  • 10
  • 647
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Functional characterization of human Cd33+ And Cd11b+ myeloid-derived suppressor cell subsets induced from peripheral blood mononuclear cells co-cultured with a diverse set of human tumor cell lines" docx

... this article as: Lechner et al.: Functional characterization of human Cd33+ And Cd11b+ myeloid-derived suppressor cell subsets induced from peripheral blood mononuclear cells co-cultured with a diverse ... serum and regulated by association of a latency protein, precluded clear neutralization data Characterization of human CD33+ and CD11b+ suppressor cells induced by tumor cell lines To characterize ... on a BD FACSCalibur flow cytometer and data acquisition and analysis were performed as above Data are from three unique donors and expressed as a fraction of labeled cells within a live -cell gate...
  • 20
  • 575
  • 0
Tài liệu Báo cáo khoa học: Interleukin-1-inducible MCPIP protein has structural and functional properties of RNase and participates in degradation of IL-1b mRNA doc

Tài liệu Báo cáo khoa học: Interleukin-1-inducible MCPIP protein has structural and functional properties of RNase and participates in degradation of IL-1b mRNA doc

... that MCPIP regulates the amount of IL-1b mRNA Involvement of PIN domain of MCPIP in the stability of IL-1b mRNA In order to find out whether the PIN domain in MCPIP is responsible for IL-1b mRNA ... interacting with MCPIP will clarify the dynamics and features of this protein Role of MCPIP in regulation of the endogenous IL-1b transcript level After identification of a PIN domain in the MCPIP ... shown) Of the identified proteins, 73% are proteins involved in mRNA stability, but there are also proteins involved in other cellular processes, such as actin Further studies characterizing proteins...
  • 14
  • 598
  • 0
Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

... UMPK The F133N mutation was created using UMP kinase from Ureaplasma parvum the following primers: F133N-fw (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT ... with ADP and UDP, and ADP showed a rate that was > 20 times that of UDP In order to determine the true Km for UMP and ATP, a two-substrate assay was performed at four concentrations of UMP and ATP ... et al UMP kinase from Ureaplasma parvum Swedish Research Council for the Environment, Agricultural Sciences, and Spatial Planning (FORMAS) References Pollack JD (2001) Ureaplasma parvum: an opportunity...
  • 12
  • 656
  • 0

Xem thêm

Từ khóa: out of the green yonder molecular cloning and functional characterization of beta carotene 15 15 apos oxygenasesstructural and functional roles of fsh and lh as glycoproteins regulating reproduction in mammalstructural and functional organization of the insect retinaacquisition preparation and functional assessment of human nk cells for adoptive immunotherapyisolation and functional studies of human fetal gastric epithelium in primary culturebrachypodium distachyon a new model system for structural and functional analysis of grass genomesidentification and functional characterization of srnas in neisseria meningitidispurification reconstitution and functional characterization of zinc transporter from rat renal brush border membranesmolecular and functional characterization of p glycoprotein in vitrostructural and functional modulation of ion channels by specific lipids from model systems to cell membranessome structural and functional substrates of development in young catsmethods for structural and chemical characterization of nanomaterialsdesign conformational functional and physiological characterization of recombinant polymeric heme proteinsdiverse domains of cytosine 5 dna methyltransferases structural and functional characterizatidesign and functional elements of a terrific web siteNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíBT Tieng anh 6 UNIT 2chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP