0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Thạc sĩ - Cao học >

The generation of native human monoclonal antibodies with neutralising activity for dengue virus 2

The generation of native human monoclonal antibodies with neutralising activity for dengue virus 2

The generation of native human monoclonal antibodies with neutralising activity for dengue virus 2

... 1.1.5.4 Virus assembly and propagation 17 1.1.6 Phylogeny of Dengue Virus 19 1.1.7 Pathogenesis of Dengue Virus 22 1.1.8 Immune response to Dengue Virus 26 1.1.8.1 Innate immunity to DV 26 1.1.8 .2 ... culture 62 2.8 Source of primary CD 22+ B cells 63 2. 9 RNA extraction and RT-PCR for serotyping of patients 63 2. 10 Cloning of B cells from Dengue virus- infected patients 64 2. 10.1 Preparation of feeder ... 60 2. 2 EBV virus production 60 2. 3 Dengue virus production 60 2. 4 Cryopreservation of cells 61 2. 5 Hybridoma cultures and antibody purification 61 2. 6 Ascites and antibody purification 62 2.7...
  • 17
  • 239
  • 0
The generation of native human monoclonal antibodies with neutralising activity for dengue virus 3

The generation of native human monoclonal antibodies with neutralising activity for dengue virus 3

... on the surface of the virus There are a number of different mechanisms postulated to prevent virus from entering the cell One way is for antibodies to alter the spatial distances 33 between the ... 6.0) of the trans Golgi network triggers dissociation of the prM/E heterodimers, which leads to the formation of 90 dimers that lie flat on the surface of the particle, with prM capping the fusion ... is a member of the Lymphocryptovirus genus, within the subfamily of Gammaherpesviruses, in the Herpesviridae family These viruses possess the ability to establish latent infection in the body throughout...
  • 199
  • 317
  • 0
GENERATION AND CHARACTERIZATION OF HUMAN MONOCLONAL ANTIBODIES WITH NEUTRALIZING ACTIVITY FOR DENGUE VIRUS

GENERATION AND CHARACTERIZATION OF HUMAN MONOCLONAL ANTIBODIES WITH NEUTRALIZING ACTIVITY FOR DENGUE VIRUS

... classification for dengue severity The new classification for dengue severity is divided into Dengue without Warning Signs, Dengue with Warning Signs, and Severe Dengue 24 1.2 Molecular Biology of DENV ... Fisher and Prof Leo Yee Sin, thank you for recruiting patients for our study To Prof Mary Ng and Boon, thank you for providing us with technical advice and reagents To Terence, thank you for your ... Figure 23 Binding activity of 10.15 to various strains of DENV2 and DENV1, and 101   Figure 24 Binding activity of 12.17 to various strains of DENV2 and DENV1, and ...
  • 201
  • 643
  • 0
Báo cáo y học:

Báo cáo y học: "Consolidating the set of known human protein-protein interactions in preparation for large-scale mapping of the human interactome" ppt

... the list of human interactions, we turned to literature mining We adopted the strategy of separately identifying the protein names in the abstracts and then matching up the interacting protein ... Combination of the interaction data creates a consolidated set of 31,609 interactions between 7,748 human proteins On the basis of this initial set of interactions, we estimate the scale of the human ... accuracy of large-scale human protein interaction assays, test the existing sets of interaction data for their relative accuracy, then apply these benchmarks in order to recover protein interactions...
  • 12
  • 208
  • 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... City, CA, USA) Isolation of anti-Cn2 scFv by panning of phage- antibody repertories The library of human scFv was displayed on filamentous phage and used for the selection of antibodies against ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC...
  • 11
  • 679
  • 0
Báo cáo y học:

Báo cáo y học: "The critical role of arginine residues in the binding of human monoclonal antibodies to cardiolipin" ppsx

... a single experiment only are shown in Figs 2,3,4 The importance of arginine residues in IS4VH As reported previously, the presence of the heavy chain of IS4 plays a dominant role in binding to ... 94 in CDR3 of UK4VL hinders DNA binding sterically A similar effect may be occurring with regards to the binding of UK4VL to CL The effect of point mutations of specific arginine residues in ... [27,37,41-43] In general, these studies have shown that altering the numbers of arginine residues in the CDRs of these antibodies can lead to significant alterations in binding to DNA Arginines in VH...
  • 10
  • 500
  • 0
Báo cáo y học:

Báo cáo y học: " Generation and characterization of high affinity human monoclonal antibodies that neutralize staphylococcal enterotoxin B" ppsx

... al.: Generation and characterization of high affinity human monoclonal antibodies that neutralize staphylococcal enterotoxin B Journal of Immune Based Therapies and Vaccines 2010 8:9 Submit your ... HuMAbs neutralize SEB-induced cytokine production by human lymphocytes To examine the biological activity of HuMAbs in vitro, a cell-based assay was employed that measures inhibitory Page of effects ... displayed the highest anti-SEB affinity, exhibited prophylactic as well as therapeutic activity in a mouse model of SEB-induced lethality Materials and methods Generation of HuMAbs Human B-cell hybridomas...
  • 9
  • 392
  • 0
báo cáo hóa học:

báo cáo hóa học:" Characterization of the tumor marker muc16 (ca125) expressed by murine ovarian tumor cell lines and identification of a panel of cross-reactive monoclonal antibodies" docx

... MOVCAR-9 MOVCAR-10 MOVCAR-1 MOVCAR-2 MOVCAR-9 MOVCAR-10 Figure Extra -and intracellular Muc16 expression by MOVCAR cells Extra -and intracellular Muc16 expression by MOVCAR cells (A) MOVCAR-10 cells ... cDNA was prepared cDNA was amplified with the following primer pairs from Integrated DNA Technologies: Muc16 5'-TGCCACCTACCAGTTGAAAG-3' and 5'-GTACCGCCAAGCAGATGAG-3'; GAPDH 5'-TGCTGAGTATGTCGTGGAGTCTA-3' ... ITS and 1% antibiotic-antimycotic The human epithelial ovarian tumor cell lines OVCAR-3, SKOV-3, and CAOV-3 were purchased from ATCC RT-PCR Total RNA was isolated from MOVCAR cell lines using the...
  • 7
  • 430
  • 0
Báo cáo y học:

Báo cáo y học: " HIV-1 neutralization by monoclonal antibody against conserved region 2 and patterns of epitope exposure on the surface of native viruses" pot

... P05877 ABY26917 AY669700 AAT675 32 219 22 0 22 1 22 2 22 3 22 4 22 5 22 6 22 7 22 8 22 9 23 0 23 1 23 2 23 3 23 4 23 5 23 6 23 7 23 8 23 9 24 0 D C2E 21 8 E P I P I H Y C T P A G Y A I L K C N D K N E F E E E F E ... 92BR 025 DU174 SF1 62 QH06 92 IIIB MN VI191 92RW009 92UG 024 AE AE AE C C B B B B A A D AAW57 720 AY 621 208 AY 621 222 AAB61 124 DQ411853 P19550 AY669730 AB037858 P05877 ABY26917 AY669700 AAT675 32 219 22 0 ... northern part of Thailand through National serosurveillance in the year 20 02, including MENO 12 (AY243187), MENO23 (AY243194), MENO24 (AY243195), MENO31 (AY24 320 2) and MENO43 (AY24 321 3) HIV-1 TCLA...
  • 8
  • 445
  • 0
Báo cáo y học:

Báo cáo y học: "Increased bleeding risk associated with the use of recombinant human activated protein C in patients with advanced liver diseas" potx

... that they may be at greatly increased risk for bleeding while receiving APC Because such patients were excluded from the major clinical trials of APC, it may be prudent to withhold therapy with ... epistaxis In a multivariate regression model that included race, sex, and Acute Physiology and Chronic Health Evaluation II score, cirrhosis remained independently associated with the risk of a bleeding ... 23.5, 95% confidence interval = 1.75–315) Of the five patients with ALD who had bleeding episodes, four died within 28 days of drug administration Interestingly, only one out of 12 patients who...
  • 2
  • 268
  • 0
The application of games in teaching grammar with reference to tieng anh 10 textbook at ha trung high school, thanh hoa province

The application of games in teaching grammar with reference to tieng anh 10 textbook at ha trung high school, thanh hoa province

... 2.1 Ha Trung high school and current situation of teaching and learning English at the school 2.1.1 Ha Trung high school 10 Ha Trung high school is one of the leading schools in Thanh Hoa province ... deals with the theories of the role of grammar, students’ motivation, and the application of games in teaching grammar It is important that it is carried 35 out to investigate the application of games ... teaching and learning grammar? - What benefits does the application of games in teaching grammar bring to teachers and students? - What kinds games should be used to teach the grammar of Tieng Anh...
  • 39
  • 1,577
  • 8
Refusals to invitations the use of vietnamese learners of english and the use of native speakers of english  a comparison

Refusals to invitations the use of vietnamese learners of english and the use of native speakers of english a comparison

... groups of participants: Vietnamese learners of English and native speakers of English For the Vietnamese group, we contacted most of the Vietnamese participants in person and some via e-mail to ask ... (Journal of Japanese Language Teaching), 87, 25 - 39 Lauper, J A (1997) Refusal strategies of native English speakers in Spanish and in English and of native English speakers in English Annual Meeting ... Beebe et al (1987), more advanced learners are more affected by the refusal strategies of their native language, whereas the native language of the learners in Yagamashira’s study had more influence...
  • 44
  • 1,183
  • 4
A STUDY ON THE TRANSLATION OF ENGLISH HUMAN RESOURCE MANAGEMENT TERMS INTO VIETNAMESE

A STUDY ON THE TRANSLATION OF ENGLISH HUMAN RESOURCE MANAGEMENT TERMS INTO VIETNAMESE

... Resource Management and Human Resource Management term I An overview of Human Resource Management The definition of Human Resource and Human Resource Management in Vietnam What is Human Resource Management? ... have long known to translators They are: SL Emphasis TL Emphasis Word-for-word translation Adaption Literal translation Free translation Faithful translation Idiomatic translation Semantic translation ... books, Human Resource Management of corporations and then edited by Human Resource Manager in Human Resource Management forums 24 Translation in the area of Human Resource Management Just appearing...
  • 70
  • 812
  • 1
Tài liệu The Language of Love: Deepen Your Relationship With Loving Communication pdf

Tài liệu The Language of Love: Deepen Your Relationship With Loving Communication pdf

... Each Other 13 The quest for love may be exciting, but the journey you embark on once you've found true love is much more spectacular… The Language of Love: Deepen Your Relationship With Loving ... Give them your full attention Turn off the computer, put down your book, turn down the TV – whatever is necessary to show them that they have your complete attention Then look at them while they ... each other, the better ★ Need to clean the garage? Each of you take one half of it and have a contest to see who can the best job in the least amount of time Doing it together can take the "chore"...
  • 14
  • 443
  • 0

Xem thêm

Từ khóa: generation of enantiomerically pure carboxylic acids with chiral centers in the α positionthe generation of term definitionsthe generation of paraphrasesthe nature of management is to cope withthe nature of management is to cope with and farreaching challengesthe value of muscle exercise in patients with alsthe application of games in teaching grammar with reference to tieng anh 10 textbook at ha trung high school thanh hoa provincewhat is the importance of body language in communicating with a client with dementiathe art of living human resources bangalorethe effects of nitrogen form on interactions with potassiuma shell system for the generation of clinical documentsthe evolution of strategic human resource managementthe concept of strategic human resource managementthe definition of strategic human resource managementthe meaning of strategic human resource managementBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM