Anti tumor properties of lactobacilli are mediated by immuno modulation and direct cytotoxicity
Anti tumor properties of lactobacilli are mediated by immuno modulation and direct cytotoxicity
... ANTI- TUMOR PROPERTIES OF LACTOBACILLI ARE MEDIATED BY IMMUNO- MODULATION AND DIRECT CYTOTOXICITY CAI SHIRONG B.Sc (Hons), NUS A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... the anti- tumor properties of LGG and compare it with that of other lactobacillus strains The study is divided into main areas: I Immuno- modulation by lactobacilli: To study the receptors and ... tumor growth in C3H mice [69] Aside from anti- tumor properties, lactobacilli also showed potential anti- metastatic properties as demonstrated by inhibition of lung and lymph node metastases by...
- 200
- 314
- 0
Báo cáo khoa học: Differences in substrate specificities between cysteine protease CPB isoforms of Leishmania mexicana are mediated by a few amino acid changes potx
... specificities of the recombinant cysteine proteinases CPB of Leishmania mexicana, and cruzain of Trypanosoma cruzi, using fluorescent substrates containing non-natural basic amino acids Mol Biochem Parasitol ... proteinase, CPB, of Leishmania mexicana compared with cruzain, human cathepsin L and papain using substrates containing non-natural basic amino acids Eur J Biochem 268, 1206–1212 13 Alves, L.C., ... determined by just a few amino acids In order to explore the effects on substrate utilization of the restricted local amino acid variations of the CPB isoenzymes of L mexicana, the recombinant CPB3 ...
- 11
- 543
- 0
Tài liệu Báo cáo khoa học: Regulators of G-protein signalling are modulated by bacterial lipopeptides and lipopolysaccharide pptx
... RGS are modulated by lipopeptides and LPS S Riekenberg et al to the number and length of their fatty acids and the amino acid sequence of their peptide tail To address TLR2 ⁄ 1- and TLR2 ... modulation of RGS1 and RGS2 in BMDM after stimulation with LP and LPS in more detail, because regulation of RGS1 and RGS2 after activation of different TLR may modify the effects of G-protein signalling ... et al RGS are modulated by lipopeptides and LPS Relative expression of RGS1 mRNA Fig Expression of RGS1, RGS2 and TNFa mRNA in J774 After stimulation with 100 ngÆmL)1 LPS, 100 nM FSL-1 and 100...
- 11
- 569
- 0
Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc
... focus on the biochemical properties of both splice variants of hGBP5, hGBP 5a ⁄ b (amino acids 1 -58 6) and the C-terminally truncated hGBP5ta (amino acids 1-489), using isothermal titration calorimetry ... hGBP1 and other large GTPases, we analysed the enzymatic activity of hGBP 5a ⁄ b and hGBP5ta in a concentration-dependent manner Various concentrations of purified hGBP 5a ⁄ b and hGBP5ta were incubated ... Biophysical properties of hGBP 5a ⁄ b and hGBP5ta M Wehner and C Herrmann hand, interact dynamically with the bound nucleotide, and usually bind nucleotides in the micromolar range In addition to these...
- 9
- 462
- 0
Báo cáo khoa học: Vanadium-induced apoptosis of HaCaT cells is mediated by c-fos and involves nuclear accumulation of clusterin pptx
... expression of CLU or b-actin (E) Cytoplasmic (C) and nuclear (N) extracts isolated from confluent monolayers of HaCaT Neo and HaCaT c-fos cells and total proteins isolated from HaCaT cells and HaCaT cells ... period of days (C) Confluent monolayers of HaCaT Neo and HaCaT c-fos cells were cultured for 24, 48 and 72 h in the presence of serum, and DNA isolated from floating and attached cells was analyzed by ... expression of c-fos oncoprotein and the expression and ⁄ or processing of CLU in HaCaT NeoT and HaCaT Bcl-2 cells (Fig 5C) Whereas treatment of HaCaT NeoT cells with VOSO4 induced the expression of c-fos...
- 16
- 312
- 0
Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx
... GCGAAGCTTACCAGACCGTGGACTAACGA CCCACCGTCTTCGAGAACTA CTTCCTTGGTCTTGGCAGAG CCAGACTAGATGTAGTATTTTTTG ATTAGAGCCAGATGCTTAAGTCC ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA and then treated with TGFb1; alternatively ... regulators of the activity of the RhoB promoter Smad2 and Smad3 proteins activate RhoA and RhoB GTPases and induce actin polymerization and microfilament reorganization in Swiss 3T3 fibroblasts To examine ... small GTPases RhoA and RhoB, and that this activation is essential for Rho GTPases ⁄ Smad proteins in TGFb-induced actin reorganization TGFb-induced actin cytoskeleton reorganization in fibroblasts...
- 14
- 420
- 0
Large scale synthesis, characterization and photoluminescence properties of amorphous silica nanowires by thermal evaporation of silicon monoxide
... single step process using thermal evaporation of silicon monoxide under argon atmosphere with traces of oxygen The nanowires were free from metal contaminations and showed blue photoluminescence at ... its simplicity and the low cost Conclusions Amorphous silicon dioxide nanowires of several hundred microns in length and tens of nanometers in diameter have been synthesized in bulk by a non-catalytic ... Ni) was found to be essential for the SiOx nanowires growth and also different from bi-cycle chain-like morphology of silica nanowires observed by Kar and Chaudhuri [14] during carbon-assisted...
- 5
- 600
- 1
structural and electrochromic properties of tungsten oxide prepared by surfactant-assisted process
... of microstructural and electrochromic properties of the nanostructured tungsten oxides with mesopores from the TMDD surfactantassisted process The crystallization status, surface morphology and ... surfactant was used as a structural- directed template, mesoporous tungsten oxide was obtained by the modified sol–gel route The microstructural properties of the as -prepared tungsten oxides thin films ... Spectroelectrochemical and monochromatic Fig Survey scan XPS spectra (a) and W 4f high-resolution XPS spectra (b) for tungsten oxide films of sample A, sample C and sample D, and O 1s level peak analysis of sample...
- 7
- 630
- 0
Báo cáo khoa học: Functional transitions of F0F1-ATPase mediated by the inhibitory peptide IF1 in yeast coupled submitochondrial particles pdf
... determine the affinity of the latent state (E ¼ in the above scheme) of the ATPase for IF1: Kd is % lM This value is much higher than the Kd for the IF1 ATPase interaction in the absence of D~Hþ ... states of ATPase (or GTPase): where E is the only active form of ATPase During ATP hydrolysis, IF1 can bind to the ATPase both in the absence and in the presence of D~Hþ Only in the presence l of ... undergoes inhibition by IF1 Due to the presence of the uncoupler, this second inhibition cannot be reversed anymore In the case of GTP hydrolysis, the dependency of the uncoupler-induced ATPase on IF1...
- 8
- 293
- 0
Báo cáo khoa học: Redox properties of cytochrome P450BM3 measured by direct methods potx
... Conclusions We determined the redox properties of cytochrome P450BM3 by direct electrochemistry The holoenzyme response at a DDAB-modified EPG electrode was characterized by redox couples at )0.388 ... This type of plot can be used to calculate the electron transfer rate constant Ó FEBS 2003 Redox properties of cytochrome P450BM3 (Eur J Biochem 270) 4085 Fig Influence of pH on the heme redox potential ... 2003 Redox properties of cytochrome P450BM3 (Eur J Biochem 270) 4087 [30,34,35] Given the fast electron transfer rates and low potentials necessary for the first electron reduction of the P450BM3...
- 7
- 382
- 0
Most cases of STEMI are caused by a thrombotic occlusion of a larger coronary artery (5). The pptx
... Hiratzka LF, Hunt SA, Jacobs AK; American College of Cardiology; American Heart Association Task Force on Practice Guidelines; Canadian Cardiovascular Society ACC/AHA guidelines for the management ... contraindications dosing and recommended adjunct treatment see Tables 4-7) The finding that most myocardial infarctions were caused by thrombotic occlusion of a coronary artery was of outstanding ... to pharmacoinvasive therapy, the strategy of facilitated PCI relies on the idea that early initiation of pharmacotherapy (GP IIb/IIIA receptor blockers and/or thrombolytics) may lead to a more...
- 12
- 323
- 1
báo cáo hóa học:" Anti-tumor activity of patient-derived NK cells after cell-based immunotherapy – a case report" doc
... primary colon carcinoma before start of the NK cell-based therapy, the anastomotic relapse before start of the NK cell-based therapy and the duodenom metastases after finishing the NK cell-based ... line phosphatase, γ-glutamine transferase, alanine aminotranferease (ALT), aspartate aminotransferase (AST), lactate dehydrogenase, Quick, and aPTT were determined before each leukapheresis Blood ... (data not shown) Therapy was interrupted for months after the 6th re-infusion and the analysis of circulating NK cells after the therapy break revealed that the increased cytolytic capacity against...
- 18
- 541
- 0
Báo cáo hóa học: "Evaluation of the anti-angiogenic properties of the new selective aVb3 integrin antagonist RGDechiHCit" potx
... indicates the importance of RGDechiHCit in the selective inhibition of endothelial aVb3 integrin Such inhibition opens new fields of investigation on the mechanisms of angiogenesis, offering clinical ... this article as: Santulli et al.: Evaluation of the anti-angiogenic properties of the new selective aVb3 integrin antagonist RGDechiHCit Journal of Translational Medicine 2011 9:7 Submit your ... the Guide for Page of 10 the Care and Use of Laboratory Animals published by the National Institutes of Health in the United States (NIH Publication No 85- 23, revised 1996) and approved by the...
- 10
- 539
- 0
báo cáo hóa học: " Inhibition of secreted phospholipase A2 by neuron survival and anti-inflammatory peptide CHEC-9" docx
... models of neurodegenerative disease Neurodegeneration and PLA2 isoforms The survival- promoting and anti-inflammatory effects of CHEC-9 are most readily explained by the inhibition of PLA2 activity, ... systemic elevation of sPLA2s are associated with most forms of inflammation [1-5] The secreted isoforms are part of a growing family of PLA2 enzymes whose activity leads to the production of several ... oxidative stress, and therefore are consistent with the peptide' s performance in vivo Methods Sources and preparation of sPLA2 Purified secreted phospholipase A2 group I from the venom of the Mozambique...
- 9
- 293
- 0
Báo cáo hóa học: " Tuning the electronic properties of boron nitride nanotube by mechanical uni-axial deformation: a DFT study" docx
... obvious that besides the size and shape of nanomaterials, the electronic properties can be further Page of 11 adjusted by applying the mechanical deformation Since BNNTs have some material properties ... increase under the larger strain However, the BO of the B-N bond parallel to the axial becomes smaller at larger strains The increase and decrease in the BO values for the slanted and parallel ... performed the data analyze YCW drafted the manuscript and participated in its design SPJ participated in the design of the study and conceived of the study All authors read and approved the final manuscript...
- 11
- 408
- 0
Từ khóa: electronic properties of carbon nanotubes probed by magnetic measurementsbird s eye view of the standards promulgated by the iasc and interpretations committee sic that are still in forceantimicrobial and anti adhesive potential of a biosurfactants produced by candida speciespreparation and properties of sio2 thin films by the sol gel method using photoirradiation and its application to surface coating for displaymost cases of abuse are reported by medical professionalsprinciples of marketing 14th edition by philip kotler and gary armstrongnumerical solutions of nonlinear algebraic equations by secant bisection and newtonraphson methodsprinciples of marketing 14th edition by philip kotler and gary armstrong pptprinciples of marketing 14th edition by philip kotler and gary armstrong free downloadprinciples of marketing 14th edition by philip kotler and gary armstrong pdfprinciples of marketing 15th edition by philip kotler and gary armstrongwhat type of clouds are called fair weather clouds and look like floating cottonwhat two types of clouds are called fair weather clouds and look like floating cottonudp packets are received by a datagramsocket and translated into a datagrampacket objectburden of disease in dalys by cause sex and income group in who regions estimates for 2004chuyên đề điện xoay chiều theo dạngđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ