Structure and mechanism of hormone perception and signal transduction by abscisic acid receptors

... complex structures 96 Figure 38 Cartoon summary of the gate-latch-lock mechanism of ligand perception and signal transduction by the PYL ABA receptors 99 Figure 39 Mutations in the PYR1 latch and ... mechanism of signalling by ABA receptors 78 3.6 Selective pyrabactin activation and antagonism of PYLs 83 3.6.1 Mechanism of pyrabactin-mediated receptor activation 86 3.6.2 Mechanism of PYL2 ... inhibition of the phosphatase Hence, we identified a ‘gate-latch-lock’ mechanism of hormone binding and signal transduction by the PYL ABA receptor These structural observations were supported by interaction...

Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

... in Role of helix and C-termini in bradykinin receptors receptor signaling because: (a) interruption of the amphipathic structure of B1wt helix in B1wt and B1KB2 through the presence of a serine ... TSIfiAAA N3 38* B1wt B1RB2 B1NB2 B1CB2 B1KB2 B1KB2 ⁄ SfiV B1KB2 ⁄ QGVfiKQ B1KB2 ⁄ VCfiCV B1YB2 B1V323S 10400 5020 52 98 383 2 625 127 511 1701 182 3 17 58 2142 1 786 2957 84 6 3.91 ± 1.06 3.76 ± 1.61 2 .82 ± 0.92 ... Faussner et al Role of helix and C-termini in bradykinin receptors Fig Schematic representation of the C-terminal B1wt and B2wt sequences and chimera thereof The C-terminal sequences beginning at transmembrane...

Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx

... GCGAAGCTTACCAGACCGTGGACTAACGA CCCACCGTCTTCGAGAACTA CTTCCTTGGTCTTGGCAGAG CCAGACTAGATGTAGTATTTTTTG ATTAGAGCCAGATGCTTAAGTCC ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA and then treated with TGFb1; alternatively ... regulators of the activity of the RhoB promoter Smad2 and Smad3 proteins activate RhoA and RhoB GTPases and induce actin polymerization and microfilament reorganization in Swiss 3T3 fibroblasts To examine ... small GTPases RhoA and RhoB, and that this activation is essential for Rho GTPases ⁄ Smad proteins in TGFb-induced actin reorganization TGFb-induced actin cytoskeleton reorganization in fibroblasts...

Báo cáo khoa học: Gain of structure and IgE epitopes by eukaryotic expression of the major Timothy grass pollen allergen, Phl p 1 pdf

... bacterially expressed rPhl p and exposed to dot-blotted bacterial recombinant (PrPhl p 1+ ) or eukaryotic recombinant Phl p (ErPhl p 1+ ) PrPhl p 1- and ErPhl p 1- show the IgE binding without preadsorption ... p (nLol p 1) , natural Phl p (nPhl p 1) , eukaryotic recombinant Phl p (ErPhl p 1) and bacterial recombinant Phl p (PrPhl p 1) B and C represent immunoblots probed with rabbit anti- (Phl p Ig) antiserum ... coli (PrPhl p 1) and baculovirus-infected insect cells (ErPhl p 1) PrPhl p ErPhl p Patient number IgE binding (c .p. m.) IgE binding (c .p. m.) 15 8 4544 724 10 10 963 11 93 865 6370 2309 2980 3 918 3889...

Báo cáo khoa học: Death-associated protein kinase (DAPK) and signal transduction: ﬁne-tuning of autophagy in Caenorhabditis elegans homeostasis doc

... death-associated protein kinase (DAPK) in the regulation of autophagy Fine-tuning of autophagy in C elegans homeostasis is particularly interesting DAPK is a serine ⁄ threonine kinase originally isolated ... responding to growth factors and amino acid signaling, (b) AMP-activated protein kinase, which activates autophagy through the inhibition of mTOR signaling, (c) Bcl-2, which binds to Beclin and inhibits ... that autophagy may play a protective role in diverse neurodegenerative diseases Aging Fig Schematic diagram of autophagy signaling pathway in C elegans Autophagy inducing- and inhibiting signaling...

Báo cáo khoa học: Molecular and genetic characterization of osmosensing and signal transduction in the nematode Caenorhabditis elegans docx

... this minireview is to summarize what is currently known about the molecular mechanisms of osmotic stress resistance, osmosensing and signal transduction in C elegans Osmosensing and signaling in ... process of interest, allows genes to be ordered into pathways, and can provide important and novel mechanistic insights into the molecular structure and function of proteins In addition to forward genetic ... factor signaling in the hypodermis regulates whole animal ﬂuid balance [10] The intestine of adult C elegans is comprised of 20 epithelial cells that function in digestion and nutrient absorption In...

Plant physiology - Chapter 14 Gene Expression and Signal Transduction potx

... pathways in which one or Gene Expression and Signal Transduction (A) Tryptophan operon 5′ DNA Regulatory gene i Transcription Promoter p Operator o 3′ Gene E Gene D Gene C Gene B Gene A Transcription ... on other genes Other important protooncogenes that encode nuclear transcription factors include MYC and MYB Both phytochrome (see Chap- Gene Expression and Signal Transduction ter 17) and gibberellin ... 2 CHAPTER 14 is known about these pathways in plants, we will provide background information on gene expression and signal transduction in other organisms, such as bacteria, yeasts, and animals,...

Báo cáo khoa học: Death-associated protein kinase (DAPK) and signal transduction pptx

...

Báo cáo khoa học: Death-associated protein kinase (DAPK) and signal transduction: additional roles beyond cell death ppt

... responses by death- associated protein kinase Proc Natl Acad Sci USA 106, 1457–1461 Michie AM, McCaig AM, Nakagawa R & Vukovic M (2009) Death- associated protein kinase (DAPK) and signal transduction: ... elegans during starvation Genes Dev 21, 2161–2171 Kang C & Avery L (2009) Death- associated protein kinase (DAPK) and signal transduction: ﬁne-tuning of autophagy in Caenorhabditis elegans homeostasis ... depletion of death- associated protein kinase promotes apoptosis J Biol Chem 278, 51587–51593 Chuang YT, Fang LW, Lin-Feng MH, Chen RH & Lai MZ (2008) The tumor suppressor death- associated protein kinase...

Báo cáo khoa học: Death-associated protein kinase (DAPK) and signal transduction: blebbing in programmed cell death docx

... actin cortex under the membrane of blebs in ﬁlamin-deﬁcient blebbing cells has not been examined in blebs of cells undergoing cell death Although the proteins involved in the execution of blebbing ... tropomyosin and the actin-bundling protein, a-actinin Finally, myosin is recruited and is concentrated in a few distinct dots along the cortex [4] When examined by scanning electron microscopy in detergent-extracted ... cortex The role of death- associated protein kinase (DAPK) in blebbing, apoptosis and autophagy DAPK is a calcium ⁄ calmodulin-regulated, cytoskeleton-associated serine ⁄ threonine kinase that functions...

Báo cáo khoa học: Death-associated protein kinase (DAPK) and signal transduction: regulation in cancer ppt

... (BMS-354825) tyrosine kinase inhibitor suppresses invasion and induces cell cycle arrest and apoptosis of head and neck squamous cell carcinoma and non-small cell lung cancer cells Clin Cancer Res 11, ... little clinical beneﬁt in the treatment of solid tumours and are now being tested in combination therapies [47] Tyrosine kinase inhibitors are widely and successfully used in the treatment of cancer, ... (2009) Death-associated protein kinase (DAPK) and signal transduction: blebbing in programmed cell death FEBS J 276, doi:10.1111/j.1742-4658.2009.07412.x Kang C & Avery L (2009) Death-associated protein...

Báo cáo khoa học: M1 – Peptidomimetics and Signal Transduction Inhibition potx

... movens’’ of Ab 1–4 2 toxicity In fact, both Ab 1–4 0 and 1–4 2 have been shown to form ion channels in planar bilayer membranes.[1, 2] Besides, Ab 1–4 2 has been shown to perturb and increase the ... activation of innate and adaptive immune responses, inﬂammation and prevention of apoptosis NF-jB1 and NF-jB2 require – proteolytic processing to produce the mature p50 and p52 NF-jB subunits ... while PknG inhibition, kinase selectivity, metabolic stability, solubility and membrane permeability were monitored and results were fed back to synthetic plans PknG inhibition of the new and protected...

Báo cáo y học: "Cancer, oncogenes and signal transduction" pps

... that asymmetric localization of Numb requires both a temporal signal mediated by the activation of Aurora by the Cdc2 cell-cycleregulatory kinase as well as a spatial signal provided by a complex ... of years ago much excitement was caused by the finding that most melanomas are caused by mutations in the B-Raf kinase that result in activation of the ERK pathway Remarkably, both activating and ... identifying targets of kinase inhibitors may not only lead to knowledge concerning the overall specificity of inhibitors, but, when used with clinically approved drugs, could potentially lead...

báo cáo khoa học: " Arabidopsis WRKY2 transcription factor mediates seed germination and postgermination arrest of development by abscisic acid" pdf

... important regulators of the transcripts of WRKY2 by ABA treatment Our results suggest that WRKY2 transcription factor mediates seed germination and postgermination developmental arrest by ABA Methods ... important regulator of postgermination developmental arrest mediated by ABA Postgermination proteolytic degradation of the essential ABI5 transcription factor is interrupted by perception of an increase ... ABA-dependent seed germination and postgermination growth arrest In this study, we report that wrky2- 1 and wrky2- 2 mutants are hypersensitive to ABA during germination and postgermination early...

Báo cáo y học: "Gene regulation and signal transduction in the immune system" pptx

... promoting B-cell development by restraining the expression of pro-myeloid factors (such as Gfi1), and acting directly to induce the recombinase (Rag) genes and thereby recombination at the immunoglobulin ... the immunoglobulin heavy-chain locus Interestingly, Ikaros was found to bind at pericentromeric satellite DNA and could therefore play a role in the silencing of genes encoding key developmental ... chromatin, whereas Rag2 binding mirrored H3K4 trimethylation patterns, consistent with the results of Oettinger The role of the enzyme activation-induced cytidine deaminase (AID) in antibody diversification...

Xem thêm