Development of bismuth based visible light driven photocatalysts for the degradation of organic pollutants
Development of bismuth based visible light driven photocatalysts for the degradation of organic pollutants
... where χ is the electronegativity of the semiconductor which is taken as the geometric mean of the electronegativities of the component elements of the semiconductor, Ee is the energy of the free ... XII Summary Organic pollutants becomes a pervasive threat with the step forward of human beings Photocatalysis is an effective method for the degradation of organics Since visible light is much ... process The oxidative degradation of most organic pollutants by O2 is thermodynamically favorable, i.e the overall degradation reaction is exothermic However, the uncatalyzed reactions of triplet...
- 260
- 385
- 0
Modified titanium dioxide (tio2) photocatalysts for the degradation of organic pollutants in wastewater
... consists of two co-axial cylinders When the inner cylinder is rotated at a certain speed, the unsteady flow within the annulus allows the fluids to recirculate from the vicinity of the rotating inner ... toxic organic pollutants In addition, the increasing population of the world is also escalating the requirements of pure water for drinking and household purpose The high population density and the ... Anpo, for his support during my stay in Japan for the research cooperation and Prof Zou Zhigang, for his kindly advice and guidance during my stay in China for the research collaboration for this...
- 236
- 411
- 0
Visible Light Driven Photoelectrochemical Water Oxidation onNitrogen-Modified TiO2Nanowires
... better visible light absorbance, although unfortunately this has not always lead to better water oxidation performance and photocatalytic activity.13,22 However, it is clear that by using a water oxidation ... N-modified TiO2 films Water Oxidation Catalyst for N-Modified TiO2 Nanowire Films In PEC water splitting, the water oxidation half reaction is normally more challenging than water reduction and ... substitutional N species found at 394 eV is likely the main contributor to visible light absorption and changes in the water photo -oxidation performance in the TiO2 nanowire films, as shown in the next...
- 7
- 414
- 0
The development and study of titanium dioxide based buoyant composite photocatalyts for improved applications in photocatalytic degradation of organic pollutants in aqueous solutions
... THE DEVELOPMENT AND STUDY OF TITANIUM DIOXIDE BASED BUOYANT COMPOSITE PHOTOCATALYSTS FOR IMPROVED APPLICATIONS IN PHOTOCATALYTIC DEGRADATION OF ORGANIC POLLUTANTS IN AQUEOUS SOLUTIONS ... provide some preliminary information about the combination of the buoyant composite photocatalyst with an adsorbent component and the performance of the buoyant composite photocatalyst in phenol removal ... (lower than the melting point of the plastic substrate) (b) To evaluate the photoactivity of the prepared buoyant composite photocatalysts for their performance in photocatalytic degradation of some...
- 192
- 448
- 0
Báo cáo khoa học: Data-driven docking for the study of biomolecular complexes pptx
... In the docking literature one often finds the distinction between ‘bound’ and ‘unbound’ docking: the former refers to docking using the structures of the single proteins as they are present in the ... assessment of which residues of the labeled molecule are perturbed by the formation of the complex One then repeats this procedure with the second molecule labeled Under the assumption that the perturbed ... for the deleted atoms [13] Another point is that one should, in principle, always check whether the mutants not affect the 3D structure of the free components themselves, i.e whether or not the...
- 20
- 489
- 0
SYNTHESIZE AND INVESTIGATE THE CATALYTIC ACTIVITY OF THREE-WAY CATALYSTS BASED ON MIXED METAL OXIDES FOR THE TREATMENT OF EXHAUST GASES FROM INTERNAL COMBUSTION ENGINE
... The Tien Synthesize and investigate the catalytic activity of three-way catalysts based on mixed metal oxides for the treatment of exhaust gases from internal combustion engine CONTENT OF THESIS ... Nguyen The Tien 18 Synthesize and investigate the catalytic activity of three-way catalysts based on mixed metal oxides for the treatment of exhaust gases from internal combustion engine of three-way ... Nguyen The Tien Synthesize and investigate the catalytic activity of three-way catalysts based on mixed metal oxides for the treatment of exhaust gases from internal combustion engine LIST OF TABLES...
- 117
- 376
- 0
Báo cáo toán học: " Pyramid-based image empirical mode decomposition for the fusion of multispectral and panchromatic images" pptx
... (2) image fusion using the mixed IMFs of panchromatic and MS images; and (3) quality assessment of the fused image The test data include SPOT images of a forest area and QuickBird images of a ... are the gray value of the fused and MS images, respectively μF is the mean of fused image, μM is the mean of MS image, and m and n are the image sizes 3.1.4 Entropy 3.1 Quality evaluation of the ... 0.7 m and Figure Workflow of EMD-based image fusion 2.8 m, respectively The two images were of the same path, and the panchromatic and MS QuickBird images were taken simultaneously The standard...
- 12
- 558
- 0
Báo cáo y học: " Serodiagnosis of sheeppox and goatpox using an indirect ELISA based on synthetic peptide targeting for the major antigen P32" ppt
... goatpox using an indirect ELISA based on synthetic peptide targeting for the major antigen P32 Virology Journal 2010 7:245 Authors’ details Key Laboratory of Animal Virology of Ministry of Agriculture, ... in the sequence alignment and drafted the manuscript YC and JW carried out the MNT and established indirect ELISA YS participated in the design of the study and performed the statistical analysis ... sensitive and specific for SPPV and GTPV antibody detection, and was easier to produce and perform, and less expensive, than existing serological methods for SPPV and GTPV antibody detection The results...
- 4
- 323
- 0
Báo cáo y học: "yrGATE: a web-based gene-structure annotation tool for the identification and dissemination of eukaryotic genes" pdf
... ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA CTCAAAAGCCTTTGAGCAGCAACTTCTTGATATGGGAGCAAAAGT TTCAAAAACTTTCAACAAGCGCGTGACACATGTAGTCTTCAAAGA TGGACATTCAACTACATGGAGAAAAGCACAGGATGCTGGTGTAAA blastn blastx tblastx Protein Coding Region Start ... 19824860 957488 ACTCGAGGATGACACTTCGGCCGATGAGGTACAAGTTTCTTCTATTTGTTTTGGAATAAAGTGTAATCGCCGTGCTTAATGATTTTCCCACAATCGATCAGCAGGATAAGGAGATTGATCTGCCAGAGTCCATT ACTCGAGGATGACACTTCGGCCGATGAG>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>CAGGATAAGGAGATTGATCTGCCAGAGTCC ... user-friendly character of the yrGATE system contributes to its accessibility and to its potential for community adoption Annotation tool The Annotation Tool of the yrGATE package is a web-based utility...
- 11
- 467
- 0
Development of organic inorganic composites by sol gel method for tooling materials
... reinforcement phase, or both in the composites Sol gel composites comprise inorganic- inorganic composites and organic- inorganic composites By doping ceramic reinforcement phase in inorganic sol gel ... DEVELOPMENT OF ORGANIC/ INORGANIC COMPOSITES BY SOL GEL METHOD FOR TOOLING MATERIALS LIU FENGMIN (B Eng., Beijing University of Aeronautics & Astronautics) A THESIS SUBMITTED FOR THE DEGREE OF ... volume of SiC-filled 61 organic/ inorganic composites Figure 4-14 Thermal conductivity of different volume of SiO2-filled 62 organic/ inorganic composites Figure 4-15 Organic/ inorganic composites...
- 106
- 465
- 0
apress pro.dynamic..net.4.0.applications.data-driven.programming.for.the..net.framework
... http://www.springeronline.com For information on translations, please e-mail info @apress. com, or visit http://www .apress. com Apress and friends of ED books may be purchased in bulk for academic, corporate, ... titles For more information, reference our Special Bulk Sales–eBook Licensing web page at http://www .apress. com/info/bulksales The information in this book is distributed on an “as is” basis, without ... Although every precaution has been taken in the preparation of this work, neither the author(s) nor Apress shall have any liability to any person or entity with respect to any loss or damage caused...
- 265
- 597
- 0
Occurrence of Polyhydroxyalkanoate as Temporal Carbon Storage Material in Activated Sludge during The Removal of Organic Pollutants
... carbon storage is one of the important processes for the DOC removal in activated sludge CONCLUSIONS The occurrence of temporal carbon storage material, PHA, was confirmed in the course of wastewater ... calculated as the amount of PHA increased during the anaerobic phase divided by the amount of carbon supplied as influent in one cycle For continuous reactors, CRP value was calculated as follows The ... water was added to it, the tube was shaken, and, the methyl ester of PHA monomers in the chloroform layer was collected The chloroform phase was washed again with 0.5mL water, and then injected...
- 7
- 490
- 0
Tài liệu Risk Characterization, Assessment, and Management of Organic Pollutants in Beneficially Used Residual Products pdf
... a method of quantifying variability and uncertainty in risk A tiered approach to PRA is recommended for Superfund sites, beginning with a point-estimate analysis or deterministic risk assessment, ... data used in the model, the more representative the model output can be of land application at field scales The intent of introducing this approach is to encourage all involved in sustainable land ... eliminated, with management practices shifting to either landfilling or incineration The financial impact associated with a shift in management practices for biosolids alone was estimated to be in...
- 11
- 657
- 1
Từ khóa: rapid an aptamer based mrna affinity purification technique for the identification of rna and protein factors present in ribonucleoprotein complexesbased low cost telemetric lidar for the continuous monitoring of urban particulate matterand a tyrosine based motifs are both required for the tgn localization of cd25 mulv and cd25 mpmv chimeraseffects of climate change on fate and behavior of organic pollutantsfactors determining the toxicity of organic pollutants to animals and plantsfate effects and analysis of organic pollutantsisolated enzymes for the transformation and detoxification of organic pollutantsthe environmental impact of organic pollutants future prospectsdesign and development of arm processor based web server free downloaddesign and development of arm processor based web server 2009design and development of arm processor based web server pptdesign and development of arm processor based web serverdesign and development of arm processor based web server u2013 2009design and development of arm processor based web server 2009recommendations for nutrient intakes and for the development of food based dietary guidelineschuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ