Molecular and cellular functions of the alternatively spliced isoforms of GDNF receptor complex in neuronal differentiation

... pathways involved in the activation of specific proteins, mRNAs and miRNAs through combinatorial interactions of GFLs, GFRα and RET receptor isoforms and provides novel insights into the diverse functions ... ligand receptor systems and microRNAs during neuronal differentiation of NTera2 neuroprogenitor cells (Chapter 8) The findings in this thesis further highlight the diverse functions of GDNF ligand ... further shown to be intimately involved in NTN and NGF induced neurite outgrowth Collectively, these findings demonstrated the hitherto unrecognized role of specific ligands and receptor isoforms...

GDNF receptor complex in neuronal differentiation and breast cancer

... 1.3 GDNF receptor complex in neuronal biology Since the discovery of the roles of GDNF in promoting survival and differentiation of midbrain dopaminergic (DA) neurons and increasing the affinity ... NT2 into specific neuronal lineages and study the roles of GDNF receptor system in neuronal differentiation and neuronal lineage specification 38 CHAPTER GDNF AND BREAST CANCER 3.1 Background Breast ... current medicinal field, it is therefore interesting to continue exploring the roles of GDNF and its possible intervention in order to gain insights into how GDNF signaling may play a part in cancer...

Báo cáo sinh học: "Molecular and cellular correlates of the CIITA-mediated inhibition of HTLV-2 Tax-2 transactivator function resulting in loss of viral replication" pot

... N-terminal and a Cterminal region of CIITA interacting with the viral transactivator, although, as stated above, only the Nterminal region is involved in the inhibition of Tax-2 function Interestingly, ... the replication of the human HTLV-2 retrovirus by inhibiting the function of the viral transactivator protein Tax-2 [21,22] However the biochemical basis of the CIITA-mediated inhibition on Tax-2 ... distribution of Tax-2 molecules was analyzed in the presence and in the absence of CIITA In the absence of CIITA, Tax-2 localizes both and in the cytoplasm and in the nucleus of 293T cells often with...

o cáo hóa học:" Molecular and cellular correlates of the CIITA-mediated inhibition of HTLV-2 Tax-2 transactivator function resulting in loss of viral replication" potx

... of subcellular localization unveiled the co-localization of Tax-2 and CIITA both in the cytoplasm and the nucleus, and the role of CIITA in redirecting, upon binding, Tax-2 molecules mostly in ... by inhibiting the function of the viral transactivator protein Tax-2 [21,22] However the biochemical basis of the CIITA-mediated inhibition on Tax-2 function was not clarified In the present investigation ... results in functional inactivation of Tax-2 on the HTLV-2 LTR promoter CIITA-NF-YB interaction in vivo is stabilized and/ or favoured by the presence of Tax-2 Thus concomitant interaction of Tax-2...

Studies on the molecular and cellular mechanisms underlying the process of learning and memory formation body

... relation to learning and memory formation requirements Furthermore, the molecular mechanisms underlying the MFs redistribution during learning and memory formation are still under investigation ... hilus and CA3 area, comprise the second synapse of the hippocampal circuit In this trisynaptic model of the hippocampus, based on the observations of the MFs presynapses and their locations, the ... for the investigations on the learning- dependent morphological malleability, as well as the relations of synaptic plasticity with long-lasting memory The correlations between the basal size of the...

Studies on the molecular and cellular mechanisms underlying the process of learning and memory formation

... 5.2.3.1 Fear conditioning training 115 5.2.3.2 Short-term contextual memory and cued memory test 115 5.2.3.3 Retention and extinction of long-term contextual memory and cued memory ... which have been done in this thesis to investigate the underlying mechanisms of learning process and long-term memory formation In part I, two projects have been focused on the hippocampal mossy ... and x long-term memory procedures Investigations on the learning- induced presynaptic plasticity might shed lights on the complicated mechanisms underlying the hippocampalrecruited long-term memory...

Tài liệu Báo cáo khoa học: Brain angiogenesis in developmental and pathological processes: regulation, molecular and cellular communication at the neurovascular interface pdf

... from the pia mater invade the brain and extend toward the ventricles [4] Like other vascular networks, brain vessels undergo formation, stabilization, branching, pruning and specialization In brief, ... transports water bidirectionally between the blood and the brain Astrocytes secrete water into the perivascular space via AQP4, thereafter maintaining water homeostasis in the brain environment ... vasoconstriction and vasodilation The thickness of the vSMC layer dif- Regulation of angiogenesis and barriergenesis fers according to the size of the vessels In the brain, pial arteries invade the brain parenchyma...

Báo cáo y học: " Detrimental effects of albuterol on airway responsiveness requires airway inflammation and is independent of b-receptor affinity in murine models of asthma" pdf

... Cite this article as: Lundblad et al.: Detrimental effects of albuterol on airway responsiveness requires airway inflammation and is independent of b-receptor affinity in murine models of asthma ... analysis, and assisted with data analysis EPR did the analysis of the histology and assisted in manuscript writing MEP did the Bio-Plex®® cytokine analysis and assisted in data interpretation and ... independent of the isomer of albuterol[ 37] In this context, it is interesting to note that in our study the single isomer (R) -albuterol did not significantly induce inflammatory cytokines However,...

Tài liệu Báo cáo khoa học: Molecular and cellular speciﬁcity of post-translational aminoacyl isomerization in the crustacean hyperglycaemic hormone family docx

... axon terminal in the sinus gland, as a result of late and progressive isomerization of the Phe3 of the CHH during the migration of the secretion vesicles along the axonal tract [39,41] The immunohistochemical ... (vitellogenesis inhibiting hormone) and CHH (crustacean hyperglycemic hormone) of the crustacean have the same precursor? Immunolocalization of VIH and CHH in the X-organ sinus gland complex of the lobster ... microscopy study of the neuronal endings in the sinus gland to determine the subcellular localization of the different epimers Taken together, these results allow a discussion of the existence of enzyme(s)...

Investigations on the cellular and neuroprotective functions of nogo AReticulon 4a

... by Nogo- A expression The same effects are also observed by Nogo- B expression On the other hand, while Nogo- C and RTN3 confer some degree of protection against serum deprivation, staurosporine and ... in the inhibition of neurite outgrowth 1.2 Molecular characterization of Nogo- A 1.2.1 Nogo: part of the Reticulon family Identification and characterization of the gene encoding IN-1 antigen, Nogo- ... Localization of Nogo- A in CNS 124 7.2 Enrichment of Nogo- A at the paranode and its interaction with Caspr 125 7.3 Interaction of Nogo- A with RTN3 127 7.4 Neuroprotection by Nogo- A and the possible...

Báo cáo khoa học: Molecular and functional characterization of novel CRFR1 isoforms from the skin pptx

... terminus of the CRFR1 isoforms (Fig 1C) The predicted masses of the isoforms without/with V5 tag are as follows: CRFR1a (47.7/52 kDa), CRFR1e1 (10.8/ 15.1 kDa), CRFR1e2 (28.1/32.4 kDa), CRFR1f ... CRFR1 a, b, c and d isoforms differ in their ability to bind ligands and activate G proteins [10,16,25] CRFR1a is the most efﬁcient in the stimulation of cAMP production, CRFR1c and CRFR1b have ... independent of cAMP and IP3 [11,12,33] Neither CRFR1f, g or h isoforms were able to stimulate any of the cis-elements Instead the reporter gene expression decreased when these isoforms were cotransfected...

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identiﬁed and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains and a single KH domain similar ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1 (ANKHD1) variants,...

Báo cáo khoa học: Functions and cellular localization of cysteine desulfurase and selenocysteine lyase in Trypanosoma brucei pot

... activities for the cysteine and selenocysteine substrates were measured in the noninduced and RNAi-induced knockdown cells for SCL characterized above, and also in the noninduced and Nfs RNAi-induced cells ... Esaki N (1997) Cysteine sulfinate desulfinase, a NIFS-like protein in E coli with selenocysteine lyase and cysteine desulfurase activities, gene cloning, purification, and characterization of a novel ... mitochondrial and cytosolic markers, respectively (B) Immunolocalization of the TAP-tagged SCL protein in procyclic T brucei (a) 4¢,6diamidino-2-phenylindole-staining of nuclear and kinetoplast...

Báo cáo khoa học: Molecular and genetic characterization of osmosensing and signal transduction in the nematode Caenorhabditis elegans docx

... this minireview is to summarize what is currently known about the molecular mechanisms of osmotic stress resistance, osmosensing and signal transduction in C elegans Osmosensing and signaling in ... process of interest, allows genes to be ordered into pathways, and can provide important and novel mechanistic insights into the molecular structure and function of proteins In addition to forward genetic ... factor signaling in the hypodermis regulates whole animal ﬂuid balance [10] The intestine of adult C elegans is comprised of 20 epithelial cells that function in digestion and nutrient absorption In...

Xem thêm

Từ khóa: 2 molecular and cellular pathophysiology of pediatric macular degenerations and potential therapeutics spatial and temporal mapping of glycine receptor complex expression the basic molecular and structural components of silicate clays a single tetrahedron and single octahedron b thousands of tetrahedrons and octahedrons are connected to give planes of silicon and aluminum or magnesium ions unive molecular biology and biological functions of endothelin the role of glycosylation in the control of processing and cellular transport of the functional reproductive and hormonal functions of the male and function of the pineal gland molecular and biochemical basis of brain injury following heart surgery interventions for the future 3 detailed anatomy and cellular dynamics of the growth plate cell electropermeabilization and cellular uptake of small molecules the electrochemotherapy concept relationship of molecular and cellular defects to clinical features integration of molecular and cellular pathogenesis a bioinformatics approach ch 1 the roles and functions of forensic social work in the 21st century molecular and biochemical characteristics of the intracellular ca2 handling proteins in the heart digestive sensing and immune functions of the gut cellular molecular and systemic triggers of tumour angiogenesis Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Chuong 2 nhận dạng rui ro Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ