In vitro and in vivo studies into the antidiabetic and antilipidemic effects of chlorogenic acid

... quality of life Before the introduction of the therapeutic use of insulin, diet 11 is the main form of treatment of the disease, and dietary measures included the use of traditional medicines which ... IN VITRO AND IN VIVO STUDIES ON THE ANTIDIABETIC AND ANTILIPIDEMIC EFFECTS OF CHLOROGENIC ACID ONG KHANG WEI [BSc Biomedical Science (Hons.)] A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... through increasing GLUT translocation and inhibiting hepatic G6Pase 1,5-dicaffeoyl-quinic acid, dicaffeoyl quinic acid, chlorogenic acid and luteolin-7-O-glucoside in the extract may be the candidates...

Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

... ampliﬁcation with primers 5¢-GCGGAGCTCATGGCCAC AAGCGCATCAGC-3¢ and 5¢-GTGGTGGTGGTGGTGG TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag ... template Primers were designed as follows: PSAG with a C-terminal hexa-histidine tag (PSI -G- HisTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CAGTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTG GGTCGTAT-3¢ ... shielded from trypsin digestion on the cis-side of the membrane The A B 4004 Fig Determination of the topology of PSI -G in the thylakoid membrane using in vitro import experiments (A) Insertion...

báo cáo hóa học:" Functional significance of the signal transduction pathways Akt and Erk in ovarian follicles: in vitro and in vivo studies in cattle and sheep" ppt

... gonadotrophins and IGF with the Akt and Erk signalling pathways in theca and granulosa cells in vitro and to describe their functional significance for ovarian follicle growth in vivo Materials and ... previously in the bovine model Increases in Akt and Erk signalling proteins in response to FSH and IGF stimulation suggest a role for Akt and Erk signal transduction pathways in FSH and IGF mediated ... treated in vivo with Akt and Erk inhibitors agrees with the results from Experiments and where inhibition of the Erk pathway inhibited FSH-induced oestradiol production and inhibition of the Akt pathways...

Probiotic Lactobacillus Strains: in vitro and in vivo Studies pot

... immunomodulating properties in in vivo mouse model MATERIAL AND METHODS Survival of Lactobacillus strains at low pH and in the presence of bile salt Lactobacillus strains isolated from feces of healthy infants ... transit into the gut, and modulate TH1–TH2 balance in favor of anti-allergic TH1 immune responses In this study we report a selection of probiotic Lactobacillus strains by in vitro tests and subsequent ... 2000) Experimental design in vivo Eight-week-old inbred BALB/c mice (n = per group) were used for in vivo experiments Strains selected in in vitro tests were mixed in equal proportions, lyophilized...

Báo cáo khoa học: In vivo studies of altered expression patterns of p53 and proliferative control genes in chronic vitamin A deﬁciency and hypervitaminosis pot

... procedures A single band of about 53 kDa was detected in liver and lung indicating that the amount of p53 protein was significantly increased in the liver and lung from vitamin A- deficient rats that in controls ... provides a mechanism that cult parturition in the rat as a result of vitamin A deficiency Am J Anat 57, 303–349 may explain in part the regulation of control of proliferative Ó FEBS 2003 Vitamin A status ... analysis of c-jun, p53 and p21WAF1/CIF1 in liver and lung of control, chronic vitamin A- deficiency and hypervitaminosis rats Based on the results found in the differential display study and taking...

Báo cáo y học: " Restriction by APOBEC3 proteins of endogenous retroviruses with an extracellular life cycle: ex vivo effects and in vivo "traces" on the murine IAPE and human HERV-K elements" pot

... effects take place at the level of endogenous retroviruses with an extracellular life cycle, with an unambiguous restriction of the murine IAPE by a murine APOBEC3 protein, and of the human HERV-K ... confer G418 resistance after integration Traces of APOBEC3 past activity on resident IAPE and HERV-K elements in the murine and human genome Since the murine IAPE- D and the human HERV-K elements ... proteins inhibit endogenous retroviruses Murine and human APOBEC3 proteins inhibit endogenous retroviruses (A) Rationale of the assay for detection of infection events by endogenous retroviruses in...

Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

... control at t ¼ for each peptide The percentage of degradation was calculated by comparing the area of the peaks of the intact peptide at t ¼ and t ¼ 60 Binding assays Binding assays were carried ... [33], the peptides containing a b-amino acid substitution in position have increased stability compared to the corresponding a- amino -acid- containing peptides Therefore it is possible to increase peptide ... acid incorporation When Phe7 or Phe8 are replaced by b2-HPhe, the corresponding analogues are weak competitors of speciﬁc NK-1 binding sites These amino acids are in the helical domain of SP which...

Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf

... without an effect on Ca2+ uptake rate and capacity in Artemia mitochondria Atypical Artemia ANT Fig Effect of Ca2+ uptake on light scattering in mitochondria isolated from the liver of X laevis (A) ... we concluded that the ANT of our mitochondrial preparations of A franciscana embryos is fully functional ANT of A franciscana is refractory to inhibition by BKA As mentioned above, BKA was without ... PTP in embryos of A franciscana marks a cornerstone in our understanding of the long-term tolerance, extending for years, to anoxia and diapause, conditions that are invariably accompanied by large...

Báo cáo Y học: Function and cellular localization of farnesoic acid O -methyltransferase (FAMeT) in the shrimp, Metapenaeus ensis ppt

... role of MF in the molting process of the crustaceans [31–33] Therefore, to ascertain the expression of FAMeT in relation to the molting process of the shrimp, we determined the level of expression ... biological function of this gene The refolding of the protein during renaturation is important for the function of the enzyme When we used recombinant protein renatured following puriﬁcation under ... throughout the molting cycle suggests that FAMeT may be involved in molting or related processes in the shrimp Finally, the present work provides a framework for study of the regulation of biosynthesis...

báo cáo hóa học: " Dexamethasone diminishes the pro-inflammatory and cytotoxic effects of amyloid β-protein in cerebrovascular smooth muscle cells" docx

... parenchyma, another prominent site of extracellular Aβ deposition is within and along primarily small and medium-sized arteries and arterioles of the cerebral cortex and leptomeninges and in the cerebral ... neuroinflammation and cellular pathology within the cerebral vessel wall, we determined the effects of dexamethasone and two nonsteroidal anti-inflammatory drugs (NSAIDs), ibuprofen and indomethacin, ... of smooth muscle cell α actin, a consequence that was essentially prevented in the presence of dexamethasone (Figure 6) In contrast, neither indomethacin nor ibuprofen was capable of preventing...

Báo cáo khoa học: "Protective and therapeutic effects of an extract mixture of alder tree, labiate herb, milk thistle green bean-rice bran fermentation, and turnip against ethanol-induced toxicity in the rat" pdf

... ingredients (milk thistle extract, green bean-rice bran fermentation extract) and turnip concentrate The herbal extract mixture preparation included the following: 100 g of the xylem and bark from ... liver injury in the rats studied To determine the precise mechanism underlying the efficacy of the herbal extract mixture for ethanol toxicity, studies focusing on the antioxidant effects of the ... inflammation and hepatic failure [4,7,11,13] In this study, a mixture of an herbal extract and yogurt additive were tested for their protective and therapeutic efficacy against ethanol-induced toxicity in...

Báo cáo y học: "Application of in vivo microscopy: evaluating the immune response in living animals" pps

... Easily accessible is the inguinal lymph node of the mouse by folding back a broad flap of abdominal skin or the popliteal lymph nodes of the feet [25] A rubber ring is glued on the inner surface of ... Illuminating the landscape of in vivo immunity: insights from dynamic in situ imaging of secondary lymphoid tissues Immunity 2004, 21:331-339 37 Bousso P, Robey E: Dynamics of CD8+ T cell priming by dendritic ... settings [25,49] However, further efforts in the refinement of methods for data analysis obtained from dynamic microscopy in vivo are of utmost importance for the exploitation of the maximum information...

Báo cáo khoa học: "The in vivo study on the radiobiologic effect of prolonged delivery time to tumor control in C57BL mice implanted with Lewis lung cancer" pdf

... [16,17] They contributed the confiliction of the results in vitro and in vivo to reoxygenation In this study, we attempt to evaluate the impact of prolonged fraction delivery time on tumor control ... irradiation In the current study, the potential impact of prolonged fraction delivery time for a fixed total dose on the control of Lewis lung cancer implanted in C57BL mice was studied in order to investigate ... interfraction intervals of 10 min, (4) fractions Page of of Gy with interfraction intervals of 30 min, (5) fractions of 2.57 Gy with interfraction intervals of Assay Tumor dimensions were measured with...

Báo cáo y học: "Chemokine receptor expression and functional effects of chemokines on B cells: implication in the pathogenesis of rheumatoid arthritis" ppt

... expression < /b> Finally, we examined the effects < /b> of < /b> the chemokines < /b> on < /b> the expression < /b> of < /b> the cell surface molecules ICOSL, BAFF-R and < /b> TACI by peripheral blood B cells of < /b> normal donors and < /b> sub- Page of < /b> 11 ... chemokine receptor < /b> expression < /b> by peripheral blood in both normal donors and < /b> subjects with RA, and < /b> also synovial B cells from subjects with RA, and < /b> determined the functional < /b> effects < /b> of < /b> chemokines < /b> on < /b> ... could contribute to the pathogenesis of < /b> RA by antigen presentation, autoantibody production, and < /b> inflammatory cytokine production One of < /b> the mechanisms for accumulation of < /b> B cells in synovial tissues...

11

343

0

Báo cáo y học: "Modeling antibiotic and cytotoxic effects of the dimeric isoquinoline IQ-143 on metabolism and its regulation in Staphylococcus aureu" pot

... Modeling antibiotic and cytotoxic effects of the dimeric isoquinoline IQ-143 on metabolism and its regulation in Staphylococcus aureus, Staphylococcus epidermidis and human cells Genome Biology ... presence of IQ-143 (concentrations of a quarter of the minimum inhibitory concentration and twice the minimum inhibitory concentration) as described in the Materials and methods section and hybridized ... determination of the inhibitory potency of herbal extracts on the activity of six major cytochrome P450 enzymes using liquid chromatography/mass spectrometry and automated online extraction Rapid...

18

338

0

Xem thêm

Từ khóa: concerned the bcbs will meet again in may to review the recommendations from a number of working groups and to address important issues relating to calibration this should allow the bcbs to achiev adverse hemodynamic and nonhemodynamic effects of the autonomic dysfunction in hypertension neural behavioral and psychological effects of injury in athletes geranylgeranylated rhob mediates the apoptotic and antineoplastic effects of farnesyltransferase inhibitors new insights into cancer cell suicide and ecological effects of pesticides in doñana national park sw spain hucollp261 273 specific repertoire is downmodulated in peripheral blood during the moderate disease activity remission of disease induced by therapy positive and negative effects of inflation on the economy 7 6 recruitment occurs at the end of the post settlement post settlement stage and incorporates effects of larval and post settlement processes acute short term and chronic effects of marijuana on the female primate reproductive function factors the potential benefits and side effects of the treatment decisions should be made following discussion of these factors with the patient experimental evaluation of the preventive and therapeutic effects of a moisturizer vitro and adoptive transfer of arthritis direct and indirect effects of genetically modified plants on the honey bee actual and potential effects of the current crisis on social security ozone hole and harmful effects of ozone layer Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015