0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Tiến sĩ >

the identification and characterization of proteins required for endocytosis in the budding yeast saccharomyces cerevisiae

Tài liệu ‘Unheard voices’: listening to Refugees and Asylum seekers in the planning and delivery of mental health service provision in London. pptx

Tài liệu ‘Unheard voices’: listening to Refugees and Asylum seekers in the planning and delivery of mental health service provision in London. pptx

... seekers in the planning and delivery of mental health service provision in London. A research audit on mental health needs and mental health provision for refugees and asylum seekers ... contributing factors to the long-term mental health of refugees and asylum seekers. The fundamental challenges faced by service providers in the mental health and social care sector is to incorporate ... barriers include language, GPs not having the time to talk to people and find out what the problems are, lack of knowledge of mental health services in refugees and asylum seekers, long waiting...
  • 92
  • 1,134
  • 0
Báo cáo khoa học: Intermodule cooperativity in the structure and dynamics of consecutive complement control modules in human C1r Structural biology docx

Báo cáo khoa học: Intermodule cooperativity in the structure and dynamics of consecutive complement control modules in human C1r Structural biology docx

... timescale in both of the free modules. Thus, these loops are strong candidates for binding sites of other complement and ⁄ or regulatory proteins. The large insertion between E and F strands in C1r ... protein module of C1r (CCP1single) and second complement control proteinmodule of C1r (CCP2single) for the single CCP mod-ules, and CCP1CCP2 and CCP1CCP2 for the corre-sponding modules ... in CCP1CCP2, which is exactly the reverse of the situationobserved for the CCP1single and CCP2single modules and probably reflects the complex interdependence of the modules in terms of internal...
  • 13
  • 583
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

... GTGTTCGACTTTGCCAGCCTGTACCCCAGCATCATCCAGGCCCACAACCTGTGC VZV GTATTGGATTTTGCAAGTTTATATCCAAGTATAATTCAGGCCCATAACTTATGT HHV6 GTGTTTGATTTTCAAAGTTTGTATCCGAGCATTATGATGGCGCATAATCTGTGT CMV GTGTTCGACTTTGCCAGCCTCTACCCTTCCATCATCATGGCCCACAACCTCTGC ... GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC EHV2 GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC MHV68 GTAGTGGACTTTGCCAGCCTGTACCCAAGCATTATTCAGGCACACAATCTGTGT AH1 GTAGTTGACTTTGCCAGCTTGTACCCCAGCATCATCCAGGCTCATAATCTATGC ... GTTTTTGATTTCCAAAGTTTGTATCCAAGTATTATGATGGCTCATAATCTGTGT RhCMV GTGTTTGACTTTGCCAGCCTGTATCCGTCAATTATCATGGCACATAATCTCTGT RFHVMm GTTGTGGATTTTGCTAGCCTTTATCCCAGCATCATGCAGGCCCACAACCTATGT AtHV3 GTAGTAGACTTTGCTAGCCTTTACCCAAGTATTATACAAGCTCATAATCTGTGT...
  • 24
  • 604
  • 0
báo cáo hóa học:

báo cáo hóa học:" Identification and characterization of a spontaneous ovarian carcinoma in Lewis rats" docx

... D, Atkins L, Kato DT, Buczek-Thomas J, Fuller AF Jr,Hasan T: Characterization of a xenograft model of human ovarian carcinoma which produces intraperitoneal carcinomatosis and metastases in ... significance of stathmin expression in correlation with metastasis and clinicopathological characteristics in human ovarian carcinoma. ActaHistochemica 2008, 110:59-65.37. Balachandran R, Welsh ... Albert M, Nallainathan D,Karaskova J, Rosen B, Murphy J, Laframboise S, et al: Parallel Analysis of Sporadic Primary Ovarian Carcinomas by Spectral Karyotyping,Comparative Genomic Hybridization,...
  • 8
  • 440
  • 0
Báo cáo toán học:

Báo cáo toán học: " Influence of different flow conditions on the occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage treatment plant in Germany: an effect-directed approach" pot

... occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage treatment plant in Germany: an effect-directed approach. EnvironmentalSciences ... Kraft (Duisburg,Germany) and J.T. Baker (Deventer, The Netherlands).For chemical analysis, standard stock solutions of the analytes and the internal standards were prepared both in methanol and ... of analytes. For the quantita-tion of the analytes, a 5-point (PAHs) and a 7-po int(pharmaceuticals) internal standard calibration was used. The limit of detection and the LOQ were calculated...
  • 13
  • 589
  • 0
báo cáo hóa học:

báo cáo hóa học:" Influence of different flow conditions on the occurrence and behavior of potentially hazardous organic xenobiotics in the influent and effluent of a municipal sewage " pdf

... investigated PAH compounds. System con-trol and data evaluation were done on a GC/MSDChemStation (Agilent, Waldbronn, Germany). The determination of the pharmaceuticals (diclofenac and carbamazepine) ... fractions 1, 3, and 4 was probably caused by organic contaminants in additional precipitation runoffas well as in domestic sewage as it cannot be derived as a function of wastewater flow conditions ... Because alterations in flow con-ditions affect the chemical composition of wastewater in the influent and effluent of the STP in a number of ways, a significant impact on wastewater toxicity canbe...
  • 13
  • 475
  • 0
Báo cáo y học:

Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx

... (f) An area of an OA synovium demonstrates a lining layer completely devoid of c19orf10 staining. (g) Intense staining of a hyperplastic RA synovial lin-ing cell layer. This staining was typical ... Expression of c19orf10 in OA synovium. (a) Intense staining of the synovial lining layer and perivascular regions of RA (OCT sec-tion) tissue.(b) Intense staining of the synovial lining layer and ... minimal staining of the lymphocytes although some mononuclear cells in the aggregates stained positively (arrow). (e) Intense staining of individual cells in the lining layer of a typical OA synovium....
  • 9
  • 489
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Cytogenetic and molecular characterization of eight new reciprocal translocations in the pig species. Estimation of their incidence in French populations" pot

... 389406389â INRA, EDP Sciences, 2002DOI: 10.1051/gse:2002014Original articleCytogenetic and molecular characterization of eight new reciprocal translocations in the pig species. Estimation of their incidence ... systematically and allows the detection of rearrangements modifying very slightly the size and/ or the bandingprofiles of the chromosomes, as, for instance, in the case of the translocations rcp(15;17)(q24;q21) ... thepresence of a very thin p-terminal green bandon the der(5) chromosome, demonstrating the reciprocity of the exchange, and allowed an accurate localization of the breakpoint on the p-terminal...
  • 18
  • 381
  • 0
IDENTIFICATION OF NOVEL SMALL MOLECULE INHIBITORS OF PROTEINS REQUIRED FOR GENOMIC MAINTENANCE AND STABILITY

IDENTIFICATION OF NOVEL SMALL MOLECULE INHIBITORS OF PROTEINS REQUIRED FOR GENOMIC MAINTENANCE AND STABILITY

... IDENTIFICATION OF NOVEL SMALL MOLECULE INHIBITORS OF PROTEINS REQUIRED FOR GENOMIC MAINTENANCE AND STABILITY Sarah C. Shuck Submitted to the faculty of the ... 34 2. Small Molecule Inhibition of RPA and its Effect on DNA Replication and Repair 2.1. Introduction The identification of small molecule inhibitors of proteins is a rapidly ... maintaining genomic stability (91). Inhibition of proteins essential for this process may prove to be a means of globally preventing cancer development and proliferation and has the potential for widespread...
  • 147
  • 286
  • 0
design, synthesis, and characterization of polymeric materials for uses in energy storage applications

design, synthesis, and characterization of polymeric materials for uses in energy storage applications

... Graduate School Department of Chemistry DESIGN, SYNTHESIS, AND CHARACTERIZATION OF POLYMERIC MATERIALS FOR USES IN ENERGY STORAGE APPLICATIONS A Thesis in Chemistry by Daniel ... numbers of other synthetic polymers were developed and commercialized in response to the growing need for new materials in the automotive and aerospace industries. Some of these new materials include ... design, synthesis, and characterization of polymeric materials for energy storage applications, which include small molecule electrolyte additives, solid polymer electrolyte, and gel polymer electrolyte...
  • 229
  • 608
  • 0
MODEL AND SOLUTION OF MUNICIPAL SOLID WASTE MANAGEMENT IN THE PERI-URBAN AREAS OF HA NOI INNER-CITY THROUGH 2030

MODEL AND SOLUTION OF MUNICIPAL SOLID WASTE MANAGEMENT IN THE PERI-URBAN AREAS OF HA NOI INNER-CITY THROUGH 2030

... areas of Hanoi inner-city. - Building a model and solution of MSW management of in the peri-urban areas of Hanoi inner-city relevant to the planning of solid waste management of Hanoi through 2030. ... (430,15 ha) . 2.4. The forecast amount of generated MSW in the peri-urban areas of Hanoi through 2030 By 2030, the population of the nine districts in the peri-urban areas of Hanoi inner-city will ... plannings of the districts. 3.4. The model of MSW management in the peri-urban areas of Hanoi inner-city through 2030 3.4.1. General diagram of MSW management: The management model of collecting,...
  • 27
  • 480
  • 0

Xem thêm

Từ khóa: isolation identification and characterization of butanol tolerant bacteria1 height and width of fill required for soil improvement2 height and width of fill required for stability of fill embankmentstrategy for training and development of human resource for evnhcmc in the period of 2010 2015 vision 2020identification and characterization of group 5 anidentification and characterization of der f 22 a novel allergen from dermatophagoides farinae a paralogue of der f 2list of documents required for admission in junior collegecare—state oversight and coordination of health services for children in foster care newderivation maintenance and characterization of rat embryonic stem cells in vitro pdfisolation and characterization of resident mesenchymal stem cells in human glomeruli3 2 estimates of the weight of air required for selected fuels and excess air levelsmethods for the purification and characterization of human adipose derived stem cellscase study biodegradable microspheres for the sustained release of proteins guidelines for formulating and processing dry powder pharmaceutical productsa rational strategy for the identification and testing of new agentsexperimental procedures for the purification and characterization of the arabinanases and galactanaseschuyên đề điện xoay chiều theo dạngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)