Stephen Wolfram - A New Kind Of Science Episode 6 ppt
Stephen Wolfram - A New Kind Of Science Episode 6 ppt
... ...
- 113
- 276
- 0
Stephen Wolfram - A New Kind Of Science Episode 2 ppt
... ...
- 113
- 250
- 0
Stephen Wolfram - A New Kind Of Science Episode 3 pdf
... ...
- 113
- 238
- 0
Stephen Wolfram - A New Kind Of Science Episode 7 pdf
... ...
- 113
- 237
- 0
Stephen Wolfram - A New Kind Of Science Episode 8 potx
... ...
- 113
- 245
- 0
Stephen Wolfram - A New Kind Of Science Episode 12 doc
... States of cellular automata, 865 in quantum theory, 10 56 States of matter as analogy for CA classes, 235 Stationary phase approximation in path integrals, 1 061 Statistical estimates ... cellular automata, 19 Linear algebra and CA invariances, 1022, 1023 and dimensions of networks, 1031 and models of memory, 1101 Linear cellular automata see also Additive cellular automata ... (of data), 1083 Taj Mahal nesting in gardens of, 874 Take (take elements) basic example of, 853 Tally sticks and application of randomness, 968 Tan curve of, 145 Tang, Chao (USA,...
- 62
- 432
- 0
13C–18O bonds in carbonate minerals: A new kind of paleothermometer ppt
... the IAEA) and three intra-laboratorycalcite standards, ÔMARJ-1Õ, ÔMZ carbonateÕ and ÔSigma-carbÕ. Two of the standards (NBS-19 and MARJ-1) werepurified from Italian Carrara marbles that were ... maxima average 27 .6 °C.Super-imposed on this seasonality is an inter-annual todecadal variability of ca. 1–2 °C. Note also that near-sur-face water temperatures in shallow coastal waters can ... External precision of CO2extracted at 25 °C fromcarbonate standardsFig. 2 plots all analyses of the NBS-19, MAR-J1, MZcarbonate and Sigma-carb standards made between Janu-ary, 2004 and April,...
- 18
- 472
- 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
... GCGAATTCTCCATCGTGCCPPP6C-3¢UTR-mut-sense TTTTTATTGTGGAGTATGCTGCTGAAATGPPP6C-3¢UTR-mut-antisense ATTTCAGCAGCATACTCCACAATAAAAAGPPP6C-siR-Top GATCCGCTTTGTGTAAGTAATTTGATTCAAGAATCAAATTACTTACAAGTTTTTTGAATTCTCGAGAPPP6C-siR-Bottom ... GATCCGCTTTGTGTAAGTAATTTGATTCAAGAATCAAATTACTTACAAGTTTTTTGAATTCTCGAGAPPP6C-siR-Bottom AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATTTGATCTCTTGAACAAATTACTTACACAAAGAGPPP6C-forward AGGGAATTCATGGCGCCGCTAGACCTGGCPPP6C-reverse GAGGCCTCGAGTCAAAGGAAATATGGCGTTGMicroRNA-373 ... Sequence (5¢-to3¢)miR-373-sense GACGGCTCGAGGACCAAGGGGCTGTATGCACmiR-373-antisense GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGGPPP6C-3¢UTR-sense CGGGATCCTCTTGTATTACCCTCTAPPP6C-3¢UTR-antisense GCGAATTCTCCATCGTGCCPPP6C-3¢UTR-mut-sense...
- 11
- 396
- 0
Báo cáo toán học: "A New Family of Somos-like Recurrences" pptx
... = A( K )a( n − 4K) − A( K )a( n − 6K) + a( n − 8K) a( n − 2K − 1) = A( K )a( n − 4K − 1) − A( K )a( n − 6K − 1)++ a( n − 8K − 1)Simplify again to obtainφ(n) = A( K )a( n − 4K − 1 )a( n − 6K) − A( K )a( n − 4K )a( n ... but algebraiccalculations easily verified by a computer algebra system such as Maple or Mathematica.φ(6K + 2) = a( 6K + 2 )a( 4K + 1) − a( 6K + 1 )a( 4K + 2) − a( 5K + 2) − a( 5K + 1)where we can substitute ... for a( n), a( n − 1), a( n − K),and a( n − K − 1) from the definition of {a( n)}. a( n) = A( K )a( n − 2K) − A( K )a( n − 4K) + a( n − 6K) a( n − 1) = A( K )a( n − 2K − 1) − A( K )a( n − 4K − 1) + a( n − 6K − 1) a( n...
- 8
- 205
- 0
Báo cáo y học: "PLCb1-SHP-2 complex, PLCb1 tyrosine dephosphorylation and SHP-2 phosphatase activity: a new part of Angiotensin II signaling?" ppt
... H, Hasegawa M, Sugai S, Obata T, Ugi S, Morino K, Egawa K,Fujita T, Sakamoto T, Nishio Y, Kojima H, Haneda M, Yasuda H, Kikkawa R,Kashiwagi A: Expression of a dominant negative SHP-2 in transgenicmice ... its phospha-tase activity. In addition to its phosphatase activity,SHP-2 appears to function as a molecular adaptor asshown by Ali et al’sreportofaSHP-2IRScomplex[7]as well as its adaptor function ... ortho-vanadate and protease inhibitor cocktail, precleared withprotein A- Sepharose, and anti-SHP-2 or anti PLCb1anti-bodies bound to protein A- Sepharose were added at 4°C. This was then incubated...
- 7
- 331
- 0
Từ khóa: a new model of plan recognitionpreparing students for a new world of work in the 21st centurya new history of western philosophy epuba new history of western philosophy reviewa new hymn of praisea new hymn of praise lyricsGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ