Báo cáo sinh học: "Etiology and antibiotic resistance patterns of community-acquired urinary tract infections in J N M C Hospital Aligarh, India" potx

... AntimicrobialsOpen AccessResearchEtiology and antibiotic resistance patterns of community-acquired urinary tract infections in J N M C Hospital Aligarh, IndiaMohammed Akram1, Mohammed Shahid2 and Asad ... usedantimicrobilas among pathogens of both bacteremic and non-bacteremic community-acquired urinary tract infec-tion. J Microbial Immunol Infect 2004, 37:185-191.27. Colodner R, Keness Y, Chazan ... Fluoroquinolones, Co = Cotrimoxazole, T = Tetracycline,Nf = Nitrofurantoin, Car = Carbapenems.Annals of Clinical Microbiology and Antimicrobials 2007, 6:4 http://www.ann-clinmicrob.com/content/6/1/4Page...

báo cáo sinh học:" HIV and infant feeding counselling: challenges faced by nurse-counsellors in northern Tanzania" pptx

... feed-ing methods [37], the impact of the infant feeding compo-nent of the pMTCT programme on infant feedingoutcomes is uncertain.Limitations In interpreting the findings of the present study, ... guidelines at the international and national level, infant feeding counselling remains amajor challenge and a controversial issue in pMTCT in Tanzania [2].A qualitative study in Moshi, Kilimanjaro ... diag-nosis and who had an enormous demand for nursing care and for someone to talk to. The time constraint thusemerged in this context as inhuman and was challengingthe very core of nursing care....

báo cáo sinh học:" Knowledge and communication needs assessment of community health workers in a developing country: a qualitative study" docx

... interest in receiving official oradministrative information and 40% were interested in reading clinical (tibbi maalooomat) information, while57% wanted both types of information in equal amountsthrough ... sufficient.Communicating with males on family planning; estab-lishing village health committees; convincing TB suspectsto make use of diagnostic facilities; and talking abouttaboo subjects such ... We conducted this studyto document the perceptions of these workers on their knowledge and communication needs,image building through mass media and mechanisms for continued education.Methods:...

Báo cáo sinh học: " Phenotype and envelope gene diversity of nef-deleted HIV-1 isolated from long-term survivors infected from a single source" pptx

... Robinson J, Posner M, Sodroski J: Functional and immunologic characterization of human immunodeficiency virus type 1 envelope glycopro-teins containing deletions of the major variable regions. ... Learmont J, Tindall B, Evans L, Cunningham A, Cunningham P, Wells J, Penny R, Kaldor J, Cooper DA: Long-term symptomless HIV-1 infection in recipients of blood products from a singledonor. Lancet ... majorvariants in C1 8L that were distinct from a single variantpresent in C1 8E; 2 major variants in C9 8L that were dis-tinct from a single major variant present in C9 8E; and 2major variants in D36L...

Tài liệu Báo cáo khoa học: Molecular and cellular speciﬁcity of post-translational aminoacyl isomerization in the crustacean hyperglycaemic hormone family docx

... Kleijn DPV, Coenen T, Laverdure AM, Tensen CP& Vanherp F (1992) Localization of messenger RNAsencoding crustacean hyperglycemic hormone and gonadinhibiting hormone in the X-organ sinus gland ... neurohormones, such asmoult-inhibiting hormone, mandibular organ inhibitinghormone and vitellogenesis inhibiting hormone (VIH;also called gonad inhibiting hormone) [20]. In Homarus americanus, ... secondary antisera used in immunohistochemistry (HIC) and in immunocytochemistry (ICC). Dec-L, decapeptide corresponding to the N- terminus of VIH; Dec-DW4, decapeptide corresponding to the N- terminal...

Báo cáo khoa học: High and complementary expression patterns of alcohol and aldehyde dehydrogenases in the gastrointestinal tract Implications for Parkinson’s disease docx

... CTCTCCACACTCTTCCATCCTCCAAAGGCGGTGCCTTTCCATGTGCGTCAdh3 Adh3 (class III Adh) Rat GACACTCTCCACACTCTTCCAGCCTCCAAAGGCAGTGCCTTTCCACGTGAdh4 Adh4 (class IV Adh) Mouse TCATCTCTGCTCTTCCACCCTCCAAAGACGCAGCCCTTCCACGTACGCCAdh4-1 Adh4 (class ... CCCAGCACAGAACACCCAGCTCTCTGGATCTCAAAATGTCAGGACAGTCCGAdh4-2 Adh4 (class IV Adh) Rat CATCATCTCTGCTCTTCCAACCACCAAAGACGCAGCCCTTCCATGTCCGAdh4-3 Adh4 (class IV Adh) Rat GTGATATCAGAGAACACTGTCAGGAACAAGGCTTCAGGTCACGGTCGCAldh1 ... GGTTAACGGAGAGGCTTTGGGCACTGGGAGGCACCCCGACAATGACGCTAdh1-2 Adh1 (class I Adh) Rat TGGCCTAGAACTGCAGGAAGAGGCGTGAACAGGGATCCACTAACCGCGTAdh3 Adh3 (class III Adh) Mouse CTCTCCACACTCTTCCATCCTCCAAAGGCGGTGCCTTTCCATGTGCGTCAdh3...

Báo cáo khoa học: Experimental and steady-state analysis of the GAL regulatory system in Kluyveromyces lactis docx

... thepresence of a noninducing, nonrepressing (NINR)medium, such as glycerol or rafﬁnose, the GAL switchis in a noninduced state. Under such a condition,KlGal4p activity is inhibited by the binding ... maximumb-galactosidase concentration obtained in glycerolmedium. A typical experimental run that aimed tomaintain a constant glucose concentration of 57 ±4mm is shown in Fig. 4A. The expression of LAC4,the ... state in the absence of galactose. Activated KlGal1p in the nucleus would beabsent in NINR medium and its concentration corre-sponds to 1190 nm in the maximally induced state,representing a...

báo cáo sinh học:" Human resources for health challenges of public health system reform in Georgia" docx

... poorplanning, and ignorance from the local government were mentioned as main reasons for inadequatestaffing. FGD participants were concerned with lack of good training institutions and trainingprograms, ... CPH directors' judgment on various statements about HR policy, management, and funding issues in their CPHStatements about HR policy, management, and funding issues in CPH Mean values and ... participants were consistent in admitting financialresource deficiency and lack of adequate motivations forpublic health system workforce. Diverse factors such asinsufficient funding, lack of...

Báo cáo sinh học: " Strategically examining the full-genome of dengue virus type 3 in clinical isolates reveals its mutation spectra" ppt

... p1259A and cdc2503B in this study covered1239 nucleotides encoding 413 amino acids, includingportion of domain I and II, 3 hinge regions, and completedomain III to the end of the stem-anchor ... it contained 293 amino acids, rangingfrom E118 to E412, which include portions of domain IStrategy in clonal-sequencing the whole genome of genomic RNA of DENV-3Figure 1Strategy in clonal-sequencing ... genomic sequences of DENV within infected individualsremains largely unknown.Results: Instead of arbitrarily choosing one genomic region in this study, the full genomicconsensus sequences of...

Báo cáo sinh học: "Optimal design for the detection of a major gene segregation in crosses" potx

... postweaning growth in mice. Genet Res Camb 44, 293-308Dickerson GE (1973) Inbreeding and heterosis in animals. In: Proc Anim Breeding GenetSymP in honour of Dr JL Lush, ... in F2 and backcrosses. Since that time, a number of crosses between homozygous lines and even between heterogeneous subpopulationshave been conducted in plants and animals ... backcrosses increased between C3 0 and C3 5, C4 0 and C4 4, and C5 0 and C5 4. The major gene was characterized for each of these casesby an effect of 2 residual standard...

Xem thêm

Từ khóa: báo cáo sinh học phân tử báo cáo sinh học 2015 bao cao sinh hoc 11 bai 26 bản báo cáo sinh học về xem băng hình của thúvề đời sống và tập tính chuyên đề báo cáo sinh học báo cáo sinh học thpt bài báo cáo sinh học thực vật urinary tract infections in cats with hyperthyroidism diabetes mellitus and chronic kidney disease what is known about the natural history of urinary tract infections in infants and children how common are urinary tract infections in infants and children poulsen magne bisgaard nguyen thai son nguyen vu trung hoang manh an and anders dalsgaard 2012 enterococcus and streptococcus spp associated with chronic and self medicated urinary tract infections in vietnam báo cáo khoa học sinh học trạng thái hiện sinh báo cáo khoa học báo cáo sinh thái học báo cáo trường học thân thiện học sinh tích cực chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hương Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ