High and complementary expression patterns of alcohol and aldehyde dehydrogenases in the gastrointestinal tract Implications for Parkinson’s disease Marie Westerlund1, Andrea Carmine Belin1, Michael R Felder2, Lars Olson1 and Dagmar Galter1 Department of Neuroscience, Karolinska Institutet, Stockholm, Sweden Department of Biological Sciences, University of South Carolina, Columbia, USA Keywords ADH1; ADH4; ALDH1; epithelium; in situ hybridization Correspondence D Galter, Department of Neuroscience, Karolinska Institutet, 171 77 Stockholm, Sweden Tel: +46 524 870 18 Fax: +46 32 37 42 E-mail: dagmar.galter@ki.se Website: http://www.ki.se (Received 29 September 2006, revised 12 December 2006, accepted 22 December 2006) doi:10.1111/j.1742-4658.2007.05665.x Parkinson’s disease (PD) is a heterogeneous movement disorder characterized by progressive degeneration of dopamine neurons in substantia nigra We have previously presented genetic evidence for the possible involvement of alcohol and aldehyde dehydrogenases (ADH; ALDH) by identifying genetic variants in ADH1C and ADH4 that associate with PD The absence of the corresponding mRNA species in the brain led us to the hypothesis that one cause of PD could be defects in the defense systems against toxic aldehydes in the gastrointestinal tract We investigated cellular expression of Adh1, Adh3, Adh4 and Aldh1 mRNA along the rodent GI tract Using oligonucleotide in situ hybridization probes, we were able to resolve the specific distribution patterns of closely related members of the ADH family In both mice and rats, Adh4 is transcribed in the epithelium of tongue, esophagus and stomach, whereas Adh1 was active from stomach to rectum in mice, and in duodenum, colon and rectum in rats Adh1 and Adh4 mRNAs were present in the mouse gastric mucosa in nonoverlapping patterns, with Adh1 in the gastric glands and Adh4 in the gastric pits Aldh1 was found in epithelial cells from tongue to jejunum in rats and from esophagus to colon in mice Adh3 hybridization revealed low mRNA levels in all tissues investigated The distribution and known physiological functions of the investigated ADHs and Aldh1 are compatible with a role in a defense system, protecting against alcohols, aldehydes and formaldehydes as well as being involved in retinoid metabolism Although the etiology of the neurodegenerative events in Parkinson’s disease (PD) remains largely unknown, evidence suggests that both environmental and genetic factors are involved The disease is characterized by loss of dopamine (DA) neurons in substantia nigra pars compacta (SNpc) and later in the ventral tegmental area These events are accompanied by progressive loss of DA innervation of nucleus caudatus and putamen, resulting primarily in movement disabilities However, degenerative events are also known to involve other neuron populations Suggested causes for the neurodegeneration include oxidative stress, misfolded proteins, inflammation, mitochondrial and ubiquitin–proteasome dysfunction and impaired protection against potentially harmful substances Recently however, several genes have been identified in which mutations are either linked to or associated with disease, shifting the weight of evidence towards genetic causes and complex genetic risk factors in PD Parkinson-linked genes include a-synuclein (SNCA), DJ-1, Abbreviations ADH, alcohol dehydrogenase; ALDH, aldehyde dehydrogenase; DA, dopamine; DOPAC, di-hydroxyphenylacetic acid; DOPAL, 3,4dihydroxyphenylacetaldehyde; DOPET, 3,4-dihydroxyphenylethanol; GI, gastrointestinal; PD, Parkinson’s disease; RA, retinoic acid; SNpc, substantia nigra pars compacta 1212 FEBS Journal 274 (2007) 1212–1223 ª 2007 The Authors Journal compilation ª 2007 FEBS M Westerlund et al Parkin, PINK-1, LRRK2 and UCH-L1 [1] Genes implicated in PD are typically not specifically expressed in DA neurons and sometimes not even in the brain itself, but are instead active in various other tissues Two such genes are alcohol dehydrogenase (ADH1) and ADH4 for which a truncating G78stop mutation (rs283413) and a functionally impaired allele comprising two linked SNPs (rs34925826 and rs11480228), respectively, have been identified to significantly associate with PD [2,3] Aldehyde dehydrogenase (ALDH1), by contrast, is expressed strongly and selectively in the mesencephalic DA neurons, possibly to protect them against the high intracellular levels of aldehydes formed during DA metabolism Notably, ALDH1 mRNA levels have been shown to be specifically downregulated in DA neurons in PD by the use of in situ hybridization [4] and microarray methods [5–7] In the periphery, ADHs and ALDH1 are expressed mainly in the digestive tract and are implicated in detoxification reactions It is thus possible that impaired function of these genes in the lining of the gastrointestinal (GI) tract could cause toxic compounds, such as aldehydes, to reach the circulation and eventually central nervous system neurons A recent study analyzed the enteric nervous system in PD and found that both Meissner’s and Auerbach’s plexuses were affected already in early stages of disease and terminal axons of postganglionic and preganglionic neurons contained a-synuclein-positive aggregates [8] The hypothesis was put forward [8] that a putative environmental pathogenic agent, capable of passing the GI epithelial lining, might induce a-synuclein misfolding and aggregation in specific neurons of the intestinal neuronal plexuses and possibly also reach the central nervous system The mammalian ADHs (EC 1.1.1.1) constitute a complex family of enzymes exhibiting extensive multiplicity with respect to substrate repertoire and tissue distribution They are dimeric, zinc-dependent enzymes, which oxidize and reduce various alcohols and aldehydes using NAD+ ⁄ NADH as electron acceptor and donor, respectively ADHs appear to participate in a general defense towards alcohols and aldehydes, without generating toxic radicals, as is the case for the cytochrome P450 system [9] Even though the ADHs are known to be involved in both retinoid transformation and formaldehyde scavenging, their physiological functions have not been fully revealed Based on their catalytic properties, ADHs have been suggested to be involved in the metabolism of lipid peroxidation products, x-hydroxy fatty acids, xenobiotic alcohols, aldehydes, steroids and biogenic amines According to the most recent nomenclature [10], the Expression of ADH and ALDH in the rodent GI tract ADH classes are designated ADH1–ADH6 (or class I–VI ADH), five of which have been identified in humans ADH1 is abundant in liver where it participates in the oxidation of ingested ethanol [11] Human ADH1 is the only class consisting of isoenzymes, namely ADH1A, ADH1B and ADH1C, although rodents not show this diversity [10] Human ADH2 was first isolated from liver and has a high Km for ethanol [12] ADH3, from which all ADHs are thought to have evolved, is present in all living species investigated to date [13] and exhibits characteristic differences compared with the other classes of ADHs It functions as a glutathione-dependent formaldehyde dehydrogenase and has been shown to catalyze the reductive breakdown of S-nitrosoglutathione, indicating involvement in the metabolism of nitric oxide [14] ADH4 was first identified in gastric mucosa [15] and is the only form of ADH not expressed in liver ADH4 appears to be mainly involved in retinoid metabolism and probably also in first-pass metabolism of ethanol [16] Limited information on substrate specificities is available for ADH5 and ADH6, because these two enzymes have not yet been identified at the protein level Sequence alignment and phylogenetic studies indicate that human ADH5 and rat ADH6 should probably be included in the same class, whereas mouse ADH5 should be regarded as a separate variant [14] Another enzyme superfamily, which operates in close relation to the ADHs, is the ALDHs (EC 1.2.1.3) They catalyze the oxidation of endogenous and exogenous aldehydes into the corresponding acids [17,18] Human ALDH1 (or class I ALDH), is involved primarily in retinoid metabolism where it oxidizes retinal aldehyde to retinoic acid (RA), regulating growth, development and cell differentiation [19] The rat homolog of ALDH1 is also known as RALDH or RalDH-I and the mouse homolog was formerly known as AHD2 There are two other classes of ALDHs, mitochondrial ALDH2 and stomach cytosolic ALDH3, neither of which has been found to participate in RA synthesis in vitro [20] In addition to the exogenous substrates for the ALDHs produced during drug and xenobiotic metabolism, there are a number of endogenous substrates, including biogenic amines and other neurotransmitters, retinal aldehyde, corticosteroids, and products of amino acid catabolism and membrane lipid peroxidation [21] In the light of these observations, the detoxification systems in the epithelial lining of the GI tract deserve further investigation as to their possible etiological roles for forms of PD Here we map the expression pattern of the Adh1, Adh3, Adh4 and Aldh1 genes in the adult mouse and rat GI tract Revealing the tissue FEBS Journal 274 (2007) 1212–1223 ª 2007 The Authors Journal compilation ª 2007 FEBS 1213 Expression of ADH and ALDH in the rodent GI tract M Westerlund et al expression patterns will help explain the physiological functions of these enzymes and also how genetically dysfunctional ADHs and ALDHs might be involved in PD pathology To allow accurate identification of the closely related Adh1 and Adh4 gene products, we used multiple specific oligonucleotide probes, and ascertained specificity by tests on Adh1 and Adh4 null-mutated mice We present novel data about the distribution patterns of all investigated genes, and can correct a previous study in which Adh1 and Adh4 were not correctly separated We found that the cellular distribution of the enzymes described here, reflects what has been known about their properties from biochemical studies including investigations in human tissues, and that this has implications for how to interpret the role of the studied enzymes in health and disease Results The distribution and relative intensity of expression of the Adh1, Adh3, Adh4 and Aldh1 genes in the GI tract of rats and mice is summarized in Fig and Table Figures and document key findings and Fig documents probe controls Figure summarizes details of localization of the mRNA species at different depths of the GI epithelium: stomach (Fig 5A), small intestine (Fig 5B) and large intestine (Fig 5C) Adh1, Adh3, Adh4 and Aldh1 transcription in mouse tissues Adh1 and Adh4 mRNAs were expressed along the entire mouse GI tract (Fig 2), in different patterns and intensities High Adh4 and low Adh1 expression was found in the upper part of the digestive tract, including the tongue and esophagus The mRNA signal was located at the base of the stratified squamous epithelium, with a gradient observed towards the superficial layers, while the submucosa showed no expression Both enzyme classes were expressed in gastric mucosa, mainly with complementary, rather than overlapping patterns The Adh1 signal was restricted mainly to the neck of the gastric gland, whereas Adh4 was restricted to the gastric pit closer to the lumen At the gastroduodenal junction there was an abrupt termination of Adh4 expression, such that the gut expressed only Adh1 from duodenum through jejunum, ileum, colon and rectum In duodenum, the Adh1 signal was found in the outer epithelial border of the villi Expression was found to be highest at the base of the villi and in the intestinal glands, while submucosal glands were empty In jejunum and ileum, Adh1 1214 mRNA showed a similar expression pattern as described for duodenum In colon and rectum, the Adh1 signal was found to be restricted to the base of the crypts, leaving the upper part devoid of signal Low levels of Adh1 mRNA were also observed in striated muscles of the tongue and upper part of esophagus, as well as in the smooth muscle layers in the walls of the GI tract from esophagus to rectum Unlike Adh1, Adh4 and Aldh1, Adh3 was not restricted to certain tissues but was ubiquitously expressed in almost all tissues investigated Notably, the levels of Adh3 mRNA were much lower than those of the other classes of investigated enzymes High levels of Aldh1 mRNA were found in the basal epithelial cell layers of esophagus with a decrease in signal intensity observed towards the superficial layers In the stomach, Aldh1 mRNA was present in the epithelial cells of the gastric pits and in the neck of the gastric glands Aldh1 expression continued in duodenum with the signal confined to the epithelial cells of the villi, whereas the lamina propria showed no expression In jejunum and ileum, a similar expression pattern as in duodenum was observed showing Aldh1 mRNA signal in epithelial cells at the base of the villi In colon, Aldh1 gene activity was detected in the upper parts of the crypts of Lieberkuhn, whereas the lower ă parts of the crypts, the submucosa and underlying muscle layers were negative Aldh1 was thus transcribed in the mucosa from esophagus to colon, while rectum was mainly devoid of detectable levels of Aldh1 mRNA Adh1, Adh3, Adh4 and Aldh1 transcription in rat tissues In the rat GI tract (Fig 3) a similar Adh4 mRNA expression pattern as described for mice was observed Adh4 mRNA was found in the upper part of the tract including the epithelial cells of the tongue, esophagus and stomach, where it was expressed from the cardiac to the pyloric region, down to the gastroduodenal junction By contrast to mouse, the rat showed no expression of Adh1 mRNA in jejunum or ileum However, in colon and rectum, Adh1 was found to be present in the epithelial cells in the lower parts of the intestinal glands As in mice, low levels of Adh3 mRNA expression were found in almost all the tissues investigated In the rat GI tract, Aldh1 mRNA was found in the epithelial cells from tongue to jejunum The tongue and esophagus expressed Aldh1 mRNA in the basal layer of the stratified squamous epithelium, whereas the outermost layers facing the lumen as well FEBS Journal 274 (2007) 1212–1223 ª 2007 The Authors Journal compilation ª 2007 FEBS M Westerlund et al Expression of ADH and ALDH in the rodent GI tract Fig Localization of alcohol dehydrogenase (Adh1), Adh4 and Aldh1 mRNAs at eight different levels of the mouse and rat GI tracts from tongue to rectum Tissues were radioactively labeled with oligo probes for in situ hybridization followed by exposure to autoradiographic film Adh1 is present at low levels in tongue and esophagus and at higher levels from stomach to rectum in mice, whereas corresponding rat tissues show expression only in duodenum, colon and rectum In both mouse and rat, Adh4 is found in the epithelial lining of upper GI tract including the tongue, esophagus and stomach, but not in the small and large intestines In the rat, Aldh1 is present higher up in the GI tract from tongue to jejunum compared with the mouse where the expression can be observed from esophagus to colon Arrows are pointing at the epithelium The scale bar ¼ mm Figure provides an overview of the distribution of mRNA signals For comparisons of labeling intensities between mRNA species and tissues, refer to Table as the underlying submucosa were negative Aldh1 was also active in the stomach mucosa, restricted mainly to the neck of the gastric glands In duodenum and jejunum a similar expression as described for mice was observed showing Aldh1 mRNA at the base of the villi FEBS Journal 274 (2007) 1212–1223 ª 2007 The Authors Journal compilation ª 2007 FEBS 1215 Expression of ADH and ALDH in the rodent GI tract M Westerlund et al Fig Alcohol dehydrogenase (Adh) and aldehyde dehydrogenase (Aldh) mRNA expression in the mouse GI tract as revealed by in situ hybridization Left-hand panels were counter-stained with cresyl violet and photographed under bright field microscopy to illustrate tissue morphology The other panels are dark-field photomicrographs of corresponding sections at the same magnification Together, Adh1 and Adh4 provide a continuous expression pattern in the epithelial cells of the mucosa in the GI tract Moderate to high levels of Adh1 mRNA are observed in stomach, jejunum and rectum, while Adh4 expression is observed from tongue to stomach, but not in small and large intestines Adh3 shows low and ubiquitous expression in all tissues and Aldh1 is observed at low to moderate levels in esophagus, stomach and jejunum, but not in rectum The apparent signal in the outer keratinized layer of the tongue and esophagus is due to light scatter The scale bar ¼ 100 lm Probe specificity Adh1 and Adh4 probe-specificities were tested on tissues from wild-type, Adh1– ⁄ – and Adh4– ⁄ – mice Liver 1216 and esophagus were used, as these tissues are known to express high levels of Adh1 and Adh4 mRNA, respectively Adh1 hybridization revealed expression in liver of wild-type (Fig 4A) but not in knockout FEBS Journal 274 (2007) 1212–1223 ª 2007 The Authors Journal compilation ª 2007 FEBS M Westerlund et al Expression of ADH and ALDH in the rodent GI tract Fig Alcohol dehydrogenase (Adh) and aldehyde dehydrogenase (Aldh) mRNA expression in the rat gastrointestinal tract Left-hand panels were counter-stained with cresyl violet and photographed under bright-field microscopy, the other panels are dark-field photomicrographs of corresponding sections at the same magnification High levels of Adh1 mRNA are observed in the epithelial cells at the base of the intestinal glands in rectum and moderate levels of Adh4 are present in the epithelial cell layer of tongue, esophagus and stomach, where the signal is located to the gastric pits Adh3 does not show restriction to the epithelium, but is expressed ubiquitously and at low levels in all tissues Low to moderate Aldh1 gene activity is observed in the epithelial cells of the tongue and esophagus, in the gastric glands and at the base of the villi in jejunum The apparent signal in the outer keratinized layer of the tongue and esophagus is due to light scatter Scale bar ¼ 100 lm (Fig 4B) mice, whereas Adh4 hybridization showed a corresponding pattern with a positive signal in esophagus epithelium of wild-type (Fig 4C) but not knockout mice (Fig 4D), as expected Hybridization of colon, to represent GI tract tissues, with a random probe generated no signal above background level (Fig 4E) FEBS Journal 274 (2007) 1212–1223 ª 2007 The Authors Journal compilation ª 2007 FEBS 1217 Expression of ADH and ALDH in the rodent GI tract A C B M Westerlund et al D E Fig Microscopic pictures of control mouse tissues hybridized with Adh1, Adh4 or a random probe Liver from an Adh1– ⁄ – mouse showed no signal for the Adh1 probe used, and esophagus from an Adh4 – ⁄ – mouse showed no specific signal in the epithelial lining as expected Colon showed no specific signal when hybridized to a random probe Scale bar ¼ 20 lm Discussion We undertook this investigation because polymorphisms in the genes encoding human ADH1 and ADH4 have previously been associated with an increased risk of PD, even though these genes are not expressed by neurons or glial cells in the brain [22] A prerequisite for the hypothesis that mutations of these two enzyme families may increase PD risk, by decreasing the defense against reactive aldehydes present in food or produced during lipid peroxidation, is that the genes are active in the GI tract In this study we therefore mapped the cellular expression of Adh1, Adh3, Adh4 and Aldh1 genes along the entire GI tract of mice and rats Increased levels of aldehydes reaching the brain may explain why both DA neurons and a plethora of other neurons are also affected in PD The particular vulnerability of DA neurons may be explained by the high levels of DA metabolites, including the aldehyde 3,4-dihydroxyphenylacetaldehyde (DAL) and the fact that DA itself can react with aldehydes to form toxic isoquinolines such as salsolinol [23] In line with the suggested role of ADHs and ALDHs in protection against toxic insults, mRNAs encoding these enzymes have previously been identified in tissues forming a physiological and enzymatic barrier against the environment Adh1 and Adh4 have been observed in the epithelial lining of the human [24,25] and rodent GI tract [26–29] as well as in rodent epidermis [30], which together form a first line of defense against toxic insults In addition to adult rodents, Adh1 and Adh4 have also been identified in various embryonic 1218 tissues [30,31] Upon entering the body, toxins may also become enzymatically degraded in the liver, which expresses high levels of both Adh [32] and Aldh [33,34] Our results demonstrate ADH and ALDH mRNA expression along the entire GI tract, with specific gene activity patterns observed for each enzyme, showing restriction both to specific regions of the tract as well as to certain cell types Our findings are mainly in agreement with a previous study by Vaglenova et al [26] with regard to the patterns of localization of Adh1 and Adh4 mRNAs in the GI tract However, since Vaglenova et al reported presence of Adh4 message also below the level of the stomach, we took particular care in verifying the absence of Adh4 activity in the small and large intestines by using three different Adh4-specific oligo probes While all our three probes hybridized in the same manner to epithelial cells from tongue to stomach, none of them generated signals below this level of the GI tract There are significant sequence similarities between the Adh1 and Adh4 genes, and it is thus possible that long riboprobes as used by Vaglenova et al may be less efficient in discriminating these two genes, possibly leading to a degree of crosshybridization of their Adh4 probe to Adh1 The characteristic expression patterns observed for Adh1 and Adh4 along the GI tract reflect different functional requirements of the two classes of enzymes Expression of Adh4 in the upper part of the tract close to the external environment, where the epithelial cell turnover is high, fits well with the known involvement of the enzyme in RA synthesis required for cell proliferation [26] Expression of Adh1 in deeper layers of the FEBS Journal 274 (2007) 1212–1223 ª 2007 The Authors Journal compilation ª 2007 FEBS M Westerlund et al Fig Schematic drawings of the stomach (A), small (B) and large (C) intestinal walls The figure shows the localization of Adh1, Adh3, Adh4 and Aldh1 mRNA expression in the rat (R) and mouse (M) gastrointestinal mucosa The results from duodenum, jejunum and ileum are collectively presented in (B) and the results from colon and rectum are collectively presented in (C) The Adh1 mRNA signal in rat small intestine represents duodenum only, the Aldh1 signal in rat small intestine represents duodenum and jejunum and the Aldh1 signal in mouse large intestine represents colon only (Reprinted from Schultzberg et al [46] with permission from Elsevier Science.) stomach mucosa as well in the lower tract including small and large intestines fits with the role of this enzyme in metabolism of ingested alcohols, because ADH1 has been shown to have a high efficiency for ethanol metabolism Whereas Adh1 and Adh4 expression was highly restricted to the epithelial cells of the GI mucosa, Adh3 was observed at much lower levels in all tissues in both mice and rats This is in line with the different substrate repertoire known for this enzyme Rather than being involved in ethanol and retinol oxidation, Adh3 is mainly active towards glutathione-coupled formaldehydes [35], but also towards free hydroxyfatty acids and leukotrienes Owing to its ubiquitous tissue expression, the gene encoding Adh3 has been suggested to have a house keeping function This hypothesis is further supported by the fact that ADH3 is the highly conserved ancestral form from which all classes of ADHs have evolved [36] Aldh1 has previously been found to be specifically and strongly expressed by DA neurons in SN, which might reflect the need for efficient RA formation and ⁄ or aldehyde detoxification by these neurons [4] The main function of ALDH is in the last step of retinoid metabolism where it catalyzes oxidation of retinal aldehyde to RA, which is essential for cell growth and development ALDH is also involved in the conversion of the DA metabolite DOPAL to di-hydroxyphenylacetic acid (DOPAC) [37] Like other endogenous aldehydes, DOPAL has been shown to be toxic to DA neurons both in vitro and in vivo [38,39] Intracellular formation of aldehydes might be associated with the specific vulnerability of DA neurons in SN and in line with this hypothesis, DOPAL has been found to be more toxic to neurons of SN compared to ventral tegmental area [40] Mitochondrial dysfunction is another event implicated in PD pathogenesis and inhibition of mitochondrial complex I and III leads to elevated levels of DOPAL and 3,4-dihydroxyphenylethanol (DOPET) in vitro [41] Expression of ADH and ALDH in the rodent GI tract A B C In conclusion, we have detected Adh1, Adh3, Adh4 and Aldh1 transcription in the mucosal layer of the rodent GI tract, with characteristic regional differ- FEBS Journal 274 (2007) 1212–1223 ª 2007 The Authors Journal compilation ª 2007 FEBS 1219 Expression of ADH and ALDH in the rodent GI tract M Westerlund et al Table Oligonucleotide probe sequences complementary to mouse and rat Adh1, Adh3, Adh4 and Aldh1 Probe Gene Species Sequence 5’- to 3’ Adh1 Adh1-1 Adh1-2 Adh3 Adh3 Adh4 Adh4-1 Adh4-2 Adh4-3 Aldh1 Random Adh1 (class I Adh) Adh1 (class I Adh) Adh1 (class I Adh) Adh3 (class III Adh) Adh3 (class III Adh) Adh4 (class IV Adh) Adh4 (class IV Adh) Adh4 (class IV Adh) Adh4 (class IV Adh) Aldh1 (class I Aldh) – Mouse Rat Rat Mouse Rat Mouse Rat Rat Rat Rat ⁄ mouse Rat ⁄ mouse ACAGCCAATGATGACAGACAGACCGACACCTCCGAGGCCAAACACGGC GGTTAACGGAGAGGCTTTGGGCACTGGGAGGCACCCCGACAATGACGCT TGGCCTAGAACTGCAGGAAGAGGCGTGAACAGGGATCCACTAACCGCGT CTCTCCACACTCTTCCATCCTCCAAAGGCGGTGCCTTTCCATGTGCGTC GACACTCTCCACACTCTTCCAGCCTCCAAAGGCAGTGCCTTTCCACGTG TCATCTCTGCTCTTCCACCCTCCAAAGACGCAGCCCTTCCACGTACGCC CCCAGCACAGAACACCCAGCTCTCTGGATCTCAAAATGTCAGGACAGTCCG CATCATCTCTGCTCTTCCAACCACCAAAGACGCAGCCCTTCCATGTCCG GTGATATCAGAGAACACTGTCAGGAACAAGGCTTCAGGTCACGGTCGC GGCCTTCACAGCTTTGTCAACATCTGCCTTGTCCCCTTCTTCCACATGGC ATGGTGGTGCGTTTGAGGTAATGGAGGGCTGCGATCGTTTTCCGTTGGGG Table mRNA expression levels of Adh1, Adh3, Adh4 and Aldh1 in the rat and mouse GI tract Tissues were investigated using radioactive oligonucleotide in situ hybridization and the signals were scored semiquantitatively (see Experimental procedures) using bright- and dark-field microscopy Tissue Adh1 Adh3 Adh4 Aldh1 Rat Mouse Rat Mouse Rat Mouse Rat Mouse Tongue Esophagus Stomach Duodenum Jejunum Ileum Colon Rectum – – – ++ – – ++ ++ +– +– + ++ ++ + + + +– +– +– +– +– +– +– +– +– +– +– +– +– +– +– +– + ++ ++ – – – – – + ++ ++ – – – – – ++ ++ + + + – – – – + + + + + + – part of the Adh1 gene, an advantage when double and triple knockouts are used Genotyping was carried out using previously described methods and primers [44] Animals were killed by cervical dislocation and tissues including tongue, esophagus, stomach, duodenum, jejunum, ileum, colon, rectum and liver were dissected and rapidly frozen on dry ice Stomach and intestines were washed with Ringer’s solution to remove contents Tissues were sectioned at 14 lm, thawed onto coated glass slides (Menzel-Glaser, Braunschweig, ă Germany) and stored at )20 °C until use Serial sectioning and hybridization of adjacent sections was performed Results were based on five observations per tissue type and probe Animal experiments were approved by the Swedish Animal Ethics Committee (Stockholm, Sweden) Probes ences Characterization of the expression patterns of the two enzyme superfamilies might help evaluating their possible involvement in PD pathology The distribution in the lining of the GI tract suggests that ADHs may function as defense enzymes, protecting against alcohols (ADH1, ADH4), aldehydes (ALDH1) and formaldehydes (ADH3) as well as being involved in retinoid metabolism (ADH4) Experimental procedures Animal tissues Adult Sprague–Dawley rats (n ¼ 2) (Scanbur BK, Sollentuna, Sweden), C57BL ⁄ (B6) mice (n ¼ 2), B6.Adh1– ⁄ – (n ¼ 1) [42] and Adh4– ⁄ – (n ¼ 1) [43], were kept under standardized temperature, light and humidity conditions and given food and water ad libitum The B6.Adh1– ⁄ – strain was obtained by backcrossing Adh1– ⁄ – mice [42] for six generations to the congenic B6.S line homozygous for the Adh1a allele The Adh1– ⁄ –-targeted allele is derived from the Adh1b allele and can be identified by variations outside the deleted 1220 Species-specific oligonucleotide probes targeting Adh1 (class I Adh), Adh3 (class III Adh) and Adh4 (class IV Adh) mRNAs and a species combined probe targeting mouse and rat Aldh1 (class I Aldh) mRNA (Table 1) were used Probes directed against different sequences within the same gene, gave coherent results according to signal intensity and area of expression A random probe with similar length and GC content to the probes listed in Table showed no localized or specific binding to tissue components Signal intensities were scored using a semiquantitative scale with five steps (–,+),+,++ and +++) Scores were based on several sections ⁄ animal and several animals ⁄ observation and confirmed by two experienced observers Reliability of the scores was ascertained by the positive correlation between different probes targeting the same mRNA species, between multiple tissue samples from individual animals, between animals as well as between observers (Table 2) In situ hybridization In situ hybridization was carried out according to a published protocol [45] with some modifications: Tissue FEBS Journal 274 (2007) 1212–1223 ª 2007 The Authors Journal compilation ª 2007 FEBS M Westerlund et al sections were air-dried at room temperature prior to use Probes were 3¢-end labeled with dATP (Perkin–Elmer, Boston, MA) using terminal deoxynucleotidyl transferase (TdT; Amersham Biosciences, Little Chalfont, UK) and washed using ProbeQuant G50-Micro Columns (Amersham Biosciences) Labeled probes were diluted in hybridization solution containing 4· NaCl ⁄ Cit (0.6 m NaCl, 0.06 m sodium citrate), 0.02 m Na3PO4 (pH 7.0), 10% w ⁄ v dextran sulfate, 0.2 m dithiothreitol, 1· Denhardt’s solution, 1% sarcosyl, 50% formamide and 0.5 lgỈlL)1 sheared salmon sperm DNA Hybridization of sections with probe-containing hybridization solution (150 lLỈslide)1) was carried out over night (16–18 h) at 42 °C followed by washing · 15 in 60 °C 1· NaCl ⁄ Cit and in deionized water at room temperature Sections were dehydrated in increasing concentrations of ethanol and finally air-dried Parallel sets of slides were exposed to autoradiographic films (Biomax, Eastman Kodak Co, Rochester, NY) for 14 days or to photographic emulsion (NTB2, Eastman Kodak) diluted : for 21 days, developed, counter-stained with 0.5% cresyl violet, mounted and analyzed by bright and dark field microscopy Autoradiographic films were digitalized (adobe photoshop 7.0) and artifacts were removed Expression of ADH and ALDH in the rodent GI tract Acknowledgements We thank Eva Lindqvist and Karin Lundstromer for ă excellent technical assistance This study was supported by the Swedish Research Council, the Swedish Brain ˚ Foundation and the Hallsten Foundation, the Swedish Parkinson Foundation, Swedish Brain Power, Bjorn ă Oscarssons Stiftelse, USPHS grants and Karolinska Institutet Funds The Adh4 knockout mice were kindly provided by Dr Gregg Duester from the Burnham Institute for Medical Research Support for construction of the B6.Adh1– ⁄ – congenic strain was provided by NIH grant AA11828 10 11 12 References 13 Farrer MJ (2006) Genetics of Parkinson disease: paradigm shifts and future prospects Nat Rev Genet 7, 306– 318 Buervenich S, Sydow O, Carmine A, Zhang Z, Anvret M & Olson L (2000) Alcohol dehydrogenase alleles in Parkinson’s disease Mov Disord 15, 813–818 Buervenich S, Carmine A, Galter D, Shahabi HN, Johnels B, Holmberg B, Ahlberg J, Nissbrandt H, Eerola J, Hellstrom O et al (2005) A rare truncating mutation in ă ADH1C (G78Stop) shows signicant association with Parkinson disease in a large international sample Arch Neurol 62, 74–78 Galter D, Buervenich S, Carmine A, Anvret M & Olson L (2003) ALDH1 mRNA: presence in human 14 15 16 DAmine neurons and decreases in substantia nigra in Parkinson’s disease and in the ventral tegmental area in schizophrenia Neurobiol Dis 14, 637–647 Grimm J, Mueller A, Hefti F & Rosenthal A (2004) Molecular basis for catecholaminergic neuron diversity Proc Natl Acad Sci USA 101, 13891–13896 Mandel S, Grunblatt E, Riederer P, Amariglio N, Jacob-Hirsch J, Rechavi G & Youdim MB (2005) Gene expression profiling of sporadic Parkinson’s disease substantia nigra pars compacta reveals impairment of ubiquitin-proteasome subunits, SKP1A, aldehyde dehydrogenase, and chaperone HSC-70 Ann NY Acad Sci 1053, 356–375 Grunblatt E, Mandel S, Jacob-Hirsch J, Zeligson S, Amariglo N, Rechavi G, Li J, Ravid R, Roggendorf W, Riederer P et al (2004) Gene expression profiling of parkinsonian substantia nigra pars compacta; alterations in ubiquitin-proteasome, heat shock protein, iron and oxidative stress regulated proteins, cell adhesion ⁄ cellular matrix and vesicle trafficking genes J Neural Transm 111, 1543–1573 Braak H, de Vos RA, Del Bohl J & TK (2006) Gastric alpha-synuclein immunoreactive inclusions in Meissner’s and Auerbach’s plexuses in cases staged for Parkinson’s disease-related brain pathology Neurosci Lett 396, 67–72 Hoog JO, Hedberg JJ, Stromberg P & Svensson S ă ă ă (2001) Mammalian alcohol dehydrogenase functional and structural implications J Biomed Sci 8, 71–76 Duester G, Farres J, Felder MR, Holmes RS, Hoog ă ă JO, Pares X, Plapp BV, Yin SJ & Jornvall H (1999) ă Recommended nomenclature for the vertebrate alcohol dehydrogenase gene family Biochem Pharmacol 58, 389–395 Crabb DW, Bosron WF & Li TK (1987) Ethanol metabolism Pharmacol Ther 34, 59–73 Li TK, Bosron WF, Dafeldecker WP, Lange LG & Vallee BL (1977) Isolation of pi-alcohol dehydrogenase of human liver: is it a determinant of alcoholism? Proc Natl Acad Sci USA 74, 4378–4381 Jornvall H, Hoog JO & Persson B (1999) SDR and ă ă ă MDR: completed genome sequences show these protein families to be large, of old origin, and of complex nature FEBS Lett 445, 261–264 Hoog JO, Stromberg P, Hedberg JJ & Grifths WJ ă ă ă (2003) The mammalian alcohol dehydrogenases interact in several metabolic pathways Chem Biol Interact 143–144, 175–181 Yin SJ, Wang MF, Liao CS, Chen CM & Wu CW (1990) Identification of a human stomach alcohol dehydrogenase with distinctive kinetic properties Biochem Int 22, 829–835 Yin SJ, Chou CF, Lai CL, Lee SL & Han CL (2003) Human class IV alcohol dehydrogenase: kinetic FEBS Journal 274 (2007) 1212–1223 ª 2007 The Authors Journal compilation ª 2007 FEBS 1221 Expression of ADH and ALDH in the rodent GI tract 17 18 19 20 21 22 23 24 25 26 27 28 29 30 M Westerlund et al mechanism, functional roles and medical relevance Chem Biol Interact 143–144, 219–227 Vasiliou V, Bairoch A, Tipton KF & Nebert DW (1999) Eukaryotic aldehyde dehydrogenase (ALDH) genes: human polymorphisms, and recommended nomenclature based on divergent evolution and chromosomal mapping Pharmacogenetics 9, 421–434 Perozich J, Nicholas H, Wang BC, Lindahl R & Hempel J (1999) Relationships within the aldehyde dehydrogenase extended family Protein Sci 8, 137–146 Dockham PA, Lee MO & Sladek NE (1992) Identification of human liver aldehyde dehydrogenases that catalyze the oxidation of aldophosphamide and retinaldehyde Biochem Pharmacol 43, 2453–2469 Yoshida A, Hsu LC & Dave V (1992) Retinal oxidation activity and biological role of human cytosolic aldehyde dehydrogenase Enzyme 46, 239–244 Pappa A, Sophos NA & Vasiliou V (2001) Corneal and stomach expression of aldehyde dehydrogenases: from fish to mammals Chem Biol Interact 130–132, 181–191 Galter D, Carmine A, Buervenich S, Duester G & Olson L (2003) Distribution of class I, III and IV alcohol dehydrogenase mRNAs in the adult rat, mouse and human brain Eur J Biochem 270, 1316–1326 Yamanaka Y, Walsh MJ & Davis VE (1970) Salsolinol, an alkaloid derivative of DAmine formed in vitro during alcohol metabolism Nature 227, 1143–1144 Estonius M, Svensson S & Hoog JO (1996) Alcohol ă ă dehydrogenase in human tissues: localisation of transcripts coding for five classes of the enzyme FEBS Lett 397, 338–342 Yin SJ, Chou FJ, Chao SF, Tsai SF, Liao CS, Wang SL, Wu CW & Lee SC (1993) Alcohol and aldehyde dehydrogenases in human esophagus: comparison with the stomach enzyme activities Alcohol Clin Exp Res 17, 376–381 Vaglenova J, Martinez SE, Porte S, Duester G, Farres J & Pares X (2003) Expression, localization and potential physiological significance of alcohol dehydrogenase in the gastrointestinal tract Eur J Biochem 270, 2652–2662 Tietjen TG, Mjaatvedt CH & Yang VW (1994) Cellular localization of the class I alcohol dehydrogenase transcript in adult rat tissues Histochem J 26, 526–532 Haselbeck RJ & Duester G (1997) Regional restriction of alcohol ⁄ retinol dehydrogenases along the mouse gastrointestinal epithelium Alcohol Clin Exp Res 21, 1484– 1490 Koivisto T & Salaspuro M (1996) Aldehyde dehydrogenases of the rat colon: comparison with other tissues of the alimentary tract and the liver Alcohol Clin Exp Res 20, 551–555 Westerlund M, Galter D, Carmine A & Olson L (2005) Tissue- and species-specific expression patterns of class I, III, and IV Adh and Aldh1 mRNAs in rodent embryos Cell Tissue Res 322, 227–236 1222 31 Ang HL, Deltour L, Zgombic-Knight M, Wagner MA & Duester G (1996) Expression patterns of class I and class IV alcohol dehydrogenase genes in developing epithelia suggest a role for alcohol dehydrogenase in local retinoic acid synthesis Alcohol Clin Exp Res 20, 1050–1064 32 Maly IP, Toranelli M & Sasse D (1999) Distribution of alcohol dehydrogenase isoenzymes in the human liver acinus Histochem Cell Biol 111, 391–397 33 Stewart MJ, Malek K & Crabb DW (1996) Distribution of messenger RNAs for aldehyde dehydrogenase 1, aldehyde dehydrogenase 2, and aldehyde dehydrogenase in human tissues J Invest Med 44, 42–46 34 Hsu LC, Chang WC, Hoffmann I & Duester G (1999) Molecular analysis of two closely related mouse aldehyde dehydrogenase genes: identification of a role for Aldh1, but not Aldh-pb, in the biosynthesis of retinoic acid Biochem J 339 (2), 387–395 35 Koivusalo M, Baumann M & Uotila L (1989) Evidence for the identity of glutathione-dependent formaldehyde dehydrogenase and class III alcohol dehydrogenase FEBS Lett 257, 105–109 36 Jornvall H, Hoog JO, Persson B & Pares X (2000) ă ă ă Pharmacogenetics of the alcohol dehydrogenase system Pharmacology 61, 184–191 37 Tank AW, Weiner H & Thurman JA (1981) Enzymology and subcellular localization of aldehyde oxidation in rat liver Oxidation of 3,4-dihydroxyphenylacetaldehyde derived from DAmine to 3,4-dihydroxyphenylacetic acid Biochem Pharmacol 30, 3265–3275 38 Mattammal MB, Haring JH, Chung HD, Raghu G & Strong R (1995) An endogenous DAminergic neurotoxin: implication for Parkinson’s disease Neurodegeneration 4, 271–281 39 Esterbauer H, Schaur RJ & Zollner H (1991) Chemistry and biochemistry of 4-hydroxynonenal, malonaldehyde and related aldehydes Free Radical Biol Med 11, 81–128 40 Burke WJ, Li SW, Williams EA, Nonneman R & Zahm DS (2003) 3,4-Dihydroxyphenylacetaldehyde is the toxic DAmine metabolite in vivo: implications for Parkinson’s disease pathogenesis Brain Res 989, 205–213 41 Lamensdorf I, Eisenhofer G, Harvey-White J, Hayakawa Y, Kirk K & Kopin IJ (2000) Metabolic stress in PC12 cells induces the formation of the endogenous DAminergic neurotoxin, 3,4-dihydroxyphenylacetaldehyde J Neurosci Res 60, 552–558 42 Deltour L, Foglio MH & Duester G (1999) Metabolic deficiencies in alcohol dehydrogenase Adh1, Adh3, and Adh4 null mutant mice Overlapping roles of Adh1 and Adh4 in ethanol clearance and metabolism of retinol to retinoic acid J Biol Chem 274, 16796–16801 43 Deltour L, Foglio MH & Duester G (1999) Impaired retinol utilization in Adh4 alcohol dehydrogenase mutant mice Dev Genet 25, 1–10 FEBS Journal 274 (2007) 1212–1223 ª 2007 The Authors Journal compilation ª 2007 FEBS M Westerlund et al 44 Szalai G, Xie D, Wassenich M, Veres M, Ceci JD, Dewey MJ, Molotkov A, Duester G & Felder MR (2002) Distal and proximal cis-linked sequences are needed for the total expression phenotype of the mouse alcohol dehydrogenase (Adh1) gene Gene 291, 259–270 45 Dagerlind A, Friberg K, Bean AJ & Hokfelt T (1992) ă Sensitive mRNA detection using unfixed tissue: combined radioactive and non-radioactive in situ hybridization histochemistry Histochemistry 98, 39–49 Expression of ADH and ALDH in the rodent GI tract 46 Schultzberg M, Hokfelt T, Nilsson G, Terenius L, Rehfeld JF, Brown M, Elde R, Goldstein M & Said S (1980) Distribution of peptide- and catecholaminecontaining neurons in the gastro-intestinal tract of rat and guinea-pig: immunohistochemical studies with antisera to substance P, vasoactive intestinal polypeptide, enkephalins, somatostatin, gastrin ⁄ cholecystokinin, neurotensin and dopamine beta-hydroxylase Neuroscience 5, 689–744 FEBS Journal 274 (2007) 1212–1223 ª 2007 The Authors Journal compilation ª 2007 FEBS 1223 ... systems in the epithelial lining of the GI tract deserve further investigation as to their possible etiological roles for forms of PD Here we map the expression pattern of the Adh1, Adh3, Adh4 and. .. in the epithelial cells of the gastric pits and in the neck of the gastric glands Aldh1 expression continued in duodenum with the signal confined to the epithelial cells of the villi, whereas the. .. Results The distribution and relative intensity of expression of the Adh1, Adh3, Adh4 and Aldh1 genes in the GI tract of rats and mice is summarized in Fig and Table Figures and document key findings