Báo cáo khoa học: "Root biomass and biomass increment in a beech (Fagus sylvatica L ) stand in North-East France " doc
Báo cáo khoa học: "Root biomass and biomass increment in a beech (Fagus sylvatica L.) stand in North-East France." doc
... values within the limits of first and third quartile.Original articleRoot biomass and biomass increment in a beech (Fagus sylvatica L. ) stand in North-East France No l Le Goff* and Jean-Marc ... wereobtained: biomass of each root category – coarse, small and fine – and total root system biomass, current annual biomass increment of coarse and small roots (table IV).The total annual biomass ... same pattern of variation wasobserved with biomass increments of coarse and smallroots (figure 5b).3.2. Stand level3.2.1. Biomass and biomass increment The stand biomass and the biomass increments...
- 13
- 374
- 0
Báo cáo khoa học: Identification and structural characterization of a sialylated lacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus influenzae pptx
... (25 lgÆmL )1 ), CMP-Neu5Ac(50 lgÆmL )1 ), kanamycin (10 lgÆmL )1 ) or tetracycline(4 lgÆmL )1 ). Structural analysis and purification of LPSLPS was prepared for structural analysis from cellsharvested ... remains an important cause ofdisease worldwide. Encapsulated strains can cause invasive,bacteraemic infections such as septicemia and strainslacking a capsule, so-called nontypeable strains ... Y., Lesse, A. ,Yamasaki, R., Gibson, B., Spinola, S.M. & Apicella, M .A. (199 2) Lipooligosaccharides (LOS) of some Haemophilus species mimichuman glycosphingolipids, and some LOS are sialylated....
- 11
- 579
- 0
Tài liệu Báo cáo khoa học: Pronounced adipogenesis and increased insulin sensitivity caused by overproduction of prostaglandin D2 in vivo pptx
... Japan) and Antsense II (Bayer Medical, Tokyo, Japan), respectively.Plasma leptin and insulin levels were measured by usingELISA kits (Morinaga Institute of Biological Science,Yokohama, Japan), ... 5¢-GATGTGGAACCCATAACTGGATTCAC-3¢ and 5¢-GGTCCCAGTCTCATTTAGCCACAGTA-3¢ forCD36, 5¢-GCGTCGGGTAGATCCAGTT-3¢ and 5¢-CTCAGTGGGGCTTAGCTCTG-3¢ for ACC, and 5¢-AACACCCCAGCCATGTACGTAG-3¢ and 5¢-TGTCAAAGAAAGGGTGTAAAACGC-3¢ ... 3-isobutyl-1-methylxanthine; L- PGDS, lipocalin-type prostaglandin D synthase; LPL,lipoprotein lipase; PG, prostaglandin; PGDS, prostaglandin D synthase; PPAR, peroxisome proliferator-activated receptor;...
- 10
- 647
- 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx
... 401–407.Supplementary materialThe following supplementary material is availableonline:Fig. S1. Natural and synthetic conomarphin with all l- amino acids on HPLC.Fig. S2. The fragments of natural conomarphin ... PeptProtein Res 17, 275–283.10 Kuwada M, Teramoto T, Kumagaye KY, Nakajima K,Watanabe T, Kawai T, Kawakami Y, Niidome T,Sawada K, Nishizawa Y et al. (199 4) Omega-agatoxin-TK containing D-serine at ... omega- [L- Ser46]agatoxin-TK, exerts blockade ofP-type calcium channels in cerebellar Purkinje neurons.Mol Pharmacol 46, 587–593.11 Torres AM, Menz I, Alewood PF, Bansal P, LahnsteinJ, Gallagher...
- 12
- 616
- 0
Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt
... CATYTGYTCNACNGCCCAYTTLP7 AWAWALGWDDKLP8 GYHENALP9 WPLDYFLF2 GCCACACTTCTGTCAACATCC3RAC TTCTTCAAGGGCTGGCTCCCT3AP CTGATCTAGAGGTACCGGATCC5RACF ATCCTCACGAACAAGCAG5RACR GATCGCGATGCAGGCCTTFLF1 GGACGACTACAGCGTCTTCAGTAGAFLR1 ... et al. [29] using bovine serumalbumin fraction V as a standard protein.cDNA cloningConstruction of the cDNA library and cloning of cellulasecDNA was achieved as follows: Total RNA was extractedfrom ... itself.Keywords: cellulase; abalone; invertebrate; cDNA cloning;cellulase gene.Cellulase (endo-b-1,4-D-glucanase) is an enzyme whichhydrolyzes internal b-1,4-glycoside linkages of cellulosechains [1]....
- 8
- 511
- 0
Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt
... by a heptose and the 4¢-phosphate by a galacturonic acid, is biologically, i.e. agonistically as wellas antagonistically, completely inactive. The lack ofantagonistic activity may be explained ... in a sandwich-ELISA.Ninety-six-well plates (Greiner, Solingen, Germany) werecoated with a monoclonal antibody against TNF (clone6b from Intex, Germany). Cell culture supernatants and the standard ... signal in the NMR experiment. This is in complete accordance to ourdata indicating the existence of unilamellar vesicles as well as a nonlamellar cubic structure, as also the latter leads to anisotropic...
- 9
- 665
- 1
Báo cáo khoa học: Crystal structure and enzymatic properties of a bacterial family 19 chitinase reveal differences from plant enzymes pdf
... Acidicmammalian chitinase in asthmatic Th2 in ammation and IL-13 pathway activation. Science 304, 1678–1682.4 Kasprzewska A (200 3) Plant chitinases ) regulation and function. Cell Mol Biol Lett ... 180–190.47 DeLano WL (200 4) The Pymol Molecular GraphicSystem. San Carlos, CA.Supplementary materialThe following supplementary material is availableonline:Fig. S1. SDS ⁄ PAGE analysis of purified ... similar to those observed for other chitinases. Theenzyme was also capable of degrading a colored colloidal chitin substrate(carboxymethyl-chitin–remazol–brilliant violet) and a small, presumablyamorphous,...
- 12
- 399
- 0
Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx
... 6-sialylated oligosaccharides suchas 6¢-sialyl-lactose, sialyl-lactosamine or sialyl-lacto-N-neo-tetraose found in human milk [42,43], monosialylgan-glioside NeuAca2–6Galb1–4GlcNAcb1–3Galb1–4Glc-Cerimmunostained ... aorta,amygdala, occipital and parietal lobe and salivary gland.Almost no expression was observed in fetal lung and heart,uterus, bladder, kidney, duodenum, trachea, Burkitt’s lym-phoma, and ... 1.4NeuAca2-3Galb1-3[Neu5Aca2-6]GalNAca1-O-Ser/ThrcNeuAca2-6(3)Galb1-4GlcNAc-RcAsialofetuin Galb1-3GalNAca1-O-Ser/Thr 66 83Galb1-4GlcNAc-RArylglycosides Gala1-O-pNp 8 0.6GalNAca1-O-pNp 5.3 0.6GlcNAca1-O-pNp...
- 12
- 584
- 0
Báo cáo khoa học: Identification and functional characterization of a novel barnacle cement protein pptx
... (R.U .) Au:ASWAu:BufferHPA:ASWFig. 3. Typical SPR analyses on polycrystalline gold and alkylated gold. The arrows and thick arrows indicate the starts of sample loading(2 l M) and washing by ... Mountain View, CA, USA), and poly (A) +RNAwas isolated using Oligo(dT)-Latex Super (Takara ShuzoCo .). cDNA was prepared from mRNA with a Zap-cDNAsynthesis kit (Stratagene, La Jolla, CA, USA) according ... polycrystal-line gold and (B) alkylated gold in ASW.Fig. S3. Quantification of protein adsorption by aminoacid analysis and data fitting with the Langmuirmodel. Doc. S1. Search for homologous proteins.This...
- 11
- 488
- 0
Báo cáo khoa học: Ligand binding and antigenic properties of a human neonatal Fc receptor with mutation of two unpaired cysteine residues docx
... ectodomains (a1 , a2 and a3 ), a transmembrane part and a short intracellular signalingtail. Like MHC class I HC, the FcRn counterpart isnoncovalently associated with b2-microglobulin (b2m)[4,5]. ... heterogeneous ligand-binding model or the bivalentanalyte binding model supplemented with the BIAevalua-tion wizard.ELISA analyses of anti-FcRn reactivityWells of ELISA plates were coated with 100 lL ... the BIAevalutionWizard. The heterogeneous ligand-binding modelassumes that two parallel and independent interactions(KD1 and KD2 ) take place between the ligand and the receptor, and the...
- 14
- 533
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ