Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai Ken-ichi Suzuki, Takao Ojima and Kiyoyoshi Nishita Laboratory of Biochemistry and Biotechnology, Graduate School of Fisheries Sciences, Hokkaido University, Japan A cellulase [endo-b-1,4- D -glucanase (EC 3.2.1.4)] was iso- lated from the hepatopancreas of abalone Haliotis discus hannai by successive chromatographies on TOYOPEARL CM-650M, hydroxyapatite and Sephacryl S-200 HR. The molecular mass of the cellulase was estimated to be 66 000 Da by SDS/PAGE, thus the enzyme was named HdEG66. The hydrolytic activity of HdEG66 toward carb- oxymethylcellulose showed optimal temperature and pH at 38 °C and 6.3, respectively. cDNAs encoding HdEG66 were amplified by the polymerase chain reaction from an abalone hepatopancreas cDNA library with primers synthesized on the basis of partial amino-acid sequences of HdEG66. By overlapping the nucleotide sequences of the cDNAs, a sequence of 1898 bp in total was determined. The coding region of 1785 bp located at nucleotide position 56–1840 gave an amino-acid sequence of 594 residues including the initiation methionine. The N-terminal region of 14 residues in the deduced sequence was regarded as the signal peptide as it was absent in HdEG66 protein and showed high similarity to the consensus sequence for signal peptides of eukaryote secretory proteins. Thus, matured HdEG66 was thought to consist of 579 residues. The C-terminal region of 453 residues in HdEG66, i.e. approximately the C–terminal three quar- ters of the protein, showed 42–44% identity to the catalytic domains of glycoside hydrolase family 9 (GHF9)-cellulases from arthropods and Thermomonospora fusca. While the N-terminal first quarter of HdEG66 showed 27% identity to the carbohydrate-binding module (CBM) of a Cellulomonas fimi cellulase, CenA. Thus, the HdEG66 was regarded as the GHF9-cellulase possessing a family II CBM in the N-ter- minal region. By genomic PCR using specific primers to the 3¢-terminal coding sequences of HdEG66-cDNA, a DNA of 2186 bp including three introns was amplified. This strongly suggests that the origin of HdEG66 is not from symbiotic bacteria but abalone itself. Keywords: cellulase; abalone; invertebrate; cDNA cloning; cellulase gene. Cellulase (endo-b-1,4- D -glucanase) is an enzyme which hydrolyzes internal b-1,4-glycoside linkages of cellulose chains [1]. The cellulase has been shown to exist not only in plants [2], molds [3], fungi [1], bacteria [1] and protista [4], but also in herbivorous invertebrates, such as arthropods [5–7], nematodes [8] and mollusks [9–14]. Most cellulases from microorganisms are composed of a catalytic domain and ancillary domains such as CBMs and linkers, while the invertebrate cellulases except for two nematode enzymes have just a catalytic domain [1,8,14]. The origin of the invertebrate cellulases was initially explained as products of symbiotic microorganisms in the intestine or contamination by foods [15,16]. However, those cellulases have become considered to be the products of invertebrates themselves, as animals bred in the presence of antibiotic could produce cellulases [17] and cellulase genes were cloned from termite [18,19], crayfish [20], nematode [21], and mussel [22]. According to the criteria based on hydrophobic cluster analysis [23], termite and crayfish cellulases are classified into the GHF9 subfamily which includes the majority of cellulases from plants, bacteria, and a slime mold [24]. Nematode cellulases are classified into GHF5 which includes some bacterial and fungal cellulases [21]. On the other hand, a thermostable and low molecular mass ( 20- kDa) cellulase was recently isolated from blue mussel and the primary structure was determined [13,22]. Origin of the mussel cellulase was also investigated by genomic PCR similar to the case of arthropod cellulases. According to the primary structure analysis, the mussel cellulase is classified into the GHF45 subfamily 2, being distinct from the arthropod ones that are classified into GHF9. This leads us to consider that molluscan cellulases possess somewhat different properties and a different evolutionally origin from arthropod ones. However, at present there is little informa- tion about the biochemical properties and primary struc- tures of molluscan cellulases to assess the fundamental differences between molluscan and other invertebrate cellu- lases. Therefore, in the present study, we attempted to isolate a cellulase from abalone Haliotis discus hannai which is one of the most common and valuable herbivorous molluscs in Japan, and determine its primary structure. In addition, we investigated the existence of a cellulase gene in abalone chromosomal DNA by genomic PCR. Correspondence to T. Ojima, Laboratory of Biochemistry and Biotechnology, Graduate School of Fisheries Sciences, Hokkaido University, Hakodate, Hokkaido 041-8611, Japan. Fax: + 81 138 40 8800, Tel.: +81 138 40 8591, E-mail: ojima@fish.hokudai.ac.jp Abbreviations: CBM, carbohydrate-binding module; GHF, glycoside hydrolase family; CMC, carboxymethylcellulose. Enzymes: endo-b-1,4- D -glucanase (EC 3.2.1.4). (Received 9 October 2002, revised 3 December 2002, accepted 20 December 2002) Eur. J. Biochem. 270, 771–778 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03443.x Materials and methods Materials Living abalones were purchased from a local market in Hakodate, Hokkaido prefecture, Japan. CMC (medium viscosity) was purchased from ICN Bio medicals, Inc. (OH, USA), TOYOPEARL CM-650 M was fromToyo Soda Mfg, Co. (Tokyo, Japan), Sephacryl S-200 HR was from Amer- sham Pharmacia Biotech AAB (NJ, USA), and Hydroxy- apatite (Fast Flow Type) was from Wako pure chemical industries Ltd. (Osaka, Japan). Lysylendopeptidase, Oligo- tex-dT (30), TaKaRa Taq DNA polymerase, 5¢-Full RACE and 3¢-Full RACE kits, and restriction endonucleases were purchased from TaKaRa (Tokyo, Japan). pCR-TOPO 2.1 TA cloning kit was purchased from Invitrogen (CA, USA). The other chemicals used were reagent grade from Wako Pure Chemical industries Ltd. (Osaka, Japan). Determination of enzymatic activity Cellulase activity was assayed in a 1-mL of reaction mixture containing 0.5% CMC, 10 m M sodium phosphate (pH 7.0), and an appropriate amount of enzyme at 30 °C. The reducing sugar liberated by hydrolysis of CMC was determined by the method of Nelson and Somogyi [25]. One unit of cellulase was defined as the amount of enzyme that liberates reducing sugars equivalent to 1.0 lmol of glucose per min under the conditions described above. Temperature dependence of cellulase activity was assayed at 4–80 °C and pH 7.0. Thermal stability of cellulase was assayed by measuring remaining activity of the enzyme that had been incubated at 4–70 °C for 30 min. pH dependence of cellulase activity was assayed at 30 °C in reaction mixtures adjusted at pH 3.0–9.0 with 10 m M sodium phosphate. Amino-acid sequencing The N-terminal amino-acid sequence of intact enzyme was determined with the sample electrically transferred to a poly(vinylidene difluoride) membrane after SDS/PAGE using an ABI 473 A protein sequencer (Applied Biosystems, CA, USA). For the analysis of internal amino-acid sequences, the enzyme was digested with 1/100 (w/w) of lysylendopeptidase at 37 °C for 2 h. The fragments were separated by HPLC (LP-1000, EYLA, Tokyo, Japan) equipped with Mightysil RP-18 GP column (150 · 4.6 mm) (KANTO CHEMICAL CO., INC, Tokyo, Japan) and subjected to the protein sequencer. SDS/PAGE SDS/PAGE was performed with 10% polyacrylamide gel according to the method of Porzio and Pearson [26]. After the electrophoresis, the gel was stained with 0.1% Coomas- sie Brilliant Blue R-250 in 50% methanol-10% acetic acid, and destained with 5% methanol-7% acetic acid. Zymography Zymography for cellulase was carried out by the method of Be ´ guin [27] with slight modifications as follows: The enzyme was run on SDS/PAGE at 4 °C and the gel was washed with 100 mL of 10 m M sodium phosphate (pH 7.0))25% 2-propanol by gently shaking at 4 °Cfor30mintoremove SDS. This washing was repeated once more and the gel was equilibrated with 10 m M sodium phosphate (pH 7.0) at 4 °C for 30 min to accomplish renaturation of the enzyme. Then, the gel was laid on 2% agar gel (5 mm thick) containing 0.1% CMC and 10 m M Tris/HCl (pH 7.5) which was solidified in Petri dish (/ 20 cm). After the incubation at 37 °C for 3 h, the overlaid gel was removed and the agar replica gel was stained with 0.1% Congo Red aqueous solution. Location of the enzyme was detected as unstained bands. Determination of protein concentration Protein concentration was determined by the biuret method [28] or the method of Lowry et al. [29] using bovine serum albumin fraction V as a standard protein. cDNA cloning Construction of the cDNA library and cloning of cellulase cDNA was achieved as follows: Total RNA was extracted from 1 g of abalone hepatopancreas by the ganidinium thiocyanate-phenol method [30] and mRNA was selected with Oligotex-dT (30) from the total RNA according to the manufacturer’s protocol. Double-stranded cDNA was syn- thesized from the mRNA with a cDNA synthesis kit (TaKaRa, Tokyo, Japan) and used as an abalone cDNA library. cDNAs encoding abalone cellulase were amplified by PCR from the cDNA library with degenerated primers synthesized on the basis of partial amino-acid sequences of the cellulase. PCR was carried out in a 50-lL of reaction mixture containing 50 m M KCl, 10 m M Tris/HCl (pH 8.3), 2m M each of dATP, dTTP, dGTP and dCTP, 1.2 m M MgCl 2 ,2pmolÆmL )1 primers, 1 ngÆmL )1 template DNA, and 0.05 unitsÆmL )1 TaKaRa Taq DNA polymerase. A successive reaction at 95 °C for 30 s, 45 °Cfor60sand 72 °C for 90 s was repeated for 30 cycles with a PC 700 Program Incubator (ASTEC, Fukuoka, Japan). cDNAs for 5¢-and 3¢-terminal regions of mRNA were amplified with a 5¢-Full RACE kit and a 3¢-Full RACE kit (TaKaRa, Tokyo, Japan), respectively. Genomic PCR was performed with DNA primers specific to 3¢-terminal regions of the cellulase cDNA and abalone chromosomal DNA prepared from the adductor muscle by the conventional method [31]. The PCR products were cloned with a pCR-TOPO 2.1 TA cloning kit (Invitrogen, CA, USA) and sequenced using a BigDye-terminator Cycle sequencing kit (Applied Biosys- tems, CA, USA) and an ABI 310 DNA sequencer (Applied Biosystems, CA, USA). Results Purification of cellulase from abalone hepatopancreas Hepatopancreas (125 g) dissected from 10 abalones (aver- age shell size: 8 · 6 cm) were cut into small pieces with scissors and suspended in 250 mL of 10 m M sodium phosphate (pH 7.0) containing 0.2% sodium azide, 1 m M phenylmethanesulfonyl fluoride and 1 m M EDTA. After 772 K i. Suzuki et al.(Eur. J. Biochem. 270) Ó FEBS 2003 the extraction at 4 °C for 30 min, the extract was centri- fuged at 10 000 g for 15 min. The supernatant was applied to a TOYOPEARL CM-650M column (2.0 · 15 cm) pre- equilibrated with 10 m M sodium phosphate (pH 7.0), and proteins adsorbed were eluted with a linear gradient of 0–200 m M NaCl in 10 m M sodium phosphate (pH 7.0). As shown in Fig. 1, three fractions showing hydrolytic activity toward CMC, namely CM-I–III fractions, were eluted. According to SDS/PAGE followed by zymography, the CM-I and -II were found to contain 66 000, 75 000, and 100 000 Da proteins with cellulase activity in substantial amounts. However, the CM-III fraction contained only the 66 000 Da protein in fairly high purity. Therefore, in the present study, we focused on the 66 000-Da cellulase (named HdEG66) in the CM-III fraction and attempted to isolate it. The CM-III fraction, i.e. fractions 19–24, was applied to a hydroxyapatite column (1.5 · 20 cm) pre-equilibrated with 10 m M potassium phosphate (pH 7.0), and adsorbed pro- teins were eluted with a linear gradient of 10–300 m M potassium phosphate (pH 7.0). As shown in Fig. 2, the HdEG66 was eluted as a major peak at around 0.18 M potassium phosphate, i.e. fractions 25–29. As these fractions were still contaminated by the small amount of 25 000 Da protein, they were lyophilized and subjected to gel-filtration through Sephacryl S-200 HR. Consequently, the HdEG66 was eluted in a single major peak and showed a single band of 66 000 Da in both the SDS/PAGE and zymogram (Fig. 3). According to the eluting position in the gel- filtration, molecular mass of the HdEG66 was estimated to be 66 000 Da which was fairly consistent with that estima- ted by SDS/PAGE. This indicates that HdEG66 is a monomeric enzyme. The yield and purity of the HdEG66 in respective purification steps are summarized in Table 1. The purified HdEG66 showed a specific activity of 13.9 UÆmg )1 , which is approximately 95-fold higher than that of crude extract. The optimal temperature and pH of the HdEG66 were at 38 °C and pH 6.3, respectively, and the enzyme was stable to heating at 30 °C for 30 min (data not shown). Partial amino-acid sequence of HdEG66 Partial amino-acid sequences of the HdEG66 were analyzed in order to design PCR primers for the amplification of HdEG66-cDNA. To analyze the N-terminal sequence, the HdEG66 was blotted onto a poly(vinylidene difluoride) membrane and subjected to the protein sequencer. Conse- quently, an amino-acid sequence of 14 residues was identified as VDVTISNHWDGGFQ (Table 2). Then, in order to analyze the internal amino-acid sequences, the HdEG66 was digested with lysylendopeptidase and the Fig. 1. TOYOPEARL CM-650M column chromatography of abalone crude extract. Crude extract from abalone hepatopancreas was applied to a TOYOPEARL CM-650M column (2.0 · 15 cm) and eluted with a 0–0.2 M NaCl linear gradient in 10 m M sodium phosphate (pH 7.0) at a flow rate of 30 mLÆh )1 . Each fraction contains 5.0 mL. The SDS gel electrophoretic patterns of the sample before chromatography (Cr) and fractions indicated by the arrows a–j are shown in the inset. M, molecular mass markers; 15 K ¼ 15 000 Da etc. Fig. 2. Purification of abalone cellulase by hydroxyapatite column chromatography. The CM-III fraction in TOYOPEARL CM-650M chromatography was applied to a hydroxyapatite column (1.5 · 20 cm) and eluted with a 0.01–0.3 M potassium phosphate (pH7.0)ataflowrateof30mLÆh )1 . Each fraction contains 5.0 mL. The SDS gel electrophoretic patterns of fractions indicated by the arrowsa–iareshownintheinset.Thefractionsc–ewerepooled. Fig. 3. Purification of abalone cellulase by Sephacryl S-200 HR gel filtration. The cellulase fraction obtained in the hydroxyapatite column chromatography was concentrated by lyophilization and then applied to a Sephacryl S-200 HR column (2.0 · 140 cm). Each fraction con- tains 5.0 mL. V 0 is the void volume of the column. The SDS gel electrophoretic and zymographic patterns of fractions indicated by the arrows a–c are shown in the inset. The fractions a–c were pooled as the purified HdEG66. Ó FEBS 2003 cDNA cloning of abalone cellulase (Eur. J. Biochem. 270) 773 fragments were isolated by HPLC. Among the fragments, LP1-LP9 fractions were subjected to sequencing (Table 2). According to database searches on DDBJ, GenBank and EMBL, these sequences were found to show 42–80% identity to the amino-acid sequences of termite and cockroach cellulases. Among the fragments, LP5 and LP6 were considered to be derived from middle and C-terminal region of the HdEG66, respectively, from the sequence similarity to the termite cellulase. Then, a forward primer F1 was synthesized on the basis of the N-terminal sequence of the HdEG66, while reverse primers R1 and R2 were synthesized on the basis of sequences of LP5 and LP6, respectively (Table 2). PCR amplification of HdEG66-cDNA cDNAs encoding the N-terminal region of the HdEG66 were amplified by PCR using the F1–R1 primer pair. This PCR gave a cDNA with approximately 1000 bp named Hd1-DNA. The Hd1-DNA was cloned with a TOPO cloning kit and sequenced (Fig. 4A). The amino-acid sequence deduced from the Hd1-DNA corresponded to the N-terminal 335 amino-acid sequence of the HdEG66. Next, in order to obtain cDNAs encoding C-terminal region of the HdEG66, a forward specific primer F2 was newly synthesized and PCR was performed using the F2-R2 primer pair. Thus, Hd2-DNA of 477 bp encoding the C-terminal 159 amino acids of the HdEG66 was amplified. Finally, 5¢-and3¢-RACE PCRs were performed using primers shown in Table 2, and Hd5RACE-DNA and Hd3RACE-DNA for 5¢-and3¢-terminal regions were amplified, respectively. By combining the nucleotide sequences of the Hd5RACE-DNA, Hd1-DNA, Hd2- DNA and the Hd3RACE-DNA in this order, the nucleo- tide sequence of total 1898 bp was determined (Fig. 5). The reliability of the nucleotide sequence was confirmed with HdFull-DNA which was amplified with the specific primer pair, FLF1–FLR1 (Table 2 and Figs 4 and 5). The translational initiation codon ATG was found in nucleotide positions from 56 to 58 and termination codon TAA from 1838 to 1840 (Fig. 5). In the 3¢-terminal region, a putative polyadenylation signal sequence AATAAA and a poly(A+) tail were found. These structural characteristics indicate that the HdEG66 cDNA is not derived from prokaryote like intestinal bacteria. The translational region of 1785 bp gave an amino-acid sequence of 594 residues. All the amino-acid sequences determined with lysylendopepti- dase fragments, LP1–LP9, are found in the deduced sequence, indicating that the thus cloned cDNAs are of the HdEG66 protein. It is noteworthy that the N-terminal 15 residues in the deduced sequence are absent in the HdEG66 protein. According to the sequence comparison with the consensus sequence for signal peptides of eukaryote secretory proteins [32], the N-terminal region of 14 residues except for the initiation methionine is regarded as the signal peptide of the HdEG66. Further, the inconsistent residue Table 2. Partial amino acid sequences of HdEG66 and nucleotide sequences of primers. W ¼ A/T, Y ¼ C/T, H ¼ A/C/T, H ¼ A/C/T, R ¼ A/G, S ¼ C/G and N ¼ A/G/C/T. Peptides Sequences Primer names DNA sequences Intact VDVTISNHWDGGFQ F1 ACNATHWSNAAYCAYTGGGA LP1 DAYATTK LP2 WRGDSALGDK LP3 GDNGEDLTGGWY LP4 TEVEGFFK LP5 YPGIYSSSIQDAGQFYSSSGYK R1 RTARAAYTGNCCNGCRTCYTG LP6 WAVEQMNYILGDNK R2 CATYTGYTCNACNGCCCAYTT LP7 AWAWALGWDDK LP8 GYHENA LP9 WPLDYFL F2 GCCACACTTCTGTCAACATCC 3RAC TTCTTCAAGGGCTGGCTCCCT 3AP CTGATCTAGAGGTACCGGATCC 5RACF ATCCTCACGAACAAGCAG 5RACR GATCGCGATGCAGGCCTT FLF1 GGACGACTACAGCGTCTTCAGTAGA FLR1 TCCAAACAGTCAGTTTCTTAACCGT Table 1. Purification of cellulase from abalone Haliotis discus hannai. Oneunitofcellulasewasdefinedastheamountofenzymethatliberates reducing sugars equivalent to 1.0 lmol of glucose per min. Purification step Total protein (mg) Specific activity (unitsÆmg )1 ) Total activity (units) Purification (fold) Yield (%) Crude extract 1470 0.15 220 1 100 CM-III fraction 13.4 2.95 40 20 18 Hydroxyapatite 4.14 4.00 16 27 7 Sephacryl S-200 1.06 13.9 15 93 7 774 K i. Suzuki et al.(Eur. J. Biochem. 270) Ó FEBS 2003 between the deduced sequence and the sequence of LP7 peptide was found at the amino-acid position 388. Namely, the neighboring residue of LP7 toward the N-terminus should be lysine because LP7 is a fragment produced by lysylendopeptidase digestion. However, the corresponding residue is not lysine but asparagine in both the deduced sequence and the amino-acid sequence of LP8. We now consider that this inconsistency has arisen from hetero- geneity of the HdEG66, e.g. coexistence of proteins with lysine and asparagine at the position 338 in the HdEG66 preparation. Amplification of HdEG66 gene from abalone chromosomal DNA The existence of HdEG66 gene in the abalone chromosomal DNA was examined by genomic PCR using primers, 3RAC and FLR1, which are specific to the 3¢-terminal region of the HdEG66-cDNA (Table 2). By PCR, a DNA of 2186 bp named Hdcel-1 DNA was amplified from the abalone chromosomal DNA that was prepared from the adductor muscle. By comparison with the sequence of HdEG66- cDNA, the Hdcel-1 DNA was revealed to consist of three introns (each 664 bp, 757 bp, and 229 bp) and 4 exons (each 91 bp, 172 bp, 191 bp, and 82 bp) (Fig. 4B). The positions of introns in the cDNA sequence are also shown in Fig. 5. The GU-AG rule in eukaryotic genes is applicable to these intron-exon junctions. These results indicate that the Hdcel-1 DNA is part of a structural gene for HdEG66 and that HdEG66 is the product of abalone itself, and is not derived from symbiotic microorganisms, e.g. intestinal bacteria. Discussion In the present study, we have successfully isolated a cellulase HdEG66 from abalone hepatopancreas. The molecular mass of HdEG66 was estimated to be 66 000 Da by both SDS/PAGE and gel-filtration through Sephacryl S-200 HR, and the optimal temperature and pH were shown to be 38 °C and pH 6.3, respectively. In addition, the HdEG66 showed weak hydrolytic activity toward crystalline cellulose like termite cellulases (data not shown). The HdEG66 showed somewhat larger molecular size compared to the other invertebrate cellulases, however, the basic properties of the HdEG66 were fairly similar to those of other invertebrate cellulases [6,11,12,33]. With cDNAs amplified by PCR, an amino-acid sequence of 594 residues for the HdEG66 was determined. The N-terminal region of 15 residues including initiation methi- onine was absent in the purified HdEG66 protein and showed the characteristic feature for signal peptides of eukaryotic secretory proteins [32]. Therefore, this region was regarded as the signal peptide that was cut away upon secretion of the HdEG66. Accordingly, the matured HdEG66 was considered to consist of 579 residues with the calculated molecular mass of 63 196.88 Da. By sequence comparison with other invertebrate and bacterial cellulases, the C-terminal region of 453 residues in the HdEG66 was regarded as the GHF9-type catalytic domain i.e. it showed 44, 43, and 42% identity with the corresponding regions of termite [18], crayfish [20], and Thermomonospora fusca [34] cellulases, respectively (Fig. 6). Further, the catalytically important residues in GHF9 cellulases [35–38], i.e. His506, Asp200, Asp203, Asp550 and Glu559 in the HdEG66 sequence were all conserved (Fig. 6). Based on these results, we conclude that the HdEG66 is classified into GHF9. On the other hand, HdEG66 was found to possess an extended N-terminal region of 126 residues which is deficient in other invertebrate cellulases (Fig. 6). This extended region showed sequence identity of 27% with the CBM attached by a linker in Cellulomonas fimi CenA [39]. The CBM of CenA belongs to CBM family II, which is currently the largest among five principal families, i.e. families I–IV and VI [1]. The family II CBMs possess strictly conserved four tryptophans and highly conserved two cysteines that form a disulfide bridge. In case of N-terminal extended region of the HdEG66, three out of the four tryptophans are conserved at residues 24, 43, and 79, although the remaining one is substituted by aspartic acid at residue 57. While the two cycteines are not conserved in HdEG66, three cysteines are however present at residues 33, 58, and 90. In addition, a putative linker region rich in threonine and glycine residues locates in the position connecting the N-terminal extended region and the catalytic domain (Fig. 6). These sequence charac- teristics strongly suggest that the N-terminal extended region of the HdEG66 corresponds to a family II CBM followed by a linker. Accordingly, HdEG66 is considered to be the first animal cellulase possessing the family II CBM in the N-terminus of the GHF9-type catalytic domain. Cellulose-binding ability and other biochemical functions Fig. 4. Structures of cDNA and genomic fragment for HdEG66. (A) structure of HdEG66 cDNA. Open and closed boxes indicate trans- lational and untranslational regions, respectively. Relative positions of Hd1-DNA, Hd2-DNA, Hd5RACE-DNA, Hd3RACE-DNA, and HdFull-DNA are indicated as solid lines. Bold lines in both sides of the cDNAsindicateprimersusedforthePCR.LengthsofthecDNAsare shown in the parentheses. (B) Structure of the genomic fragment, Hdcel-1 DNA. Open and closed boxes represent exons and introns, respectively. The sequence data for HdEG66 cDNA and Hdcel-1 DNA are available from DNA Data Bank of Japan with accession numbers, AB092978 and AB092979, respectively. Ó FEBS 2003 cDNA cloning of abalone cellulase (Eur. J. Biochem. 270) 775 for the putative CBM of HdEG66 are now under investi- gation. By PCR with chromosomal DNA prepared from abalone adductor muscle and specific primers to the 3¢-region of HdEG66-cDNA, a genomic fragment Hdcel-1 DNA enco- ding for C-terminal region of the HdEG66 was amplified. The Hdcel-1 DNA consisted of four exons and three introns (Fig. 4B) and the coding sequence of the exons was consistent with that of cDNA. This strongly suggests that the Hdcel-1 DNA is a genomic fragment derived from Fig. 5. The nucleotide and deduced amino-acid sequences of the HdEG66. Residue numbers for both nucleotide and amino acid are indicated in the right of each row. The translational start codon ATG, termination codon TAA, and a putative polyadenylation signal AATAAA are boxed. A putative signal peptide is indicated by a dotted underline. The amino-acid sequences determined with intact HdEG66 (N-terminus) and peptides LP1–LP9 are indicated by lines under the amino-acid sequence. The positions of primers for PCR are indicated by lines above the nucleotide sequence. The Asp338 that was suggested to be lysine from the LP7 sequence was double-boxed. Introns 1–3 indicates the positions of introns revealed by the analysis of a genomic fragment Hdcel-1 DNA (see Fig. 4B). 776 K i. Suzuki et al.(Eur. J. Biochem. 270) Ó FEBS 2003 abalone chromosome not from intestinal symbiotes and that the HdEG66 is an enzyme secreted by abalone itself. Further, the position of intron-2 in the Hdcel-1 DNA was found to coincide to the position of corresponding intron in termite cellulase gene [19]. These results strongly suggest that the HdEG66 and termite cellulase genes derive from a common ancestral gene although the termite cellulase lacks CBM. In the present study, we found the presence of cellulases of approx. 75 000 and 100 000 Da as well as HdEG66 (see Fig. 1). We are now attempting to purify these isoforms and determine their primary structures in order to reveal the structural characteristics of abalone cellulases and their evolutionary relationships to other invertebrate and bacter- ial cellulases. References 1. Tomme, P., Warren, R.A.J. & Gilkes, N.R. (1995) Cellulose hydrolysis by bacteria and fungi. Adv. Microbiol. Physiol. 37, 1–81. 2. Brummell, D.A., Lashbrook, C.C. & Bennett, A.B. (1994) Plant endo-1,4-b- D -glucanases. ACS Symp. Series 566, 100–129. 3. Blume, J.E. & Ennis, H.L. (1991) A Dictyostelium discoideum cellulase is a member of a spore germination-specific gene family. J. Biol. Chem. 266, 15432–15437. 4. Moriya, S., Ohkuma, M. & Kudo, T. (1998) Phylogenetic position of symbiotic protist Dinemympha exilis in the hindgut of the termite Reticulitermes speratus inferred from the protein phylogeny of elongation factor 1a. Gene 210, 221–227. 5. Watanabe,H.,Nakamura,M.,Tokuda,G.,Yamaoka,I.,Scriv- ener,A.M.&Noda,H.(1997)Siteofsecretionand properties of endogenous endo-b-1,4-glucanase components from Reticulitermes speratus (Kolbe), a Japanese subterranean termite. Insect Biochem. Mol. Biol. 27, 305–313. 6. Tokuda, G., Watanabe, H., Matsumoto, T. & Noda, H. (1997) Cellulose digestion in the wood-eating higher termite, Nasutitermes takasagoensis (Shiraki): distribution of cellulases and properties of endo-b-1,4-glucanase. Zool. Sci. 14, 83–93. 7. Xue, X.M., Anderson, A.J., Richardson, N.A., Anderson, A.J., Xue, G.P. & Mather, P.B. (1999) Characterisation of cellulase Fig. 6. Comparison of amino-acid sequences for the HdEG66 and other cellulases. The sequence of C-terminal 453 residues for the HdEG66 was aligned with the sequences for catalytic domains of RsEG (Reticulitermes speratus [18]), CqEG (Cherax quadricarinatus [20]), and E4-68 (Thermomonospora fusca [37]). Residue numbers of RsEG, CqEG, and E4-68 are of the precursor enzymes. Catalyti- cally important residues in GHF9 are boxed. Identical residues among the sequences are indicated by asterisks. While the sequence of N-terminal 126 residues except for the puta- tive signal peptide region was aligned with the CBM attached by a linker of Cellulomonas fimi CenA [39]. Locations of four tryptophans strictly conserved in family II CBMs [1] are indicated by reverse triangles. Ó FEBS 2003 cDNA cloning of abalone cellulase (Eur. J. Biochem. 270) 777 activity in the digestive system of the redclaw crayfish (Cherax quadricarinatus). Aquaculture 180, 373–386. 8. Smant, G., Stokkermans, J.P.W.G., Yan, Y., De Boer, J.M., Baum, T.J., Wang, X., Hussey, R.S., Gommers, F.J., Henrissat, B., Davis, E.L., Helder, J., Schots, A. & Bakker, J. (1998) Endogenous cellulases in animals: isolation of b-1,4- endoglucanase genes from two species of plant-parasitic cyst nematodes. Proc.NatlAcad.Sci.USA95, 4906–4911. 9. Yokoe, Y. & Yasumasu, I. (1964) The distribution of cellulase in invertebrates. Comp. Biochem. Physiol. 13, 323–338. 10. Marshall, J.J. (1973) Purification of a b-1,4-glucan hydrolase (cellulase) from the snail, Helix pomatia. Comp. Biochem. Physiol. 44B, 981–988. 11. Marshall, J.J. & Grand, R.J.A. (1976) Characterization of a b-1,4- glucan hydrolase from the snail, Helix pomatia. Comp. Biochem. Physiol. 53B, 231–237. 12. Anzai, H., Nisizawa, K. & Matsuda, K. (1984) Purification and characterization of a cellulase from Dolabella auricularia. J. Biochem. 96, 1381–1390. 13.Xu,B.,Hellman,U.,Ersson,B.&Janson,J C.(2000) Purification, characterization and amino-acid sequence analysis of a thermostable, low molecular mass endo-b-1,4-glucanase from blue mussel, Mytilus edulis. Eur. J. Biochem. 267, 4970–4977. 14. Watanabe, H. & Tokuda, G. (2001) Animal cellulases. Cell. Mol. Life Sci. 58, 1167–1178. 15. Cleveland, L.R. (1924) The physiological and symbiotic relationships between the intestinal protozoa of termites and their host, with special reference to Reticulitermes flavipes Kollar. Biol. Bull. Mar. Biol. Lab. 46, 117–227. 16. Martin, M.M. & Martin, J.S. (1978) Cellulose digestion in the midgut of the fungus-growing termite Macrotermes natalensis: the role of acquired digestive enzymes. Science 199, 1453–1455. 17.O’Brien,G.W.,Veivers,P.C.,McEwen,S.E.,Slaytor,M.& O’Brien, R.W. (1979) The origin and distribution of cellulase in the termites, Nasutitermes exitiosus and Coptotermes lacteus. Insect Biochem. 9, 619–625. 18. Watanabe, H., Noda, H., Tokuda, G. & Lo, N. (1998) A cellulase gene of termite origin. Nature 394, 330–331. 19. Tokuda, G., Lo, N., Watanabe, H., Slaytor, M., Matsumoto, T. & Noda, H. (1999) Metazoan cellulase genes from termites: intron/ exon structures and sites of expression. Biochim. Biophys. Acta 1447, 146–159. 20. Byrne,K.A.,Lehnert,S.A.,Johnson,S.E.&Moore,S.S.(1999) Isolation of a cDNA encoding a putative cellulase in the red claw crayfish Cherax quadricarinatus. Gene 239, 317–324. 21. Yan, Y., Smant, G., Stokkermans, J., Qin, L., Helder, J., Baum, T., Shots, A. & Davis, E. (1998) Genomic organization of four b-1,4-endoglucanase genes in plant-parasitic cyst nematodes and its evolutionary implications. Gene 220, 61–70. 22. Xu, B., Janson, J C. & Sellos, D. (2001) Cloning and sequencing of a molluscan endo-b-1,4-glucanase gene from the blue mussel, Mytilus edulis. Eur. J. Biochem. 268, 3718–3727. 23. Lemesle-Varloot, L., Henrissat, B., Gaboriaud, C., Bissery, V., Morgat, A. & Mornon, J.P. (1990) Hydrophobic cluster analysis: procedures to derive structural and functional information from 2-D-representation of protein sequences. Biochimie 72, 554–574. 24. Henrissat, B. & Davies, G. (1997) Structural and sequence-based classification of glycoside hydrolases. Curr. Opin. Struct. Biol. 7, 637–644. 25. Nelson, N. (1944) A photometric adaptation of the Somogyi method for the determination of glucose. J. Biol. Chem. 153, 375–380. 26. Porzio, M.A. & Pearson, A.M. (1977) Improved resolution of myofibrillar proteins with sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Biochim. Biophys. Acta 490, 27–34. 27. Be ´ guin, P. (1983) Detection of cellulase activity in polyacrylamide gels using Congo red-stained agar replicas. Anal. Biochem. 131, 333–336. 28. Gornall, A.G., Bardawill, C.J. & David, M.M. (1949) Determination of serum proteins by means of the biuret reaction. J. Biol. Chem. 177, 751–766. 29. Lowry, O.H., Rosebrough, N.J., Farr, A.L. & Randall, R.J. (1951) Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193, 265–275. 30. Chomczynski, P. & Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. 31.Sambrook,J.,Fritsch,E.F.&Maniatis,T.(1989)Molecular Cloning: a Laboratory Mannual, 2nd edn. Cold Spring. Harbor Laboratory Press, Cold Spring Harbor, New York, USA. 32. von Heijne, G. (1986) A new method for predicting signal sequence cleavage sites. Nucleic Acids Res. 14, 4683–4690. 33. Chun, C.Z., Hur, S.B. & Kim, Y.T. (1997) Purification and characterization of an endoglucanase from the marine rotifer, Brachionus plicatilis. Biochem. Mol. Biol. Int. 43, 241–249. 34. Jung, E.D., Lao, G., Irwin, D., Barr, B.K., Benjamin, A. & Wilson, D.B. (1993) DNA sequences and expression in Streptomyces lividans of an exoglucanase gene and an endoglucanase gene from Thermomonospora fusca. Appl. Environ. Microbiol. 59, 3032–3043. 35. Tomme, P., Chauvaux, S., Be ´ guin, P., Millet, J., Aubert, J P. & Claeyssens, M. (1991) Identification of a histidyl residue in the active center of endoglucanase D from Clostridium thermocellum. J. Biol. Chem. 266, 10313–10318. 36. Tomme, P., van Beeumen, J. & Claeyssens, M. (1992) Modification of catalytically important carboxy residues in endoglucanase D from Clostridium thermocellum. Biochem. J. 285, 319–324. 37. Sakon, J., Irwin, D., Wilson, D.B. & Karplus, P.A. (1997) Structure and mechanism of endo/exocellulase E4 from Thermomonospora fusca. Nat. Struct. Biol. 4, 810–818. 38. Khademi, S., Guarino, L.A., Watanabe, H., Tokuda, G. & Meyer, E.F. (2002) Structure of an endoglucanase from termite, Nasutitermes takasagoensis. Acta Crystallogr. D58, 653–659. 39. Wong, W.K.R., Gerhard, B., Guo, Z.M., Kilburn, D.G., Warren, A.J. & Miller, R.C. Jr (1986) Characterization and structure of an endoglucanase gene cenA of Cellulomonas fimi. Gene 44, 315–324. 778 K i. Suzuki et al.(Eur. J. Biochem. 270) Ó FEBS 2003 . ATCCTCACGAACAAGCAG 5RACR GATCGCGATGCAGGCCTT FLF1 GGACGACTACAGCGTCTTCAGTAGA FLR1 TCCAAACAGTCAGTTTCTTAACCGT Table 1. Purification of cellulase from abalone Haliotis. Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai Ken-ichi Suzuki, Takao Ojima and Kiyoyoshi Nishita Laboratory of Biochemistry