Báo cáo khoa học: Identiﬁcation of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf

... FEBS Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles Asaka Yamane1,*, Mina Fukui1,*, Yoshiaki Sugimura1, Miho Itoh1, ... T, Fleckman P,Dale BA & Maki M (20 03) Analysis of epidermal-type transglutaminase (transglutaminase 3) in human stratified epithelia and cultured keratinocytesusing monoclonal antibodies. ... 38 9,150–156. 33 Hitomi K, Kitamura M, Alea MP, Ceylan I, Thomas V& El Alaoui S (2009) A specific colorimetric assay for measuring of transglutaminase 1 and Factor XIII activi-ties. Anal Biochem 39 4,...

Tài liệu Báo cáo khoa học: Identiﬁcation of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... methyltransferase 1 and 3 towardthe Ewing sarcoma protein and a peptide. Proteins 61,164–175.48 Raman B, Guarnaccia C, Nadassy K, Zakhariev S,Pintar A, Zanuttin F, Frigyes D, Acatrinei C, Vindigni A, ... oncogene contains an N-terminal transcrip-tion activation domain and a C-terminal RNA-binding domain. Althoughthe EWS activation domain is a potent transactivation domain that isrequired for the ... EMSA was performedwith RGG3 (lanes 2 and 4) and 32 P-labeled Htelo (lanes 1 and 2) orrHtelo (lanes 3 and 4). (B) EMSA was performed with RGG3 (lanes2 and 4) and 32 P-labeled rHtelo (lanes 1 and...

Tài liệu Báo cáo khoa học: Identiﬁcation of two late acyltransferase genes responsible for lipid A biosynthesis in Moraxella catarrhalis doc

... Synthesis and characteriza-tion of lipooligosaccharide-based conjugates as vaccinecandidates for Moraxella (Branhamella) catarrhalis.Infect Immun 66, 1891–1897.51 Caroff M, Tacken A & Szabo ... TGA TGA TGG CAA CTC (atr antisense) This studyasd1 AAG CCG ATG ACA CCA ATT (asd sense) This studyasd2 GCA GGT TCA TAG TGC ATG (asd antisense) This studyKan RP GGT GCG ACA ATC TAT CGA (kanamycin ... staining analysis with revert-ant O35ElpxX or O35ElpxL showed that an LOS bandmigrated in a manner identical to that of the parentalLOS. The LOS band of revertant O35ElpxX alsoshowed a change...

Tài liệu Báo cáo khoa học: Identiﬁcation, sequencing, and localization of a new carbonic anhydrase transcript from the hydrothermal vent tubeworm Riftia pachyptila docx

... 706–7 23 RpCAbrR3 GTT ACT TCC GCA GCT AGG 466–4 83 Probe ampliﬁcation for FISHRpCAbrF TAC AAG GAT GCC ATT AGC 6 13 630 RpCAbrR1 CGT AGC AGT ATC AGC AGT 822– 839 RpCAtrFprobe TAC AAA GAT CCA ATC CAG ... 710–728RpCAtrRq a TCA CAA ATG TCC AGT GCC AGT T 757–778Full-length sequencing of RpCAbrRpCAbrF TAC AAG GAT GCC ATT AGC 6 13 630 RpCAbrR1 CGT AGC AGT ATC AGC AGT 822– 839 RpCAbrR2 AGA GCA GCA GAC CTT ACG ... and F. scutaria larvae sequences have a H64 also shared by A. gambiae, A. aegypti, T. gigas,D. melanogaster-2 and D. melanogaster -3 sequences(data not shown). By contrast, R. pachyptila aminoacid...

Tài liệu Báo cáo khoa học: Identiﬁcation of a novel matrix protein contained in a protein aggregate associated with collagen in ﬁsh otoliths pdf

... to have a molecular mass of 64 kDa, and to containtwo tandem repeats and a Glu-rich region. The structure of the protein and that of its DNA are similar to those of starmaker, a protein involved in ... 5A) .Although the same band was obtained after digestionFig. 3. 45Ca overlay analysis of fusions of GST and recombinantOMM-64 variants (rOMM-64-I-V and -C), containing differentdomains of ... hyaluronidase SD (25 munits, Y) and endo -a- N-acethylagalactosaminidase (70 munits, E). The HMWaggregate was digested only by heparitinase II (arrowhead), and a 64 kDa protein band appeared instead...

Báo cáo khoa học: Identiﬁcation of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

... ACAGCAAAAAGGAGGCCAAA 138 BMP2 CGGAAACGCCTTAAGTCCAG GCCACAATCCAGTCATTCCA 83 MT 2A AATAAGCTTCCGACTCTAGCCGC GATAAGCTTGTGGAAGTCGCGT 259CD 237 904 AGCTGGTGCAGGAGGAAGTA TCTCACTGGCCCTAAACTGG 92AL707095 CCGAGAACCGAACTTACCAA ... 92AL707095 CCGAGAACCGAACTTACCAA CTGATAGGGGTTGGGTGATG 128AK095 731 AGGAAGCACCCAGCAATACCA GCATTTCCATTTCCCTAAGCAC 109DKK1 CACCTTGGATGGGTATTCCA CAACACAATCCTGAGGCACA 114BC 037 851 CACAGCTCCCATTCATTCCA TCCCTTTGCCTCCTGTTGTT ... (5¢-to3¢)Size(bp)MDR1 GAAGAAGGGCCAGACGC CTCCTGGGACACGATGC 178MRP1 CCTTCGCTGAGTTCCTGC CTGCGGTGCTGTTGTGG 246BCRP ACATCAGCGGATACTACAGAG CACCATCATAAGGGTAAACAT 1 73 CA9 TTTGAATGGGCGAGTGATTG ACAGCAAAAAGGAGGCCAAA...

Báo cáo khoa học: Identiﬁcation and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

... DR2:5¢-CCGTAAGGTCACAAGGTCACTCG -3 ,DR3:5¢-CCGTAAGGTCACAGAGGTCACTCG -3 , DR4: 5¢-CCGTAAGGTCACAGGAGGTCACTCG -3 , DR5: 5¢-CCGTAAGGTCACCAGGAGGTCACTCG -3 . PAL0: 5¢-CGCAAGGTCATGACCTCG -3 . One strand of each ... domain B Ligand binding domain Fig. 1. Sequence alignment. (A) Alignment of DNA binding domain (C domain) and itsC-terminal extension. (B) Alignment of ligandbinding domain (E domain) (after ... 5¢-AAGATGGTATTGAAGATGATGGTTGA -3 ), puriﬁed from agarose gelusing Gel Extraction kit (Qiagen, Valencia, CA, USA) and randomly labeled with 32 P using a Metaprime kit (Amer-sham Pharmacia Biotech...

Báo cáo khóa học: Identiﬁcation of residues controlling transport through the yeast aquaglyceroporin Fps1 using a genetic screen ppt

... osmoregulation.The discovery of the aquaporins marked a breakthrough in our understanding of water and solute transmembranetransport [1]. Aquaporins and aquaglyceroporins [the majorintrinsic protein ... Within the N-terminal regulatory domainS246P + Q592 stop TCTfiCCT + CAAfiTAA Between the N-terminal regulatory domain and TMD1K250E AAAfiGAA Between the N-terminal regulatory domain and TMD1G348D ... regulatory domainQ227R CAGfiCGG Within the N-terminal regulatory domainT 23 1A ACAfiGCA Within the N-terminal regulatory domainP 232 S CCTfiTCT Within the N-terminal regulatory domainP 236 L (found five...

Báo cáo khoa học: Identiﬁcation of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

... )525(5¢-TGACCTTGTCTCGTTGCCTCACCC -3 )and )37 8(5¢-GCTACAGGGATGCCAAAAGAACCC -3 )fortheSite -3, and primer set )34 6 (5¢-GCGTCTCACCCTAGTCCTGGTCCTGC -3 )and) 214 (5¢-GGAAGGGGCGGGTCCAGAGAACA -3 ) for the ... and autoradiographed. Competitor DNAsused in EMSA analysis were: NF1 wt, 5¢-TTTTGGATTGAAGCCAATATGATA -3 ;NF1mut,5¢-TTTTGGATTGAATAAAATATGATA -3 ;Site-2wt,5¢-GCGTCTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTTTGTCC -3 ;Site-2mut,5¢-GCGTCTCACCCTAGTAATGGTAATGCTCCAAGGGTTTTTGTCC -3 ;Site-3wt,5¢-GGGTTCTTTTGGCATCCCTGTAGC -3 ;Site-3mut,5¢-GGGTTCTTTTTAAATCCCTGTAGC -3 .Chromatin ... Identiﬁcation of NF1 as a silencer protein of the human adeninenucleotide translocase-2 genePeter Barath1,2, Daniela Poliakova1,2, Katarina Luciakova1,2 and B. Dean Nelson11Department...

Báo cáo khoa học: Identiﬁcation of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx

... glycoformsobserved for strain NM115, whereas 3 Hex glycoformswere also observed for strains 425/ 93 and 1000 (Table 1).Core oligosaccharide from the 1000 galE mutant strainwas also prepared and examined ... H-4b-GlcNAc i 4.72 3. 81 3. 75 3. 75 3. 59 Gal-I H -3, Gal-I H-4ii 4.72 3. 82 3. 75 3. 75 3. 58 Gal-I H -3, Gal-I H-4iii 4.72 3. 82 3. 75 3. 75 3. 58 Gal-I H -3, Gal-I H-4b-Gal (Gal II) i 4.48 3. 55 3. 68 3. 93 ND ... O-deacylatedlipid A (Lipid A- OH) is as indicated. Lipid A- OH consists of two glucosamine residues each bearing an N-linked 3- OH C14:0fatty acid and a phosphate group. Variation in lipid A- OH...

Xem thêm