Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) Wenjie Wu1,*, Edward G Niles1, Hirohisa Hirai2 and Philip T LoVerde1 Department of Microbiology and Immunology, School of Medicine and Biomedical Science, State University of New York, Buffalo, NY, USA Primate Research Institute, Kyoto University, Inuyama, Japan Keywords nuclear receptors; Schistosoma mansoni; SmNR1 ⁄ SmRXR1 interactions Correspondence P T LoVerde, Southwest Foundation for Biomedical Research, PO Box 760549, San Antonio, TX, 78245–0549, USA Fax: +1 210 6703322 Tel: +1 210 2589852 E-mail: ploverde@sfbr.org *Present address Southwest Foundation for Biomedical Research, PO Box 760549, San Antonio, Texas 78245-0549, USA Note The nucleotide sequences reported in this paper have been submitted to the GenBank under accession number: AY395037, AY395051-AY395057 (Received 25 September 2006, revised November 2006, accepted November 2006) A cDNA encoding a nuclear receptor subfamily I member in the platyhelminth Schistosoma mansoni (SmNR1) was identified and characterized SmNR1 cDNA is 2406 bp long and contains an open reading frame encoding a 715 residue protein Phylogenetic analysis demonstrates that SmNR1 is a divergent member of nuclear receptor subfamily I with no known orthologue SmNR1 was localized to S mansoni chromosome by fluorescent in situ hybridization Gene structure of SmNR1 was determined showing it to consist of eight exons spanning more than 14 kb Quantitative real-time RT-PCR showed that SmNR1 was expressed throughout schistosome development with a higher expression in eggs, sporocysts and 21-day worms SmNR1 contains an autonomous transactivation function (AF1) in the A ⁄ B domain as demonstrated in a yeast one-hybrid assay; it interacts with SmRXR1 in a yeast two-hybrid assay and in a glutathione S-transferase pull-down assay Electrophoretic mobility shift assay showed that SmNR1 could form a heterodimer with SmRXR1 to bind to DNA elements containing the half-site AGGTCA, a direct repeat of the half-site separated by 0–5 nucleotides (DR1-DR5) and a palindrome repeat of the half-site not separated by nucleic acids (Pal0) Transient transfection in mammalian COS-7 cells showed that SmNR1 ⁄ SmRXR1 could enhance the transcriptional activation of a DR2-dependent reporter gene Our results demonstrate that SmNR1 is a partner of SmRXR1 doi:10.1111/j.1742-4658.2006.05587.x Nuclear receptors (NRs) belong to a superfamily of transcriptional factors that regulate homeostasis, differentiation, metamorphosis and reproduction in metazoans Members of the nuclear receptor superfamily are characterized by a modular structure: a conserved DNA-binding domain (DBD) that contains two zinc finger motifs binding to the cis-regulatory region of a target gene, and a conserved ligand-binding domain (LBD) that is involved in transcriptional activation of the target gene via ligand and coregulator binding Some NRs have no known ligand and are called orphan receptors [1,2] A DNA core motif recognized by a NR is known as a hormone response element The typical hormone response element is a consensus hexameric sequence AGGTCA, which is called a half-site NRs can bind to the half-site in different orientations or repeats either as a monomer, a homodimer or a heterodimer [2] For heterodimer binding, Abbreviations BAC, bacterial artificial chromosome; DBD, DNA-binding domain; GST, glutathione S-transferase; LBD, ligand-binding domain; NR, nuclear receptor; RAR, retinoic acid receptor; SD, synthetic dropout 390 FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS W Wu et al the nuclear receptor Retinoic X Receptor (RXR) acts as a critical partner and thus plays a central role in a variety of nuclear signaling pathways [3–6] Schistosoma mansoni is a multicellular eukaryotic parasite with a complex life cycle that involves mammalian and snail hosts Study of schistosome NRs enables us to understand how they regulate signaling pathways in the schistosome itself and to understand the molecular relationship between the schistosome and vertebrate and snail hosts Recently two S mansoni RXR homologues, SmRXR1 [7] and SmRXR2 [8,9], have been identified and characterized SmRXR1 demonstrated that it may have an important role in regulation female-specific p14 genes [7] SmRXR2 also showed a pattern of recognition of cis-sequences present in the p14 gene [10] SmRXR1 and SmRXR2 are expressed throughout schistosome development suggesting that they play a pleiotropic role in the regulation of a number of genes [7–10] Study of SmRXR partners will add to our knowledge of nuclear receptor gene regulation in schistosomes and to an understanding of the evolution of RXR’s function We present herein the characterization of a nuclear receptor subfamily I member from S mansoni (SmNR1) and demonstrate its interaction with SmRXR1 Results cDNA isolation A 2343 bp cDNA containing the 5¢-UTR, entire open reading frame, 3¢UTR and poly A tail was isolated by PCR An additional 62 bp 5¢ UTR was extended by 5¢ RACE generating a 2406 bp cDNA The sequence was confirmed as belonging to a single mRNA species by sequencing the products of PCR on single-stranded cDNA using primers within the 5¢-and 3¢ UTR The cDNA of SmNR1 encodes an open reading frame of 2145 bp corresponding to a 715 amino acid protein The DNA binding domain (DBD) is highly conserved, the P-box (EGCKG), which is involved in determining DNA binding specificity, is identical to most members of nuclear receptor subfamily I, for instance retinoic acid receptor (RAR) and vitamin D3 receptor In a C-terminal extension of the DBD, the T-box which corresponds to a dimerization interface is highly conserved, but the A-box showed less conservation (for example, 33.3% similarity to hRAR gamma and 22.2% to dHR3) (Fig 1A) The hinge region (D domain) of SmNR1 is unusually long, similar to other reported schistosome nuclear receptors [7–9,11–14] The precise length of the D domain was not determined due to the highly divergent helices 1–2 in the S mansoni NR1 LBD However, the DBD terminates at amino acid 332 and the signature sequence of the LBD (Ts) starts at amino acid 513 (Fig 1B) The end of the hinge region to Ts is usually 40 amino acids in most NRs, and the length of the hinge in SmNR1 thus can be estimated to be 140 amino acids The role of the large hinge in schistosome NRs remains unknown The degree of conservation of the LBD in SmNR1 is lower, helices 1–2 are highly divergent as mentioned above, like that in other S mansoni NRs [7–9,11–14] Although the LBD of SmNR1 is less conserved, the consensus signature of LBD (F,WY)(A,SI)(K,R,E,G) XXX(F,L)XX(L,V,IXXX(D,S) (Q,K)XX(L,V)(L,I,F) [15,16] (from the C-terminus of helix to the middle of helix 5) and the consensus motif II EFXXXLXXLX LDXXEXALLKAIXLFSXDRXGLXXXXXVEXLQE XXXXALXXY [17] (from helix to helix 9) is highly conserved (Fig 1B) One amino acid in helix 10 has been demonstrated to have an important role in heterodimer formation with RXRs In SmNR1, a methionine that occurs at position 668 may be an amino acid that corresponds to the amino acids found in hRARc and LXRa [18] This suggests that helix 10 of SmNR1 is probably involved in forming a dimer with SmRXR (Fig 1B) A putative AF2 activating domain core (AF2-AD) is present in SmNR1 (Fig 1B); it exhibits a high degree of conservation (represented by CLKEFL) in comparison with the common consensus AF2-AD core structure of FFXEFF, where F denotes a hydrophobic residue [19,20] Phylogenetic analysis A phylogenetic tree was constructed using the maximum likelihood method under the Jones–Taylor– Thornton substitution model, with a gamma distribution of rates between sites (eight categories, parameter alpha) Support values for the tree were obtained by bootstrapping 100 replicates (Fig 2) The result shows that SmNR1 is a divergent member belonging to NR subfamily I The same result was obtained by Bayesian inference and neighbor-joining distance analysis (supplementary Figs S1 and S2) Even though SmNR1 was clustered with Onchocerca volvulus NR1 on the maximum likelihood tree, the low bootstrap value (29%) did not support SmNR1 to be an orthologue to O volvulus NR1 (Fig 2) Chromosome localization and gene organization A bacterial artificial chromosome (BAC) library of S mansoni [21] was screened with a SmNR1-specific probe, and three positive clones (SmBAC1 28A22, FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS 391 S mansoni NR1 A B W Wu et al DNA binding domain Ligand binding domain Fig Sequence alignment (A) Alignment of DNA binding domain (C domain) and its C-terminal extension (B) Alignment of ligand binding domain (E domain) (after helix 2) Helices as described in [60] are boxed The putative autonomous activation domain (AF2-AD) is also indicated The number at the end of each line indicates residue position in the original sequence H3-H12, helices 3–12 SmBAC1 121N20 and SmBAC1 41A19) were identified SmBAC1 41A19 was used as a probe for fluorescent in situ hybridization and SmNR1 was localized to chromosome (Fig 3) Gene organization of SmNR1 was determined by sequencing BAC DNA (SmBAC1 41A19) and by cDNA alignment with a 24 kb genomic DNA contig (Contig_0012771) obtained from WTSI S mansoni WGS database (ftp://ftp.sanger.ac.uk/pub/databases/ Trematode/S.mansoni/genome) The SmNR1 gene consists of eight exons spanning over 14 kb (Fig 4A), and all splice donor and acceptor sites fit the GT-AG rule 392 (supplementary Table S1) The 5¢-UTR is encoded by two exons, A ⁄ B, C (DBD), hinge and E–F domain (LBD) are each encoded by 2–3 exons, respectively (Fig 4B) We previously demonstrated that the splice junction in the DBD encoding region was conserved in SmNR1 [22] In vertebrate NRs, two conserved splice sites were identified in the LBD encoding region, one is in motif I (also known as signature sequence of LBD) and the other is in motif II [17] The splice junction of motif I in SmNR1 is at the same position as that found only in RARs (NR1B) [17] (Fig 4C) The splice site of FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS W Wu et al S mansoni NR1 Fig Fluorescent in situ hybridization mapping of SmNR1 Mitotic metaphase chromosomes (2n ¼ 16) of male schistosomes obtained from the S mansoni sporocyst stage SmBAC 41A19 BAC DNA was used as a probe and hybridized to chromosome Scale bar ¼ lm structure of SmNR1 is ancient and has been maintained through out evolution of NRs Developmental expression Fig Phylogenetic tree of SmNR1 A maximum likelihood tree showing that SmNR1 (in black) is a member of the NR subfamily I The phylogenetic tree was constructed by maximum likelihood method under the Jones–Taylor–Thornton substitution model with a gamma distribution of rates between sites (eight categories, parameter alpha) Support values for the tree were obtained by bootstrapping, 100 replicates The subfamilies are according to the nomenclature system for the nuclear receptor (for nuclear receptor nomenclature, see http://www.ens-lyon.fr/LBMC/laudet/nurebase/ nomenclature/Nomenclature.html) The GenBank accession numbers of the analyzed sequences are provided in supplementary Table S2 motif II in SmNR1 is located at the same conserved position as found in all analyzed NRs [17] The conserved splice junctions in SmNR1 suggest that the gene Quantitative real-time RT-PCR was performed to evaluate mRNA expression of SmNR1 Normalized gene expression [23] was standardized to the relative quantities of S mansoni a-tubulin SmNR1 was expressed in all tested stages, with a higher expression in eggs (19.9-fold greater than male worms), sporocysts (13.6-fold greater than male worms) and 21-day worms (6.8-fold greater than male worms) It was expressed in a similar manner in the other developmental stages tested (Fig 5) The results suggest that SmNR1 is expressed throughout development but may have a more significant role in the development of eggs, sporocysts and 21-day worms Determination of transactivation A yeast one-hybrid assay was employed to determine whether ligand-independent autonomous transactivation function was present in SmNR1 Yeast strain AH109 was transformed with pGBKT7-SmNR1, pGBKT7-SmNR1(A ⁄ B) (containing the A ⁄ B domain) and pGBKT7-SmNR1(CF) (without the A ⁄ B domain), respectively, spread on synthetic dropout (SD) ⁄ –Leu media and SD ⁄ –Leu ⁄ –His medium plus mm 3-AT Yeasts transformed with pGBK-SmNR1 or pGBKSmNR1(A ⁄ B) grew on both SD ⁄ –Leu medium and FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS 393 S mansoni NR1 W Wu et al A B Fig Gene structure of SmNR1 (A) Showing exons and size of introns; roman numerals indicate exons (B) Showing the size of exons and their correspondence to the different NR domains A ⁄ B, A ⁄ B domain; C, C domain (DBD); D, D domain (hinge); Ts, signature sequence of the LBD; E, E domain (LBD) after Ts (C) Showing the splice junction of SmNR1 within motif I which is at the same position as that found only in RARs (NR1B) [17] hRARa, human retinoic acid receptor alpha (GenBank: AC018629); CiRAR, C intestinalis retinoic acid receptor (www.jgi.doe.gov, Genomic sequence Scaffold (v 1.0): (14) H4, helix 4; H5, helix C formed with the control plasmids grew as expected (see the legend to Fig 6A for a complete explanation) SmNR1 interacts with SmRXR1 Fig Quantitative real-time RT-PCR shows mRNA expression of SmNR1 Gene expression [23] of SmNR1 was normalized to the relative quantities of S mansoni a-tubulin For graphical representation of fold of expression, the normalized expression was recalculated by dividing the expression level of each stage by the lowest expression stage (male worms) Egg, eggs; Sp, secondary sporocysts in 30-day infected snail; Cer, Cercariae; 15d, 15-day schistosomules; 21d, 21-day schistosomules; 28d, 28-day worms; 35d, 35-day worms; Pair, adult worm pairs; Female, adult female worms; Male, adult male worms SD ⁄ –Trp ⁄ –His medium plus mm 3-AT (Fig 6A), while yeasts transformed with pGBK-SmNR1(CF) grew on SD ⁄ –Leu medium but not on SD ⁄ –Trp ⁄ –His medium plus mm 3-AT (Fig 6A) The results suggested that both full-length and the A ⁄ B domain of SmNR1 activated transcription of GAL4 reporter gene in the absence of ligand, while the C-F domain did not Thus the A ⁄ B domain exhibits an autonomous transactivation function (AF-1) element Yeast trans394 A yeast two-hybrid assay was performed to address whether SmNR1 interacted with SmRXR1 or SmRXR2, or acted as a homodimer in a yeast system As the A ⁄ B domain of SmNR1 (as demonstrated above) and SmRXR1 can activate transcription of GAL4 reporter [7], SmNR1(CF) and SmRXR1(CF) were used in the DBD vectors Yeast transformed with pSV40 ⁄ p53 (positive control), pSV40 ⁄ pLamin C (negative control), pGBK-SmNR1(CF) ⁄ pACT-SmRXR1, pASSmRXR1(CF) ⁄ pGAD-SmNR1, pGBK-SmNR1(CF) ⁄ pACT-SmRXR2, pAS-SmRXR2 ⁄ pGAD-SmNR1 and pGBK-SmNR1(CF) ⁄ pGAD-SmNR1 grew on SD ⁄ –Trp ⁄ –Leu medium If SmNR1 interacts with SmRXR1 or SmRXR2, or acts as a homodimer, the Gal4 DNA binding domain fusion partner will bind to the Gal1 UAS element and the Gal4 activation domain will drive transcription of HIS reporter gene Yeasts cotransformed with pGBK-SmNR1(CF) ⁄ pACT-SmRXR1 or pAS-SmRXR1(CF) ⁄ pGAD-SmNR1 grew on SD ⁄ –Trp ⁄ –His ⁄ –Leu medium plus mm 3-AT, indicting that SmNR1 and SmRXR1 interacted Yeasts cotransformed with pGBK-SmNR1(CF) ⁄ pACT-SmRXR2, pAS-SmRXR2 ⁄ pGAD-SmNR1 or pGBK-SmNR1 (CF) ⁄ pGAD-SmNR1 did not grow on SD ⁄ –Trp ⁄ –His ⁄ –Leu medium plus mm 3-AT, indicating that SmNR1 did not interact with SmRXR2 or act as a homodimer The positive control yeast cotransformed with plasmids pSV40 ⁄ p53 grew on SD ⁄ –Trp ⁄ –His ⁄ –Leu FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS W Wu et al Fig Yeast one and two-hybrid assays (A) Yeast one hybrid assay showing that SmNR1 contains an autonomous transactivation function in A ⁄ B domain Individual AH109 yeast colonies obtained from an initial transformation were re-streaked on SD ⁄ –Trp medium and on SD ⁄ –Trp ⁄ –His medium plus mM 3-AT (a) Diagram of reporter system used in yeast one-hybrid assay The HIS3 reporter gene is controlled by binding of the Gal4 DNA binding domain (GAL4DB) to the GAL4 response elements When a GAL4BD fusion protein contains an activation domain, it will transactivate the expression of the reporter genes (b) On SD ⁄ –Trp medium, yeasts transformed with pGBKT7-SmNR1 (streak 1), pGBKT7SmNR1(A ⁄ B) (streak 2), pGBKT7-SmNR1(CF) (streak 3), P53 (streak 4), PSV40 ⁄ P53 (streak 6), pLamin C (streak 7) and pLamin C ⁄ PSV40 (streak 8) grew, because pGBKT7, P53 and pLamin C plasmids expressed trp gene, yeasts transformed with PSV40 did not grow because PSV40 plasmid did not express trp gene (streak 5, negative control) (c) On SD ⁄ –Trp ⁄ –His medium plus mM 3-AT, yeasts transformed with P53 (streak 4), PSV40 (streak 5), pLamin C (streak 7) and pLamin C ⁄ PSV40 (streak 8) did not grow, because P53 and pLamin C plasmids did not express the trp gene Yeasts transformed with pGBKT7-SmNR1(CF) (streak 3) did not grow, indicating that the C-F domain of SmNR1 could not active transcription of the His reporter gene Yeasts transformed with pGBKT7-SmNR1 (streak 1) and pGBKT7-SmNR1(A ⁄ B) (streak 2) grew indicating that the A ⁄ B domain contains an activation function to active transcription of His reporter gene PSV40 ⁄ P53 (streak 6, positive control) grew as expected (B) Yeast two hybrid assay showing SmNR1 interaction with SmRXR1 (a) Diagram of the system used in yeast two hybridization If protein (P1) interacts with protein (P2), the Gal4 DNA binding domain fusion partner will bind to the Gal1 UAS element and the Gal4 activation domain will drive transcription of the expression of the reporter gene Individual AH109 yeast colonies obtained from initial transformation were re-streaked on SD ⁄ –Trp ⁄ –Leu medium (b) and on SD ⁄ –Trp ⁄ –Leu ⁄ –His medium plus mM 3-AT (c) Streak 1, pSV40 ⁄ p53 (positive control); streak 2, pSV40 ⁄ pLamin C (negative control); streak 3, pGBK-SmNR1(CF) ⁄ pGAD-SmNR1; streak 4, pAS-SmRXR1(CF) ⁄ pGAD-SmNR1; streak 5, pGBK-SmNR1(CF) ⁄ pACT-SmRXR1; streak 6, pAS-SmRXR2 ⁄ pGAD-SmNR1; and streak 7, pGBK-SmNR1(CF) ⁄ pACT-SmRXR2 medium plus mm 3-AT, yeast cotransformed with the negative control plasmids pSV40 ⁄ pLamin C did not grow on SD ⁄ –Trp ⁄ –His ⁄ –Leu medium plus mm 3-AT as expected (Fig 6B) A glutathione S-transferase (GST) pull-down assay was performed to verify the interaction of SmNR1 and SmRXR1 in vitro To address whether the heterodimer interface is located in the EF domain, both SmNR1 and SmNR1(EF) were employed GST-SmNR1 and GST-SmNR1(EF) fusion proteins were immobilized on glutathione beads 35S-labeled SmRXR1 was produced in a rabbit reticulocyte system GST protein was used as a negative control The pull-down results showed that both SmNR1 and SmNR1(EF) interacted with SmRXR1 (Fig 7A) SmNR1(EF) interacted with S mansoni NR1 A B SmRXR1 at a level similar to that of SmNR1 suggesting that there was a heterodimer interface located in SmNR1 EF domain (Fig 7B) DNA binding assays with SmNR1 ⁄ SmRXR1 heterodimers Electrophoretic mobility shift assays were performed to determine DNA binding specificity of SmNR1 A DNA element containing the half-site AGGTCA, a direct repeat of the half-site spaced with 0–5 nucleic acids (DR0-DR5) and palindrome repeat of the halfsite not separated by nucleic acids (Pal0) were employed No gel shift was observed when c-32P-labeled half-site DR0-DR5 or Pal0 were added to SmNR1 alone (Fig 8) Smears were observed when the same oligonucleotides were added to SmRXR1, and strong shifts were observed when the oligonucleotides were added to SmNR1 ⁄ SmRXR1 (Fig 8) A weak shift was observed when labeled half-site was added to SmNR1 ⁄ SmRXR1 (Fig 8) The results indicated that SmNR1 did not bind to the tested oligonucleotides, SmRXR1 bound to the oligonucleotides in an unstable state and SmNR1 ⁄ SmRXR1 heterodimer strongly bound to the target oligonucleotides The results suggest that SmNR1 requires heterodimerization with SmRXR1 to bind to the tested DNA elements The preference for SmNR1 ⁄ SmRXR1 heterodimer binding to oligonucleotides was determined by competi- FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS 395 S mansoni NR1 W Wu et al A B Fig GST pull-down assay showing SmNR1 interaction with SmRXR1 in vitro (A) 35S-labeled SmRXR1 was synthesized in vitro using pCITE-SmRXR1 as template and then incubated with GSTSmNR1, GST-SmNR1(EF) or GST (negative control) protein affixed to glutathione-Sepharose beads The beads were collected, washed and the bound protein was resolved on 10% SDS acrylamide gel and visualized by autoradiography Each experiment was repeated three times (a) GST-SmNR1 ⁄ pCITE-SmRXR1 reaction (b) GSTSmNR1(EF) ⁄ pCITE-SmRXR1 reaction (B) Bar graph representation of the relative band intensities of SmNR1 ⁄ SmRXR1 and SmNR1(EF) ⁄ SmRXR1 reaction and compared with SmRXR1 input (a) GST-SmNR1 ⁄ pCITE-SmRXR1 reaction (b) GST-SmNR1(EF) ⁄ pCITE-SmRXR1 reaction The diagram explains the reactions tion of unlabeled DR0-DR5 and Pal0 with c-32P-labeled DR4 (Fig 9) A 10-, 50- and 200-fold molar excess of unlabelled oligonucleotides was used for competition The results showed that a 10-fold excess of unlabelled specific oligonucleotides led to a reduction in the signal, while a 50- and 200-fold excess of unlabelled specific competitors completely abolished the binding of the labeled DR4 No reduction of binding was observed when unlabelled nonspecific oligonucleotides were used (Fig 9) The order of preference for SmNR1 ⁄ SmRXR1 heterodimer binding to DNA elements was thus determined by competition of a 10-fold excess of unlabeled specific oligonucleotides to be DR2 > DR5 > DR3 > DR4 > DR1 > DR0 > Pal0 To determine the role of the A ⁄ B domain of SmNR1 in DNA binding, SmNR1(CF) ⁄ SmRXR1 binding to DR1 and DR2 were employed Although SmNR1(EF) can form a heterodimer with SmRXR1 (demonstrated by pull-down experiment, Fig 7), no shifts were observed when c-32P-labeled DR1 and DR2 were added to SmNR1(CF) ⁄ SmRXR1, while strong shifts were observed when same oligonucleotides were added to SmNR1 ⁄ SmRXR1 (Figs and 10) The results suggested that the A ⁄ B domain of SmNR1 was necessary for SmNR1 ⁄ SmRXR1 heterodimer to bind to the tested DNA elements To determine the role of the C-terminal extension of SmNR1 and SmRXR1 in binding to DNA elements, in vitro synthesized SmNR1 (Ile247 to Ser372) (containing 20 amino acids at the 5¢ end of the DBD, the DBD and 40 amino acids at 3¢ end of the DBD) and SmRXR1 (Glu251 to Asn376) (containing 20 amino acids at 5¢ end of the DBD, the DBD and 40 amino acids at the 3¢ end of the DBD) were tested Both SmNR1 (Ile247 to Ser372) and SmRXR1 (Glu251 to Asn376) bound to half-site, and Fig DNA binding of SmNR1 and SmRXR1 in vitro A single protein or a combination of two proteins were synthesized in a TNT quick coupled transcription ⁄ translation system (Promega) and allowed to bind to c-32P-labeled DNA elements containing a half-site, DR0-DR5 and Pal0 Lanes 1, 5, 9, 13, 17, 21, 25 and 29 contain lysate from the control transcription-translation reaction as negative controls Lanes 2, 6, 10, 14, 18, 22, 26 and 30 contain lysate with in vitro translated SmNR1 Lanes 3, 7, 11, 15, 19, 23, 27 and 31 contain lysate with in vitro translated SmNR1 and SmRXR1 Lanes 4, 8, 12, 16, 20, 24, 28 and 32 contain lysate with in vitro translated SmRXR1 NS, nonspecific binding 396 FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS W Wu et al S mansoni NR1 Fig Competition of DNA binding to SmNR1 ⁄ SmRXR1 heterodimer in vitro Combination of SmNR1 and SmRXR1 proteins were synthesized in vitro, added to c-32P-labeled DR4 Unlabelled DR0-DR5, Pal0 or unrelated oligonucleotides (·10, ·50 and ·200 fold, respectively) were added to compete with labeled DR4 Lanes 1, 11 and 21 contain lysate from the control transcription-translation reaction as negative controls Lanes 2, 12 and 22 contain no competitor Lanes 3, 13 and 23 contain nonspecific competitor Lanes 4, 14 and 24 contain DR0 as competitor Lanes 5, 15 and 25 contain DR1 as competitor Lanes 6, 16 and 26 contain DR2 as competitor Lanes 7, 17 and 27 contain DR3 as competitor Lanes 8, 18 and 28 contain DR4 as competitor Lanes 9, 19 and 29 contain DR5 as competitor Lanes 10, 20 and 30 contain Pal0 as competitor NS, nonspecific binding SmNR1 (Ile247 to Ser372) bound to DR2, weakly to DR1, DR4 and DR5 SmRXR1 (Glu251 to Asn376) bound to DR1, DR2, DR4 and DR5 (Fig 11) SmNR1 (Ile247 to Ser372) and SmRXR1 (Glu251 to Asn376) did not form a heterodimer to bind to the DNA elements The results suggest that although there is a dimer interface located in DBD and C-terminal extension [24–26], the D-E domain has an important role in SmNR1 ⁄ SmRXR1 heterodimer binding to the DNA elements Figure 10 demonstrated that SmNR1 CF could not bind to DR1 or DR2 elements, while SmNR1 missing both the A ⁄ B and E ⁄ F domains (Fig 11) was capable of binding to a half-site and to several DR elements We suggest that the E ⁄ F domains of SmNR1 might prevent the interaction between the C domain of SmNR1 and DNA response elements, as previously demonstrated for S mansoni RXR2 [8] Transcriptional activation of a DR2 element-dependent reporter gene Electrophoretic mobility shift assay results showed that SmNR1 ⁄ SmRXR1 heterodimer could bind to DNA element DR2 strongly A pUTK-3xDR2 reporter plasmid was constructed to test the ability of SmNR1 ⁄ SmRXR1 to transactivate DR2-dependent reporter gene in mammalian COS-7 cells The results showed that SmNR1 ⁄ SmRXR1 activated the reporter gene with a significant difference to control plasmid PcDNA [degrees of freedom (d.f.) ¼ 9, p ¼ 0.03] (Fig 12) Discussion Phylogenetic analysis shows that SmNR1 is a divergent member of NR subfamily I with no known orthologue This suggests that other unknown NR groups may be expected to be present in invertebrate lineages as their sequences become available for analysis SmNR1 is a new NR group which does not exist in Drosophila, Caenorhabditis or vertebrates whose NR complement is well studied Recently an alternative splice variant of SmNR1 was identified (DQ439962) Our 5¢ sequence (nt 1–84) aligns to nt 3397–3480 on the genomic DNA Contig_0012771, while the first exon of DQ439962 runs from nt 4069–4166 Both variants encode the same protein sequence; this is therefore a case of alternative splicing in the noncoding region similar to what was found for the S mansoni nuclear receptor, SmFtz-F1 [11] Whether the corresponding mRNAs interact differently with the translational machinery or have different stabilities as proposed for SmFTZ-F1 [11] is yet to be determined FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS 397 S mansoni NR1 W Wu et al Fig 10 DNA binding of SmNR1(CF) ⁄ SmRXR1 in vitro A single protein or a combination of two proteins were synthesized in a TNT quick coupled transcription ⁄ translation system and allowed to bind to c-32P-labeled DR1 and DR2, respectively Lane 1, lysate from the control transcription-translation reaction with labeled DR1 as negative control; lanes 2–4, SmNR1(CF) ⁄ SmRXR1 with labeled DR1 plus indicated amounts of unlabeled DR1 as competitor; lanes 5–7, SmNR1 ⁄ SmRXR1 plus indicated amounts of unlabeled DR1 as competitor (positive control); lane 8, lysate from the control transcriptiontranslation reaction with labeled DR2 as negative control; lanes 9–11, SmNR1(CF) ⁄ SmRXR1 with labeled DR2 plus indicated amounts of unlabeled DR2 as competitor; lanes 12–14, SmNR1 ⁄ SmRXR1 with labeled DR2 plus indicated amounts of unlabeled DR2 as competitor (positive control) NS, nonspecific binding Most NRs which can form a heterodimer with RXR are from subfamily I, for example, thyroid hormone receptor and RAR [2] Our studies show that SmNR1 exhibits similarity to RAR, PPAR and EcR, which need RXR to form a heterodimer to confer hormone response element binding [25,27–31] RXRs have been characterized in a wide variety of metazoans, including in Cnidaria [32], Platyhelminths [7–9], Mollusca [33], Nematoda [34] and Arthropoda [35,36], and vertebrates [37,38] The functional relationship between vertebrate RXR with other NRs was described as the 1-2-3-4-5 rule [39,40] and was extended to insect RXR ⁄ EcR heterodimers [28] For example, vertebrate RXR ⁄ RAR can bind to DR1, DR2 and DR5 but not to DR3 or DR4, RXR ⁄ vitamin D3 receptor heterodimer can bind to DR3 but not to DR1, DR2, 398 DR4 or DR5 [25,27,29,31,41] In insects, Drosophila USP (RXR homologue) forms a heterodimer with EcR that can bind to DR0-DR5 [28] and to an imperfect palindromic structure [42] The DNA binding specificity of RXR ⁄ NR heterodimer in most invertebrates is not well known A recent study showed that S mansoni SmRXR1 ⁄ SmFtz-F1 heterodimer could bind to SF-1 element (which contains a conserved half-site AGGTCA) via SmFtz-F1 physical binding to the DNA element, while SmRXR1 did not bind to the DNA [43] In the mollusk, Biomphalaria glabrata RXR (BgRXR) was shown to bind to DR1 as a homodimer or as a heterodimer with mammalian RARa, LXR, FXR or PPARa [33] In this study, we showed that SmNR1 ⁄ SmRXR1 heterodimer could bind to DR0DR5, as such it is similar to the Drosophila USP ⁄ EcR heterodimer [28] but with a different preference order (Fig 9) The results suggest that RXR ⁄ NR heterodimer obtained the ability to bind to conserved half-site repeats before the split of Arthopods and Platyhelminths, but has not subsequently evolved a strict spacing between half-sites as it can bind to all of DR1 to DR5 elements This lack of binding specificity is different from the vertebrate RXR ⁄ RAR interaction that can bind to DR1, DR2 and DR5 but not to DR3 or DR4 [25,31] SmRXR1 alone was known to bind to a nonconserved direct repeat in the promoter region of S mansoni p14 gene [7] In this report, we demonstrated that SmRXR1 alone could also bind to a conserved half-site and direct repeats of half-site (Fig 8) In addition, we showed that SmNR1 ⁄ SmRXR1 heterodimer could bind in vitro to a perfect palindrome (Pal0) containing element (Figs and 9) Further studies of SmNR1 will help us to understand the mechanism of RXR ⁄ NR signal pathway in invertebrates and its evolutionary role A yeast one-hybrid assay was employed and a ligandindependent autonomous transactivation function (AF1) was determined to be present in the A ⁄ B domain of SmNR1 Furthermore, we demonstrated that the A ⁄ B domain has an important role in determining SmNR1 ⁄ SmRXR1 heterodimer binding to the DNA element That amino acids in the A ⁄ B domain can affect DNA binding and dimerization has previously been reported in the chicken thyroid hormone receptor [44] Our data shows that SmNR1 ⁄ SmRXR1 can activate transcription from a DR2-dependent reporter plasmid in mammalian cells (Fig 12) Future studies will examine transcriptional activation in detail Although the full-length of SmNR1 could not bind to the response element without the presence of SmRXR1 in vitro (Fig 8), SmNR1 alone enhanced transactivation of FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS W Wu et al S mansoni NR1 Fig 11 DNA binding of SmNR1(Ile247-Ser372) and SmRXR1(Glu251-Asn376) in vitro DNA binding of a protein containing 20 amino acids at the 5¢ end of the DBD, the DBD and the 40 amino acids at the 3¢ end of the DBD of SmNR1 (Ile247-Ser372) and SmRXR1 (Glu251-Asn376) were tested in vitro Lanes 1, 5, 9, 13, 17, 21, 25 and 29, lysate from the control transcription-translation reaction as negative control; lanes 2, 6, 10, 14, 18, 22, 26 and 30 contain with lysate with in vitro translated SmNR1(Ile247-Ser372); lanes 3, 7, 11, 15, 19, 23, 27 and 31, lysate with in vitro translated SmNR1(Ile247-Ser372) and SmRXR1(Glu251-Asn376); lanes 4, 8, 12, 16, 20, 24, 28 and 32, lysate with in vitro translated SmRXR1(Glu251-Asn376) NS, nonspecific binding * Fold activation PcDNA SmNR1 SmRXR1 SmNR1+SmRXR1 Fig 12 SmNR1 ⁄ SmRXR1 transactivated DR2-dependent reporter gene in vivo Mammalian COS-7 cells were transfected with pUTKDR2 reporter plasmids, pRL4.74 and various expression plasmids for pcDNA-3.1, SmNR1, SmRXR1 and SmNR1 ⁄ SmRXR1 Cells were lysed and luciferase activities were measured 48 h after transfection Results are expressed in fold activation (relative to the pcDNA-3.1 vector control) Each experiment was repeated at least three times The statistical significance of increase in luciferase activities of cells transfected with SmNR1, SmRXR1 and SmNR1 ⁄ SmRXR1 compared to cells transfected with pCDNA-3.1 was determined using Student’s t-test ( d.f ¼ 9, *P < 0.05) transcription in mammalian cells Whether SmNR1 can dimerize with mammalian RXR or whether a low level of homodimer formation of SmNR1 is needed is unknown However, our yeast two-hybrid and pull- down assays show no evidence for homodimerization of SmNR1 (Fig 6, unpublished data) The ability of SmNR1 ⁄ SmRXR1 to transactivate DR2-dependent reporter gene in mammalian cells suggests that SmNR1 ⁄ SmRXR1 can interact with mammalian coactivators of transcription, and S mansoni coactivators of transcription may have a similar mechanism to SmNR1 ⁄ SmRXR1 Recently four NR coactivators, SmGCN5, SmPRMT1, SmCBP1 and SmCBP2 were isolated from S mansoni [45–47] It was shown that they could interact with schistosome NRs For example, SmCBP1 interacted with S mansoni nuclear receptor SmFTZ-F1 and exhibit transcriptional activity in mammalian cells [47] Importantly, the interaction of SmNR1 ⁄ SmRXR1 is demonstrated by in vitro (GST pull-down assays) and in vivo (yeast two-hybrid and mammal cell assays) results Likewise, the ability of the heterodimer to bind DNA is shown by in vitro (electrophoretic mobility shift assay) assays and to bind DNA and drive transcription in a mammalian cell reporter gene assay in in vivo results Experimental procedures Parasites The NMRI strain of S mansoni was maintained in snails (Biomphalaria glabrata) and Syrian golden hamsters (Mesocricetus auratus) Cercariae were released from infec- FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS 399 S mansoni NR1 W Wu et al ted snails and harvested on ice Schistosome worms of different ages (15–45 days old) were harvested from infected Syrian golden hamsters Single-sex worms were obtained by separating adult worm pairs Isolation of SmNR1 cDNA PCR was performed using S mansoni female worm phage cDNA library pool [pBluescript SK (+ ⁄ –) phagemid] as template DNA The PCR primers for one end (either the 5¢ or 3¢ end) were designed according to the cDNA sequence of a short fragment previously cloned [22] The primer for the other end (either the 5¢ or 3¢ end) was a vector universal primer (M13-Rev and T3, or M13-For and T7 primers) The 5¢-UTR was extended by rapid amplification of cDNA ends (RACE) using SMARTTM RACE cDNA Amplification Kit (BD Biosciences Clontech, Mountain View, CA 94043, USA) The sequence was confirmed as belonging to a single mRNA species by sequencing the products of PCR on single-stranded cDNA using primers within 5¢- and 3¢-UTR S mansoni SmBAC1 library was screened as previously described [21] A SmNR1 specific probe of 497 bp was produced by PCR amplification with TOPO 2.1-SmNR1 as a template (forward primer: 5¢-ATTTCAGAAGTTGAAC AAACACAC-3¢, reverse primer: 5¢-AAGATGGTATT GAAGATGATGGTTGA-3¢), purified from agarose gel using Gel Extraction kit (Qiagen, Valencia, CA, USA) and randomly labeled with 32P using a Metaprime kit (Amersham Pharmacia Biotech Inc., Piscataway, NJ, USA) For BAC DNA sequencing, the BAC clone was grown in 100 mL LB medium (12.5 lgỈmL)1 choramphenicol), BAC DNA was purified using Plasmid Midi kit (Qiagen) and sequenced on an ABI-377 automatic sequencing machine (Applied Biosystems, Foster City, CA, USA) Fluorescent in situ hybridization was performed on S mansoni sporocyst metaphase chromosome spreads with BAC DNA using techniques previously described [52,53] Genomic sequence analysis and gene organization Sequence analysis and phylogenetic tree construction The phylogenetic tree was constructed using deduced DBD and LBD sequences (after helix 2) aligned with clustalw (http://www.cf.ac.uk/biosi/research/biosoft/ Downloads/clustalw.html) (supplementary Fig S3) Phylogenetic analysis of the data set was carried out using the maximum likelihood method under the Jones–Taylor– Thornton substitution model [48] with a gamma distribution of rates between sites (eight categories, parameter alpha, estimated by the program) using phyml (v2.4.4) [49] Support values for the tree were obtained by bootstrapping 100 replicates The same data set was also tested by Bayesian inference [50] and neighbor-joining distance [51] methods For Bayesian inference, the data set was analyzed under the Jones–Taylor–Thornton substitution model with a gamma distribution of rates between sites using mrbayes v3.1.1 [50] The trees were started randomly; four simultaneous Markov chains were run for million generations The trees were sampled every 100 generations Bayesian posterior probabilities were calculated using a Markov chain Monte Carlo (MCMC) sampling approach implemented in mrbayes v3.1.1, with a burn-in value setting at 7500 generations For neighbor-joining distance analysis, the data set was analyzed under Jones–Taylor–Thornton substitution model with a gamma distribution of rates between sites (eight categories, parameter alpha, estimated using PHYML) using phylip package v3.62 (http://evolution genetics.washington.edu/phylip.html) Support values for the tree were obtained by bootstrapping a 1000 replicates with seqboot implemented in the phylip package v3.62 400 BAC library screening, BAC DNA sequencing and chromosomal fluorescent in situ hybridization Exon ⁄ intron boundaries of SmNR1 were determined by sequencing BAC DNA of SmBAC1 41A19 obtained by BAC library screening Primers were designed according to the different regions of cDNA and the entire encoding regions were sequenced Intron sizes were determined by alignment of cDNA with a genomic DNA contig (Contig_0012771) obtained from WTSI database (ftp://ftp.sanger.ac.uk/pub/ databases/Trematode/S.mansoni/genome) Quantitative real-time RT-PCR mRNA expression of SmNR1 in eggs, secondary sporocysts (in 30-day infected snail), cercariae, 15-day schistosomules, 21-day schistosomules, 28-day worms, 35-day worms, adult worm pairs, adult female worms and adult male worms were analyzed by quantitative real time RT-PCR Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), treated with RNase-free DNaseI (RQ1 DNase; Promega, Madison, WI, USA) and reverse transcribed using a random hexamer and SuperScript Reverse Transcriptase II (SSRTaseII; Invitrogen) [22] Reverse-transcribed cDNA samples were used as templates for PCR amplification using SYBR Green Master MixÒ (Invitrogen) and BIO-RAD IQTM5 Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA 94547, USA) Primers specific for SmNR1 (forward: 5¢-AAAAACATCCCCCATTTCAGAA-3¢, reverse: 5¢-AACTACGCACATTCGGGTTGA-3¢) were designed by Primer Express Program TM (Applied Biosystems ) and primers specific for S mansoni a-tubulin (GenBank M80214) were designed according to [54] The efficiency for each primer set is evaluated and FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS W Wu et al S mansoni NR1 recorded during assay development by iQ5 application (cDNA is diluted to ·1-, ·10-, ·100- and ·1000-fold; see protocol of Bio-Rad iQ5 application) Normalized gene expression [23] of SmNR1 was calculated and standardized to the relative quantities of S mansoni a-tubulin using BioRad IQTM5 Optical System software v1.1 with the Normalized Expression calculations implemented in iQ5 according to the manufacturer’s protocol For graphical representation of fold of expression, the normalized expression was recalculated by dividing the expression level of each stage by the lowest expression level by iQ5 performed using Frozen-EZ transformation II kit (Zymo Research) Yeast from single transformations of DNA binding domain constructs were spread on SD ⁄ –Trp medium and SD ⁄ –Trp ⁄ –His medium plus mm 3-AT Yeasts from single transformations of activation domain constructs were spread on SD ⁄ –Leu medium and SD ⁄ –Leu ⁄ –His medium plus mm 3-AT All cotransformed yeasts were plated on SD ⁄ –Trp ⁄ –Leu medium and SD medium lacking tryptophan, leucine, histidine HCl monohydrate and adenine hemisulfate salt (SD ⁄ –Trp ⁄ –His ⁄ –Leu ⁄ –Ade) medium plus mm 3-AT Yeast one-hybrid assay GST pull-down assay cDNA encoding full-length, C-F domain (Cys267-Phe715) and A ⁄ B domain (Met1-Met266) of SmNR1 were inserted into the DNA binding domain vector pGBK-T7 to form pGBK-SmNR1, pGBK-SmNR1(CF) and pGBKSmNR1(A ⁄ B), respectively Yeast strain AH109 (with LacZ ⁄ His reporter genes) was transformed with lg of pGBK-SmNR1, pGBK-SmNR1(CF) and pGBKSmNR1(A ⁄ B), respectively, spread on SD medium lacking tryptophan (SD ⁄ –Trp) and SD medium lacking tryptophan and histidine (SD ⁄ –Trp ⁄ –His) plus mm 3-amino-1,2,4triazole (3-AT, an inhibitor to prevent the leaky expression of HIS3 gene in host cell), and then incubated at 30 °C Transformations were performed using Frozen-EZ transformation II kit (Zymo Research, Orange, CA, USA) The colonies from SD ⁄ –Leu medium were streaked on SD ⁄ –Trp ⁄ –His medium plus mm 3-AT to confirm the result Yeasts transformed with p53, pLamin C, pSV40, pLaminc C ⁄ pSV40 and p53 ⁄ pSV40 (Stratagene, La Jolla, CA, USA) were used as positive or negative controls, respectively cDNA encoding SmRXR1 was inserted into pCITE-4a vector to form pCITE-SmRXR1 cDNA inserts were transcribed and translated using Single Tube Protein System (Novagen, Madison, WI, USA) The manufacturer’s protocol for 35S-methionine incorporation was followed cDNA encoding full-length and the E-F domain (Leu433Phe715) of SmNR1 were inserted into pGEX-4T-1 vector to form pGEX-SmNR1 and pGEX-SmNR1(EF) Escherichia coli ad 494 (DE3) pLys S competent cells (Novagen) were transformed with pGEX-SmNR1 and pGEXSmNR1(EF), respectively, and induced with isopropyl thio-b-d-galactoside to produce GST fusion proteins that were subsequently affinity purified over a glutathione-sepharose column all by standard techniques For pull-down assays, 50 lL of binding mixture containing binding buffer (50 mm Tris ⁄ HCl, pH 7.5, 100 mm NaCl, 10% glycerol, 0.15% Nonidet P40), GST-SmNR1 or GST-SmNR1(EF) fusion protein affixed to glutathione-sepharose beads (about lg) and lL of in vitro translation reaction was used The reaction was incubated overnight at °C and washed three times with binding buffer [56] The bound proteins were analyzed by running on 10% SDS ⁄ PAGE and autoradiography Yeast two-hybrid assay cDNA encoding SmNR1 was inserted into the activation domain vector pGAD-T7 to form pGAD-SmNR1 pGBKSmNR1(CF) was the same as for the yeast one-hybrid analysis cDNA encoding full-length and the C-F domain of SmRXR1 (GenBank AF094759) and SmRXR2 (GenBank AF129816) were previously ligated into activation domain vector pACT2 to form pACT-SmRXR1 and pACTSmRXR2, and ligated into DNA binding domain vector pAS2 to form pAS-SmRXR1(CF) and pAS-SmRXR2 previously [7,9,10,55] Yeast strain AH109 was transformed with lg of the following plasmids: pAS-SmRXR1(CF), pAS-SmRXR2, pGBK-SmNR1(CF), pACT-SmRXR1, pACT-SmRXR2, pGAD-SmNR1, and control plasmids pLamin C, pSV40 and p53 The following cotransformations were performed: pGBK-SmNR1(CF) ⁄ pACTSmRXR1, pGAD-SmNR1 ⁄ pAS-SmRXR1(CF), pGBKSmNR1(CF) ⁄ pACT-SmRXR2, pGAD-SmNR1 ⁄ pASSmRXR2, pGBK-SmNR1(CF) ⁄ pGAD-SmNR1, pSV40 ⁄ p53 and pSV40 ⁄ pLamin C Transformations were Electrphoretic mobility shift assay cDNAs encoding SmNR1, SmNR1(CF) (Cys267-Phe715), SmNR1(Ile247-Ser372) (containing 20 amino acids at the 5¢ end of DBD, DBD and 40 amino acids at the 3¢ end of DBD), SmRXR1 and SmRXR1(Glu251-Asn376) (containing 20 amino acids at the 5¢ end of DBD, DBD and 40 amino acids at the 3¢ end of DBD) were inserted into pCITE-4a vector to form pCITE-SmNR1, pCITESmNR1(CF), pCITE-SmNR1(Ile247-Ser372), pCITESmRXR1 and pCITE-SmRXR1(Glu251-Asn376) The proteins were produced in vitro using the TNT quick coupled transcription ⁄ translation system (Promega) The following complementary single-stranded oligonucleotides containing consensus half-sites AGGTCA [40,57,58] were synthesized: half-site: 5¢-GTACCGTAAGGTCACTCGC GT-3¢, DR0: 5¢-CCGTAAGGTCAAGGTCACTCG-3¢, FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS 401 S mansoni NR1 W Wu et al DR1: 5¢-CCGTAAGGTCACAGGTCACTCG-3¢, DR2: 5¢-CCGTAAGGTCACAAGGTCACTCG-3¢, DR3: 5¢-CCG TAAGGTCACAGAGGTCACTCG-3¢, DR4: 5¢-CCGTAA GGTCACAGGAGGTCACTCG-3¢, DR5: 5¢-CCGTAAGG TCACCAGGAGGTCACTCG-3¢ PAL0: 5¢-CGCAAGGT CATGACCTCG-3¢ One strand of each oligonucleotide was annealed after incubation at 100 °C for to its complementary oligonucleotide and then labeled with T4 polynucleotide kinase and [c-32P]adenosine triphosphate The binding reactions were incubated on ice for 40 in 15 lL reaction mixture containing 40 000 cpm probes, lL in vitro translation reaction, lL 5· buffer [20% glycerol, mm MgCl2, 2.5 mm EDTA, 2.5 mm dithiothreitol, 250 mm NaCl, 50 mm Tris ⁄ HCl (pH 7.5), 0.25 mg mL)1 poly(dI-dC)Ỉpoly(dI-dC)], and then separated on 6% (v ⁄ v) native polyacrylamide gel containing 2.5% glycerol in 1· TBE buffer at °C Gel was dried, exposed to X-ray film and autoradiographed Mammalian cell culture and transfection cDNAs coding SmNR1 and SmRXR1 were amplified by PCR, cloned into pENTR ⁄ SD ⁄ D-TOPO vector (Invitrogen) and transferred into pcDNA-3.1 destination vectors using Gateway LR Clonase enzyme (Invitrogen) pUTK3xDR2 was constructed by inserting oligonucleotides containing three copies of DR2 (ACGCTCACTGGAACACT GGAATGCCCAGTTCTCGTCGCTCACTGGAACACTG GAATGCCCAGTTCTCGTTCGCTCACTGGAACACTG GAATGCCTCTAG) upstream of the thymidine-kinase promoter of reporter plasmid pUTK-Luc vector, which contains a firefly luciferase encoding sequence under the control of a Herpes simplex virus thymidine-kinase promoter [59] pRL4.74 (Promega, containing a renilla luciferase reporter gene under the control of a cytomegalovirus promoter) was used as an internal control Mammalian COS-7 cells were maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% (V ⁄ V) fetal bovine serum For transfection, cells were plated at a density of 1.5 · 105 cells ⁄ per well in 24 well culture plates with Dulbecco’s modified Eagle’s medium supplemented with 10% (V ⁄ V) fetal bovine serum Transfection was done following the instruction of LipofectamineTM 2000 (Invitrogen), the mix containing lL LipofectamineTM 2000 (Invitrogen), 0.4 lg expression plasmids, 0.375 lg reporter plasmids and 0.025 lg pRL4.74 (Promega) Forty-eight hours after transfection, COS-7 cells were lysed and the luciferase activity was measured by Dual Luciferase Reporter Assay system (Promega) and VeritasTM Microplate Luminometer (9100–001, Turner BioSystems, Sunnyvale, CA, USA) Expression of the firefly luciferase was normalized by expression of Renilla luciferase Fold activation of the reporter gene was calculated by dividing the normalized firefly luciferase value of each expression plasmid by that of the control vector pcDNA-3.1 The statistical significance of increase in luciferase activities of cells transfected with SmNR1, SmRXR1 and SmNR1 ⁄ SmRXR1 402 compared to cells transfected with pcDNA-3.1 was determined using Student’s t-test (d.f ¼ 9) Acknowledgements The authors thank R Pierce, Institut Pasteur de Lille for valuable suggestions This research was supported by NIH grant AI046762 Schistosome infected snails were obtained from Fred Lewis (Biomedical Research Institute), through NIH supply contract no AI30026 Genomic DNA sequence (Contig_0012771) was produced by Schistosoma mansoni Genome Project at the Sanger Institute and can be obtained from ftp://ftp.sanger ac.uk/pub/databases/Trematode/S.mansoni/genome References Gronemeyer H & Laudet V (1995) Transcription factors 3: nuclear receptors Protein Profile 2, 1173–1308 Laudet V & Gronemeyer H (2001) The Nuclear Receptor Factsbook Academic Press, New York, NY Berrodin TJ, Marks MS, Ozato K, Linney E & Lazar MA (1992) Heterodimerization among thyroid hormone receptor, retinoic acid receptor, retinoid X receptor, chicken ovalbumin upstream promoter transcription factor, and an endogenous liver protein Mol Endocrinol 6, 1468–1478 Leid M, Kastner P, Lyons R, Nakshatri H, Saunders M, Zacharewski T, Chen JY, Staub A, Garnier JM, Mader S et al (1992) Purification, cloning, and RXR identity of the HeLa cell factor with which RAR or TR heterodimerizes to bind target sequences efficiently Cell 68, 377–395 Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P et al (1995) The nuclear receptor superfamily: the second decade Cell 83, 835–839 Zhang XK, Hoffmann B, Tran PB, Graupner G & Pfahl M (1992) Retinoid X receptor is an auxiliary protein for thyroid hormone and retinoic acid receptors Nature 355, 441–446 Freebern WJ, Osman A, Niles EG, Christen L & LoVerde PT (1999) Identification of a cDNA encoding a retinoid X receptor homologue from Schistosoma mansoni Evidence for a role in female-specific gene expression J Biol Chem 274, 4577–4585 de Mendonca RL, Escriva H, Bouton D, Zelus D, Vanacker JM, Bonnelye E, Cornette J, Pierce RJ & Laudet V (2000) Structural and functional divergence of a nuclear receptor of the RXR family from the trematode parasite Schistosoma mansoni Eur J Biochem 267, 3208–3219 Freebern WJ, Niles EG & LoVerde PT (1999) RXR-2, a member of the retinoid x receptor family in Schistosoma mansoni Gene 233, 33–38 FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS W Wu et al 10 Fantappie MR, Freebern WJ, Osman A, LaDuca J, Niles EG & LoVerde PT (2001) Evaluation of Schistosoma mansoni retinoid X receptor (SmRXR1 and SmRXR2) activity and tissue distribution Mol Biochem Parasitol 115, 87–99 11 de Mendonca RL, Bouton D, Bertin B, Escriva H, Noel C, Vanacker JM, Cornette J, Laudet V & Pierce RJ (2002) A functionally conserved member of the FTZ-F1 nuclear receptor family from Schistosoma mansoni Eur J Biochem 269, 5700–5711 12 Hu R, Wu W, Niles EG & LoVerde PT (2006) SmTR2 ⁄ 4, a Schistosoma mansoni homologue of TR2 ⁄ TR4 orphan nuclear receptor Int J Parasitol 36, 1113–1122 13 Hu R, Wu W, Niles EG & LoVerde PT (2006) Isolation and characterization of Schistosoma mansoni constitutive androstane receptor Mol Biochem Parasitol 148, 31–43 14 Lu C, Wu W, Niles EG & LoVerde PT (2006) Identification and characterization of a novel fushi tarazu factor (FTZ-F1) nuclear receptor in Schistosoma mansoni Mol Biochem Parasitol 150, 25–36 15 Wang LH, Tsai SY, Cook RG, Beattie WG, Tsai MJ & O’Malley BW (1989) COUP transcription factor is a member of the steroid receptor superfamily Nature 340, 163–166 16 Wurtz JM, Bourguet W, Renaud JP, Vivat V, Chambon P, Moras D & Gronemeyer H (1996) A canonical structure for the ligand-binding domain of nuclear receptors Nat Struct Biol 3, 206 17 Zhang Z, Burch PE, Cooney AJ, Lanz RB, Pereira FA, Wu J, Gibbs RA, Weinstock G & Wheeler DA (2004) Genomic analysis of the nuclear receptor family: new insights into structure, regulation, and evolution from the rat genome Genome Res 14, 580–590 18 Vivat-Hannah V, Bourguet W, Gottardis M & Gronemeyer H (2003) Separation of retinoid X receptor homo- and heterodimerization functions Mol Cell Biol 23, 7678–7688 19 Perissi V, Staszewski LM, McInerney EM, Kurokawa R, Krones A, Rose DW, Lambert MH, Milburn MV, Glass CK & Rosenfeld MG (1999) Molecular determinants of nuclear receptor–corepressor interaction Genes Dev 13, 3198–3208 20 Nagy L, Kao HY, Love JD, Li C, Banayo E, Gooch JT, Krishna V, Chatterjee K, Evans RM & Schwabe JW (1999) Mechanism of corepressor binding and release from nuclear hormone receptors Genes Dev 13, 3209–3216 21 Le Paslier MC, Pierce RJ, Merlin F, Hirai H, Wu W, Williams DL, Johnston D, LoVerde PT & Le Paslier D (2000) Construction and characterization of a Schistosoma mansoni bacterial artificial chromosome library Genomics 65, 87–94 22 Wu W, Niles EG, El-Sayed N, Berriman M & LoVerde PT (2006) Schistosoma mansoni (Platyhelminthes, S mansoni NR1 23 24 25 26 27 28 29 30 31 32 33 34 Trematoda) nuclear receptors: sixteen new members and a novel subfamily Gene 366, 303–315 Livak K & Schmittgen T (2001) Analysis of relative gene expression data using real-time quantitative PCR and the (-Delta Delta C(T)) Method Methods 25, 402–408 IJpenberg A, Jeannin E, Wahli W & Desvergne B (1997) Polarity and specific sequence requirements of peroxisome proliferator-activated receptor (PPAR) ⁄ retinoid X receptor heterodimer binding to DNA A functional analysis of the malic enzyme gene PPAR response element J Biol Chem 272, 20108–20117 Predki PF, Zamble D, Sarkar B & Giguere V (1994) Ordered binding of retinoic acid and retinoid-X receptors to asymmetric response elements involves determinants adjacent to the DNA-binding domain Mol Endocrinol 8, 31–39 Wilson TE, Paulsen RE, Padgett KA & Milbrandt J (1992) Participation of non-zinc finger residues in DNA binding by two nuclear orphan receptors Science 256, 107–110 Andersson ML, Nordstrom K, Demczuk S, Harbers M & Vennstrom B (1992) Thyroid hormone alters the DNA binding properties of chicken thyroid hormone receptors alpha and beta Nucleic Acids Res 20, 4803–4810 Antoniewski C, Mugat B, Delbac F & Lepesant JA (1996) Direct repeats bind the EcR ⁄ USP receptor and mediate ecdysteroid responses in Drosophila melanogaster Mol Cell Biol 16, 2977–2986 Desvergne B (1994) How thyroid hormone receptors bind to structurally diverse response elements? Mol Cell Endocrinol 100, 125–131 Schaefer F, Yoon SA, Nouri P, Tsao T, Tummala P, Deng E & Rabkin R (2004) Growth hormone-mediated janus associated kinase-signal transducers and activators of transcription signaling in the growth hormone-resistant potassium-deficient rat J Am Soc Nephrol 15, 2299–2306 Schrader M & Carlberg C (1994) Thyroid hormone and retinoic acid receptors form heterodimers with retinoid X receptors on direct repeats, palindromes, and inverted palindromes DNA Cell Biol 13, 333–341 Kostrouch Z, Kostrouchova M, Love W, Jannini E, Piatigorsky J & Rall JE (1998) Retinoic acid X receptor in the diploblast, Tripedalia cystophora Proc Natl Acad Sci USA 95, 13442–13447 Bouton D, Escriva H, de Mendonca RL, Glineur C, Bertin B, Noel C, Robinson-Rechavi M, de Groot A, Cornette J, Laudet V et al (2005) A conserved retinoid X receptor (RXR) from the mollusk Biomphalaria glabrata transactivates transcription in the presence of retinoids J Mol Endocrinol 34, 567–582 Shea C, Hough D, Xiao J, Tzertzinis G & Maina CV (2004) An rxr ⁄ usp homolog from the parasitic nematode, Dirofilaria immitis Gene 324, 171–182 FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS 403 S mansoni NR1 W Wu et al 35 Oro AE, McKeown M & Evans RM (1990) Relationship between the product of the Drosophila ultraspiracle locus and the vertebrate retinoid X receptor Nature 347, 298–301 36 Guo X, Xu Q, Harmon MA, Jin X, Laudet V, Mangelsdorf DJ & Palmer MJ (1998) Isolation of two functional retinoid X receptor subtypes from the Ixodid tick, Amblyomma americanum (L.) Mol Cell Endocrinol 139, 45–60 37 Chambon P, Mader S, Garnier J-M, Staub A, Chen J-Y, Zacharewsi T, Saunders M, Nakshatri H, Lyons R, Kastner P et al (1992) Purification, cloning, and RXR identity of the HeLa cell factor with which RAR or TR heterodimerizes to bind target sequences efficiently Cell 71, 887 38 Mangelsdorf DJ, Ong ES, Dyck JA & Evans RM (1990) Nuclear receptor that identifies a novel retinoic acid response pathway Nature 345, 224–229 39 Shulemovich K, Dimaculangan DD, Katz D & Lazar MA (1995) DNA bending by thyroid hormone receptor: influence of half-site spacing and RXR Nucleic Acids Res 23, 811–818 40 Umesono K, Murakami KK, Thompson CC & Evans RM (1991) Direct repeats as selective response elements for the thyroid hormone, retinoic acid, and vitamin D3 receptors Cell 65, 1255–1266 41 Shaffer PL & Gewirth DT (2004) Vitamin D receptor– DNA interactions Vitam Horm 68, 257–273 42 Cherbas L, Lee K & Cherbas P (1991) Identification of ecdysone response elements by analysis of the Drosophila Eip28 ⁄ 29 gene Genes Dev 5, 120–131 43 Bertin B, Caby S, Oger F, Sasorith S, Wurtz JM & Pierce RJ (2005) The monomeric orphan nuclear receptor Schistosoma mansoni Ftz-F1 dimerizes specifically and functionally with the schistosome RXR homologue, SmRXR1 Biochem Biophys Res Commun 327, 1072– 1082 44 Hadzic E, Habeos I, Raaka BM & Samuels HH (1998) A novel multifunctional motif in the amino-terminal A ⁄ B domain of T3Ralpha modulates DNA binding and receptor dimerization J Biol Chem 273, 10270– 10278 45 de Moraes Maciel R, de Silva Dutra DL, Rumjanek FD, Juliano L, Juliano MA & Fantappie MR (2004) Schistosoma mansoni histone acetyltransferase GCN5: linking histone acetylation to gene activation Mol Biochem Parasitol 133, 131–135 46 Mansure JJ, Furtado DR, de Oliveira FM, Rumjanek FD, Franco GR & Fantappie MR (2005) Cloning of a protein arginine methyltransferase PRMT1 homologue from Schistosoma mansoni: evidence for roles in nuclear receptor signaling and RNA metabolism Biochem Biophys Res Commun 335, 1163–1172 47 Bertin B, Oger F, Cornette J, Caby S, Noel C, Capron M, Fantappie MR, Rumjanek FD & Pierce RJ (2006) 404 48 49 50 51 52 53 54 55 56 57 58 59 60 Schistosoma mansoni CBP ⁄ p300 has a conserved domain structure and interacts functionally with the nuclear receptor SmFtz-F1 Mol Biochem Parasitol 146, 180–191 Jones DT, Taylor WR & Thornton JM (1992) The rapid generation of mutation data matrices from protein sequences Comput Appl Biosci 8, 275–282 Guindon S & Gascuel O (2003) A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood Syst Biol 52, 696–704 Huelsenbeck JP & Ronquist F (2001) mrbayes: Bayesian inference of phylogenetic trees Bioinformatics 17, 754–755 Saitou N & Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees Mol Biol Evol 4, 406–425 Hirai H & LoVerde PT (1995) FISH techniques for constructing physical maps on schistosome chromosomes Parasitol Today 11, 310–314 Hirai H & Hirai Y (2004) FISH mapping for helminth genome Methods Mol Biol 270, 379–394 Oger F, Bertin B, Caby S, Dalia-Cornette J, Adams M, Vicogne J, Capron M & Pierce RJ (2006) Molecular cloning and characterization of Schistosoma mansoni Ftz-F1 interacting protein-1 (SmFIP-1), a novel corepressor of the nuclear receptor SmFtz-F1 Mol Biochem Parasitol 148, 10–23 Fantappie MR, Osman A, Ericsson C, Niles EG & LoVerde PT (2003) Cloning of Schistosoma mansoni Seven in Absentia (SmSINA) (+) homologue cDNA, a gene involved in ubiquitination of SmRXR1 and SmRXR2 Mol Biochem Parasitol 131, 45–54 Osman A, Niles EG & LoVerde PT (2001) Identification and characterization of a Smad2 homologue from Schistosoma mansoni, a transforming growth factor-beta signal transducer J Biol Chem 276, 10072–10082 Kliewer SA, Umesono K, Mangelsdorf DJ & Evans RM (1992) Retinoid X receptor interacts with nuclear receptors in retinoic acid, thyroid hormone and vitamin D3 signalling Nature 355, 446–449 Umesono K & Evans RM (1989) Determinants of target gene specificity for steroid ⁄ thyroid hormone receptors Cell 57, 1139–1146 Prost E & Moore DD (1986) CAT vectors for analysis of eukaryotic promoters and enhancers Gene 45, 107–111 Renaud JP, Rochel N, Ruff M, Vivat V, Chambon P, Gronemeyer H & Moras D (1995) Crystal structure of the RAR-gamma ligand-binding domain bound to all-trans retinoic acid Nature 378, 681–689 Supplementary material The following supplementary material is available online: FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS W Wu et al Table S1 Exon ⁄ intron organization of SmNR1 gene Table S2 GenBank accession numbers of the sequences used to construct phylogenetic trees Fig S1 Bayesian phylogenetic tree of SmNR1 Fig S2 Neighbor Joining distance tree of SmNR1 Fig S3 Alignment of peptide sequences of DBD and LBD (after helix 2) S mansoni NR1 This material is available as part of the online article from http://www.blackwell-synergy.com Please note: Blackwell Publishing is not responsible for the content or functionality of any supplementary materials supplied by the authors Any queries (other than missing material) should be directed to the corresponding author for the article FEBS Journal 274 (2007) 390–405 ª 2006 The Authors Journal compilation ª 2006 FEBS 405 ... mansoni NR1 A B W Wu et al DNA binding domain Ligand binding domain Fig Sequence alignment (A) Alignment of DNA binding domain (C domain) and its C-terminal extension (B) Alignment of ligand binding... assay in in vivo results Experimental procedures Parasites The NMRI strain of S mansoni was maintained in snails (Biomphalaria glabrata) and Syrian golden hamsters (Mesocricetus auratus) Cercariae... conserved, the P-box (EGCKG), which is involved in determining DNA binding specificity, is identical to most members of nuclear receptor subfamily I, for instance retinoic acid receptor (RAR) and vitamin