Báo cáo Y học: Purification and catalytic properties of a CO-oxidizing:H2-evolving enzyme complex from Carboxydothermus hydrogenoformans doc
Báo cáo Y học: Purification and catalytic properties of a CO-oxidizing:H2-evolving enzyme complex from Carboxydothermus hydrogenoformans doc
... the purification and catalytic proper-ties of a membrane-bound enzyme complex from C. hydro-genoformans composed of a hydrogenase and a COdehydrogenases. The complex catalyzes the conversion of CO ... Fe-containing catalytic subunit of CO dehydrogenase. A catalytically active CooSIdimer has been previously purified and characterized from C. hydrogenoformans [25]. The 89- and 62-kDa polypeptideswere ... 5717compared to the hydrogenase subunits. A densitometricanalysis revealed a molar ratio of CooS to CooH, the catalytic subunit of the hydrogenase, of 2.1 ± 0.1 : 1 and a molar ratio of CooF to...
- 10
- 376
- 0
Báo cáo Y học: Purification and biochemical characterization of some of the properties of recombinant human kynureninase pptx
... 4). This is a major difference of human kynureninase from other mammalian enzymes, suchas rat hepatic kynureninase, and may imply that previousreports of weak activity withL-kynurenine in ... theactive site and also pave the way for co-crystallization of enzyme substrate and/ or enzyme inhibitor complexes.These should allow further mechanistic investigation of the catalytic reaction ... spec-trofluorimetrically at 37 °C, with excitation of the product3-hydroxyanthranilate at 330 nm and emission at 410 nm and 310 nm and 417 nm respectively for anthranilate, bythe method of Shetty & Gaertner...
- 6
- 406
- 1
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx
... Kuwada M, Teramoto T, Kumagaye KY, Nakajima K,Watanabe T, Kawai T, Kawakami Y, Niidome T,Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin-TK containing D-serine at position 46, but not syn-thetic ... D-amino acid in peptide link-age by an enzyme from frog skin secretions. Proc NatlAcad Sci USA 102, 4235–4239.33 Shikata Y, Watanabe T, Teramoto T, Inoue A, Kawakami Y, Nishizawa Y, Katayama ... Kubota I, Takao T, Shimonishi Y, Yasuda-Kamatani Y, Minakata H, Nomoto K,Muneoka Y & Kobayashi M (1991) Fulicin, a novelneuropeptide containing a D-amino acid residueisolated from the ganglia...
- 12
- 616
- 0
Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt
... ATCCTCACGAACAAGCAG5RACR GATCGCGATGCAGGCCTTFLF1 GGACGACTACAGCGTCTTCAGTAGAFLR1 TCCAAACAGTCAGTTTCTTAACCGTTable 1. Purification of cellulase from abalone Haliotis discus hannai. Oneunitofcellulasewasdefinedastheamountofenzymethatliberatesreducing ... RTARAAYTGNCCNGCRTCYTGLP6 WAVEQMNYILGDNK R2 CATYTGYTCNACNGCCCAYTTLP7 AWAWALGWDDKLP8 GYHENALP9 WPLDYFLF2 GCCACACTTCTGTCAACATCC3RAC TTCTTCAAGGGCTGGCTCCCT3AP CTGATCTAGAGGTACCGGATCC5RACF ATCCTCACGAACAAGCAG5RACR ... (OH,USA), TOYOPEARL CM-650Mwas fromToyo Soda Mfg,Co. (Tokyo, Japan), Sephacryl S-200 HR was from Amer-sham Pharmacia Biotech AAB (NJ, USA), and Hydroxy-apatite (Fast Flow Type) was from Wako...
- 8
- 511
- 0
Báo cáo khoa học: Purification and partial characterization of seven glutathione S -transferase isoforms from the clam Ruditapes decussatus pptx
... homology and ability to catalyze the conjugation of glutathione to a broad range of electrophilic substrates inanimal organisms. These classes are named alpha, mu, pi,theta, sigma, kappa, zeta and ... Purification and partial characterization of seven glutathioneS-transferase isoforms from the clamRuditapes decussatusPascal Hoarau, Ginette Garello, Mauricette Gnassia-Barelli, Miche`le ... to assign it to a GSTclass; this isoform is recognized by the three rabbitantisera (anti-alpha, anti-mu and anti-pi). It is nowaccepted that mu, alpha and pi mammalian GST classeshave a common...
- 8
- 338
- 0
Báo cáo Y học: Purification and characterization of novel kininogens from spotted wolffish and Atlantic cod pdf
... biantennary and triantennary N-glycans that are terminated by a2 ,3-linkedsialic acids, a high number of which are O-acetylated. About1/3 of the glycans carry sulfate at N-acetylglucosamine units of ... water and analysed by MALDI-TOF MS.Phosphatase treatmentDry N-glycan samples were dissolved in 50 mMammoniumbicarbonate, and 1 U of calf intestinal alkaline phosphatase(New England Biolabs, ... like papain and ficin but they had noeffect on trypsin, a serine proteinase. Wolffish kininogencarried a2 ,3-sialylated biantennary and triantennary N-gly-cans with extensive sialic acid O-acetylation....
- 8
- 428
- 0
Báo cáo Y học: Purification and characterization of three galactose specific lectins from Mulberry seeds (Morus sp.) ppt
... Purification and characterization of three galactose specific lectins from Mulberry seeds (Morussp.)Tanzima Yeasmin, Md Abul Kashem Tang, Abdur Razzaque and Nurul AbsarDepartment of Biochemistry, ... the family Moraceae, part of the genus Morus. Itis a deep rooted perennial plant, widely distributed in Asia,Europe, Africa and Latin America in a wide range of climatic conditions varying from ... nonimmunoglobulin-typecarbohydrate recognition molecules that are involved inhemagglutination, lymphocyte transformation, inactivation of certain types of tumor cells and precipitation of certainpolysaccharides...
- 6
- 475
- 0
Báo cáo Y học: Purification and characterization of VanXYC, a D,D-dipeptidase/D,D-carboxypeptidase in vancomycin-resistant Enterococcus gallinarum BM4174 docx
... polymerase(Stratagene) was used to amplify vanXYCusingpAT704astemplate with primers A (5¢-GCTAGGTCTCAATGAACACATTACAATT-3¢)andB(5¢-TATGGAATTCTCATGCGAACTGCCTCA-3¢) that included BsaIandEcoRIrestriction ... the VanC phenotype, VanXYCmust specific-ally hydrolyseD-Ala-D-Ala with minimal activity againstD-Ala-D-Ser, a very different type of specificity.VanXYC, VanX-type and VanY-type enzymes ... VanXYC.Lane1,molecular mass standards (in kDa); Lane 2, partially pure VanXYCafter gel filtration chromatography. (B) Purification of MBP-VanXYC.Lane 1, molecular mass standards; lane 2, cytoplasm containingMBP-VanXYC;Lane3,MBP–VanXYCafter...
- 7
- 414
- 0
Báo cáo Y học: Purification and properties of the extracellular lipase, LipA, of Acinetobacter sp. RAG-1 docx
... and sequence analysis of the lipase and lipase chaperone- encodinggenes from Acinetobacter calcoaceticus RAG-1, and redefinition of a proteobacterial lipase family and an analogous lipase chaperonefamily. ... sequence analysis [6].LipA demonstrates hydrolytic activity toward emulsions of both medium and long chain triacylglycerols (Fig. 3).Areas of olive oil and tricaprylin hydrolysis are clearly seen and ... here the purification and characterization of LipA and discuss its potential as a biocatalyst in synthesis reactions and in the context of related biotechnological applications.MATERIALS AND METHODSMedia...
- 9
- 459
- 0
Báo cáo Y học: Purification and characterization of two secreted purple acid phosphatase isozymes from phosphate-starved tomato (Lycopersicon esculentum) cell cultures ppt
... various divalent metal cations and EDTA on theactivity of SAP1 and SAP2. The standard assay A was used except thatthe phosphoenolpyruvate concentration was subsaturating (4 mM). Enzyme activity ... Electrophoretic patterns of CNBr cleavage fragments of SAP1 and SAP2. CNBr cleavage fragments were prepared from gel slicescontaining 3 lgofSAP1(lane1)andSAP2(lane2)andanalyzedonan SDS/14% PAGE minigel as ... respect-ively. SDS/PAGE, periodic acid-Schiff staining and analyt-ical gel filtration demonstrated that SAP1 and SAP2,respectively, exist as 84 and 57 kDa glycosylated monomers.SAP1 and SAP2 are purple...
- 9
- 534
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngBT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ