Báo cáo khoa học: Identiﬁcation and characterization of oxidized human serum albumin A slight structural change impairs its ligand-binding and antioxidant functions pptx

... 18,153–158.9 Soejima A, Matsuzawa N, Hayashi T, Kimura R,Ootsuka T, Fukuoka K, Yamada A, Nagasawa T &Era S (2004) Alteration of redox state of human serum albumin before and after hemodialysis. Blood ... slight structural change impairs its ligand-binding and antioxidant functions Asami Kawakami1,*, Kazuyuki Kubota2,*, Naoyuki Yamada2, Uno Tagami2, Kenji Takehana1,Ichiro Sonaka1, Eiichiro ... Suzuki2 and Kazuo Hirayama21 Pharmaceutical Research Laboratories, Ajinomoto Co. Inc., Kawasaki, Japan2 Institute of Life Science, Ajinomoto Co. Inc., Kawasaki, Japan Human serum albumin (HSA)...

Tài liệu Báo cáo khoa học: Identiﬁcation and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebraﬁsh, Danio rerio docx

... CCATGTCTGCAGATGGTCGAGG 5¢-RACEZf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACEZf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACEZf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC 3¢-RACEZftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCRZftbet-R1 ... CTGCTTTTCTGGGGACTTCA Initial PCRZf3¢foxp3-F1 TGAAGTCCCCAGAAAAGCAG 3¢-RACEZf3¢foxp3-F2 GTGCTTTGTGCGTGTTGAAG 3¢-RACEZf5¢foxp3-R1 TGTATGATGGAAAAGGTGGCA 5¢-RACEZf5¢foxp3-R2 GGAACACACAGAGGGGATGATA 5¢-RACEOligo ... GGAAACTTCCTGTCTCATCCAGTG 5¢-RACEZffoxp3-F1 GGAACACACAGAGGGGATGATA Initial PCRZffoxp3-R1 CTTCAACACGCACAAAGCAC Initial PCRZffoxp3-F2 TGCCACCTTTTCCATCATACA Initial PCRZffoxp3-R2 CTGCTTTTCTGGGGACTTCA...

Tài liệu Báo cáo khoa học: Identiﬁcation and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf

... transcriptional co-activator P ⁄ CAF potenti-ates TGF-beta ⁄ Smad signaling. Nucleic Acids Res 28,4291–4298.39 Kahata K, Hayashi M, Asaka M, Hellman U,Kitagawa H, Yanagisawa J, Kato S, Imamura ... DeMarco R, Martins EA,Guimaraes PE, Ojopi EP, Paquola AC, Piazza JP,Nishiyama MY Jr, Kitajima JP, Adamson RE et al.(2003) Transcriptome analysis of the acoelomate human parasite Schistosoma ... day and 35 day para-sites, adult worm pairs, separated adult female and male worms, and eggs. cDNA from uninfected B. glabrata snails served as a neg-ative control.J. M. Carlo et al. SmSmad1B,...

Báo cáo khoa học: Identiﬁcation and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

... DR2:5¢-CCGTAAGGTCACAAGGTCACTCG-3¢,DR3:5¢-CCGTAAGGTCACAGAGGTCACTCG-3¢, DR4: 5¢-CCGTAAGGTCACAGGAGGTCACTCG-3¢, DR5: 5¢-CCGTAAGGTCACCAGGAGGTCACTCG-3¢. PAL0: 5¢-CGCAAGGTCATGACCTCG-3¢. One strand of each oligonucleotide ... bp wasproduced by PCR ampliﬁcation with TOPO 2.1-SmNR1 as a template (forward primer: 5¢-ATTTCAGAAGTTGAACAAACACAC-3¢, reverse primer: 5¢-AAGATGGTATTGAAGATGATGGTTGA-3¢), puriﬁed from agarose ... Extraction kit (Qiagen, Valencia, CA, USA) and randomly labeled with32P using a Metaprime kit (Amer-sham Pharmacia Biotech Inc., Piscataway, NJ, USA). ForBAC DNA sequencing, the BAC clone was...

Báo cáo khoa học: Identiﬁcation and characterization of 1-Cys peroxiredoxin from Sulfolobus solfataricus and its involvement in the response to oxidative stress pdf

... 25–29.12 Kawakami R, Sakuraba H, Kamohara S, Goda S,Kawarabayasi Y & Ohshima T (2004) Oxidative stressresponse in an anaerobic hyperthermophilic archaeon:presence of a functional peroxiredoxin ... G &Rhee SG (1994) Cloning and sequencing of thiol-specific antioxidant from mammalian brain: alkyl hydroperoxidereductase and thiol-specific antioxidant define a largefamily of antioxidant ... phenomena such asultraviolet irradiation of water, autoxidations and aeration turbulence. Consequently, to survive in thisharsh habitat S. solfataricus should have developed antioxidant enzymes and...

Báo cáo khoa học: Identiﬁcation and characterization of B¢¢-subunits of protein phosphatase 2 A in Xenopus laevis oocytes and adult tissues Evidence for an independent N-terminal splice variant of PR130 and an extended human PR48 protein pot

... tttcagACCCTA8 157 ACCAGGgtaagt 5461 atttagCTTCAT9 49 AACAAGgtaaga 2646 ctttagGGGAAA10 90 TACCAGgtatga 11341 atctagCATTGA11 177 TTGATGgtgaga 1075 atgtagGCAAAA12 119 CAGAAGgtaaca 2839 aatcagGATGTT13 ... the primers5¢-GTTCCTGAGCAAAGTCTTCAATG-3¢ and 5¢-GGAATTCAGTGGAAAAACTTTACAT-3¢ for XN73, and the primers 5¢-GGAATTCATGCCGACCACAACCGTTTTAAG-3¢ and 5¢-GGAGACAGTGACAAGTTATCTAGTGCT-3¢ for XPR70. ... ACACAGgtttga 3629 ttttagATTCAA3 267 GCAAAGgtaatg 13760 ttgcagGTCTGT4 104 GAGAAAgtaagt 8296 ttatagGTTGCT5 103 CTTCAGgtaatt 185761 tttcagGATGTG6 75 ACCACGgtaggc 7814 aaccagGTTATT7 87 TTGCAAgtatgc...

Báo cáo khoa học: Identiﬁcation and characterization of plasma kallikrein–kinin system inhibitors from salivary glands of the blood-sucking insect Triatoma infestans pptx

... Morita A, Isawa H, Orito Y, Iwanaga S, Chinzei Y &Yuda M (2006) Identification and characterization of a collagen-induced platelet aggregation inhibitor, triplatin,from salivary glands of ... Sun J, Yamaguchi M, Yuda M, Miura K, Takeya H,Hirai M, Matsuoka H, Ando K, Watanabe T, Suzuki Ket al. (1996) Purification, characterization and cDNAcloning of a novel anticoagulant of the intrinsic ... the same human liver cDNA library with primers DK3 (5¢-GCAGCAGTCATGACTGTAAGTCCACCCCACACTTCC-3¢) and modi-fied DK4 (5¢-GCAGCAGGATCCTCAACTGTCTTCAGAAGAGCTTGC-3¢), as described by Herwald et al....

Báo cáo khoa học: Identiﬁcation and functional characterization of a novel barnacle cement protein pptx

... TSVSAGDGAFGNLAAALTLVEDTEDGLGVKTKNGGKGFSEGTAAISQTAGANGGATVKKABacp19k VSASAANGFFKNLGKATTEVKTTKDGTKVKTKTAGKGKTGGTATTIQIADANGGVSEKSLBicp19k AAAAAGNGVFKNLVTALTNISTTDDITKVQTQTIGSGGTGGAATILQLADANGGAALKEV130 ... Mountain View, CA, USA), and poly (A) +RNAwas isolated using Oligo(dT)-Latex Super (Takara ShuzoCo.). cDNA was prepared from mRNA with a Zap-cDNAsynthesis kit (Stratagene, La Jolla, CA, USA) according ... proteinsduring the assembly of the head of bacteriophage T4.Nature 227, 680–685.38 Enami I, Murayama H, Ohta H, Kamo M, Nakazato K& Shen J-R (1995) Isolation and characterization of a photosystem...

Báo cáo khóa học: Identiﬁcation of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx

... Watanabe,S.,Muramatsu,T.,Ao,H.,Hirayama,Y.,Takahashi,K., Tanokura, M. & Kuchino, Y. (1999) Molecular cloning of theLonproteasegenefromThermus thermophilus HB8 and char-acterization of its ... 811–819.28. Lanzetta, P .A. , Alvarez, L.J., Reinach, P.S. & Candia, O .A. (1979)An improved assay for nanomole amounts of inorganic phos-phate. Anal. Biochem. 100, 95–97.29. Farahbakhsh, Z.T., Huang, ... werepurchased from Sigma.DNA manipulation and sequence analysisPlasmid DNA preparation, puriﬁcation of DNA fromagarose gel, and restriction enzyme analysis were performedby the standard methods...

Báo cáo khoa học: Identiﬁcation and characterization of four novel peptide motifs that recognize distinct regions of the transcription factor CP2 doc

... (5¢-GAAACCATTTTGCAGCGAAAGTATACAC-3¢) forPro ⁄ Arg to Ala ⁄ Ala mutations in bases 803–830. The twooverlapping PCR fragments were mixed and added as a template in the second PCR that used 1–19 and ... Sugihara TM, Wang N, Lasso RJ,Gudnason JF, Lipkin SM & Andersen B (2003) Identiﬁ-cation and characterization of Grainyhead-like epithelialtransactivator (GET-1), a novel mammalian Grainy-head-like ... identiﬁcation and char-acterization of human Sister -of- Mammalian Grainyhead(SOM) expands the grainyhead-like family of develop-mental transcription factors. Biochem J 370, 953–962.13 Kudryavtseva EI,...

Xem thêm

Từ khóa: báo cáo khoa học mẫu báo cáo khoa học y học báo cáo khoa học sinh học báo cáo khoa học nông nghiệp báo cáo khoa học lâm nghiệp báo cáo khoa học thủy sản Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Thơ nôm tứ tuyệt trào phúng hồ xuân hương Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ