4 5 cre regulated recombination in a 24 hpt and b 7 dpf larval fish muscle cells arrows show the secondary colors β actin dtomato red β actin yfp yellow and β actin mcerulean blue scale bar 100 µm
... Gene CACATCCTCGCCTTCAA TCTCGAACTCTTCCATCATCT GTTCCATCGTTCACCAAGTG TTGCAGAAATGTGCTGAATG hcp1 rpoB 2.1.2 List of plasmids and < /b> bacterial strains Table 3: List of plasmids and < /b> strains Relevant characteristic(s )a < /b> ... and < /b> outbreak cases in < /b> new geographical regions, such as south and < /b> east Asia as well as parts of South America, Papua New Guinea, the Caribbean and < /b> Africa were reported 8, 17 21 There is also an ... in < /b> other bacteria Hcp has the ability to adhere to the surface of mammalian cells, and < /b> the functional consequence of this binding had been investigated in < /b> A < /b> hydrophila106 and < /b> meningitis-causing...
... reagent [1% sulfanilamide (Alfa Aesar)/0.1% N-(1-napthyl) ethylenediamine (International Laboratory USA) – each in < /b> 2 .5%< /b> H3PO4] in < /b> a < /b> 96-well plate at room temperature for 10 min, and < /b> the absorbance ... amplification by PCR, the forward primer for MIP- 1a < /b> was CTCCCAGCCAGGTGTCATT, and < /b> the reverse primer was GGCATTCAGTTCCAGGTCAG The forward primer for b- actin was CCGTGAAAAGATGACCCAG, and < /b> the reverse ... Sample absorbance was Page of measured with a < /b> Multiscan plate reader (Genios, Tencan) at a < /b> wavelength of 450< /b> nm The sample concentration was measured using a < /b> standard curve Real-time quantitative...
... (Fig 5B) was also significantly increased by incubation of thecells with AA-treated and < /b> untreated quartz, at all particle Fig NF-jB, pCREB and < /b> AP-1 nuclear translocation in < /b> quartz-treated RAW 264 .7 ... and < /b> multicomparison analysis NF-jB, pCREB and < /b> AP-1 nuclear translocation in < /b> RAW 264 .7 cells (Fig 5)< /b> In < /b> Fig 5A,< /b> B, data were checked with the F-test and < /b> analysed with analysis of variance and < /b> the ... concentrations of 15,< /b> 50< /b> and < /b> 100 lgÆmL)1, induced COX-2 synthesis in < /b> RAW 264 .7 cells (Fig 1A,< /b> black bars) as well as AA-treated quartz (Fig 1A,< /b> striped bars) The statistical analysis of variance showed...
... cellsand < /b> treated with DNaseI before testing in < /b> the ELISA The addition of the COS -7 supernatant appears to have reinstated the binding of B3 VH /B3 3VL to dsDNA and < /b> also allows the binding of B3 VH /B3 VL ... Guth and < /b> colleagues [12] showed that arginine-to-serine mutations in < /b> VHCDR3 of SN5-18 ablate binding to chromatin The single arginine-to-serine mutation in < /b> B3 (R27aS)VL did not ablate binding to ... serine (R27aS) in < /b> B3 Vλ CDR1 resulted in < /b> a < /b> significant reduction in < /b> dsDNA binding, indicating the importance of this arginine at the binding site [ 15,< /b> 23] When an extra arginine was introduced into...
... neutropenia, and < /b> leukopenia in < /b> the other); patients in < /b> the 300-mg SC group (pancreatitis in < /b> one; and < /b> pneumonia and < /b> supraventricular tachycardia in < /b> the other); and < /b> patients in < /b> the placebo SC group (arthropod ... (arthropod bite and < /b> Staphylococcus infection in < /b> one; abdominal pain in < /b> the second; and < /b> coronary artery disease in < /b> the third) All serious infectious AEs have been listed as SAEs above and < /b> include: patient ... group, AMG 108 (100 mg/mL) or placebo was administered as two 1 .5-< /b> mL SC injections at approximately the same time of day and < /b> at least centimeters apart on the anterior abdominal wall Efficacy analyses...
... test data are also included in < /b> the training set and < /b> the model-reduction procedure is repeated Additional details are provided in < /b> Additional data file Matlab code and < /b> the data can be obtained upon ... of the input data and < /b> the standard deviation of the population of output data The procedure is given below comment added In < /b> both cases, the natural logarithm was taken and < /b> data were averaged across ... 2 . 57 to 2 .53< /b> on the training data and < /b> from 2.88 to 2.49 on the test data) MIP-1α data are characterized by a < /b> high variance and < /b> data can simply be difficult to fit because of imprecision in < /b> the...
... absorbance at 242< /b> nm increased upon mixing Yb3+ with apo-Tf and < /b> the rise was more rapid with increasing the molar ratio of Yb3+ to apo-Tf (data not shown) The apparent rate constants were obtained ... visible (Fig 5B) ; Yb3+ binding to the C-lobe can thus be inferred These results suggested that Yb3+ bind to the protein and < /b> probably altered the conformation of the protein in < /b> a < /b> manner similar ... [34] Both UV and < /b> ICP-AES data suggested that two Yb3+ bind to apo-Tf in < /b> the specific iron binding site and < /b> two tyrosines are involved in < /b> binding of Yb3+ in < /b> both the N- and < /b> C-lobe as the case for...
... washed, and < /b> Ca2+ free buffer containing IgG (panel A)< /b> , the CD66ae mAb and < /b> CD6 6b mAb (panel B) , the CD66ae mAb and < /b> CD66c mAb (panel C), the CD66ae mAb and < /b> CD66de mAb (panel D), the CD6 6b mAb and < /b> ... mAb, CD6 6b mAb, and < /b> CD66c mAb (panel B) , the CD66ae mAb, CD6 6b mAb, and < /b> CD66de mAb (panel C), the CD66ae mAb, CD66c mAb, and < /b> CD66de mAb (panel D), or the CD6 6b mAb, CD66c mAb, and < /b> CD66de mAb ... example, CEACAMs 1, 5,< /b> and < /b> are often expressed in < /b> ovarian, endometrial, cervical, breast, lung, and < /b> colon carcinomas, and < /b> may be useful as biomarkers in < /b> cancer [43- 47] A < /b> CEACAM5 expressing measles...
... T cells through an in < /b> vitro BBB model HBECs were plated to the upper chamber of a < /b> Boyden chamber and < /b> then inflamed Activated CD8 (A,< /b> B) and < /b> CD4 (C, D) T cells were added to the upper chamber and < /b> ... detectable both under basal conditions and < /b> following pro-inflammatory treatments (data not shown) Human brain endothelial cells partially block T cell migration through an in < /b> vitro model of the BBB via ... demonstrated that the ligation of PD-1 blocks the b1 and < /b> b2 integrin-mediated adhesion by human T cells induced with anti-CD3 [ 35]< /b> Therefore, based on these published data and < /b> our own novel data,...
... differentiated from hES and < /b> FL derived CD34+ cells were stained with CD 1a < /b> and < /b> HLA-DR, CD 1a < /b> and < /b> B7 .1, and < /b> CD 1a < /b> and < /b> B7 .2 Results showed that hES derived DCs are positive for HLA-DR, B7 .1, and < /b> B7 .2 surface ... Antigen uptake by hES-DCs: Cultured hES and < /b> FL DCs were sorted based on CD 1a < /b> marker Thecells were then incubated with Alexa-Dextran at 0°C and < /b> 37 C for hr and < /b> analyzed by FACS as described in < /b> ... AI50492 and < /b> AI 0 57 066 to R .A < /b> We thank Joseph Anderson for suggestions, William Wheat for help with MLR and < /b> antigen uptake assays, Sarah Akkina and < /b> Jennifer Quick for help with maintaining hES cells and...
... hỏng 35 < /b> Khắc phục S a < /b> ch a < /b> Thay phớt dầu Thay gioăng S a < /b> ch a < /b> S a < /b> van dầu S a < /b> b m dầu Thay dầu Thay b c Thay b c Thay lọc dầu S a < /b> ch a < /b> van tràn 2.2.3 HỆ THỐNG LÀM MÁT: Hình 2.3 Tổng quan hệ ... 55< /b> kG 35 < /b> – 45 < /b> kG 25 < /b> – 35 < /b> kG – 120 BTDC 650< /b> ± 50< /b> vg/phút 70 0 ± 50< /b> vg/phút 15.< /b> 0 kG/cm2 10.0 kG/cm2 0. 15 < /b> – 0. 25 < /b> mm 0. 25 < /b> – 0. 35 < /b> mm B o dưỡng : Kiểm tra nước làm mát - Không có cặn b n, gỉ đọng quanh ... tra, s a < /b> ch a < /b> thay xi lanh phanh chính, xi lanh phanh b nh xe, phân phối dầu, b u cường hoá phanh, má phanh, trống phanh, đđ a < /b> phanh, lò xo, ống dẫn dầu, dây cáp phanh Kiểm tra, điều chỉnh van...
... thứ tự Cl 17 35 < /b> 53 85 < /b> 2s22p5 3s23p5 4s24p5 5s25p5 6s26p5 B n kính ngtử (Å) 0,64 0,99 1,14 1,33 1,40 N.lượng ion h a < /b> I1 17, 42 13,01 11,84 10, 45 < /b> 9 ,50< /b> Ái lực electron (eV) 3 ,58< /b> 3,81 3 ,56< /b> 3,29 - Độ ... HỢP CHẤT C A < /b> MANGAN Hợp chất Mn +7 Kali pemanaganat (KMnO4): tinh thể màu tím đen, dung dịch màu tím đỏ, độ tan biến đổi theo nhiệt độ Ngoài ra, thể tan amoniac lỏng, pyri in,< /b> rượu axeton Trên ... 34 NHÓM VIIB Mn – Tc - Re 35 < /b> ĐƠN CHẤT Mn – Tc - Re Đặc điểm Mn Tc Re 25 < /b> 43 75 < /b> 3d54s2 4d55s2 5d56s2 B n kính ngtử R (Å) 1,3 1,36 1, 37 N.lượng ion hóaI1(eV) 7, 43 7, 28 7, 79 Thế điên cực chuẩn E0 (eV)...
... be as exact as in < /b> Russell's paragraph (and < /b> usually will not be) But if you cannot outline a < /b> generally clear relationship, the paragraph is probably confused and < /b> confusing The fact that a < /b> paragraph ... way of sequencing ideas does exist Paragraph Flow Flow, those visible links which bind the sentences of a < /b> paragraph, can be established in < /b> two basic ways (They are compatible; a < /b> paragraph may ... employ both.) The first is to For more material and < /b> information, please visit www.tailieuduhoc.org 98 THE EXPOSITORY PARAGRAPH establish a < /b> master plan at the beginning of the paragraph and < /b> to introduce...
... Americans mash, n mashed potatoes Inf Occasionally, creamed potatoes in < /b> Britain A < /b> pub used to present sausages and < /b> mash in < /b> the public bar at three shillings and < /b> sausages and < /b> creamed potatoes in < /b> the ... price in < /b> an auction sale Fetch is used in < /b> the same way make a < /b> balls of Vulgar Slang See also balls, make a < /b> dead set at, Inf make a < /b> (the) four up For instance, at bridge or tennis doubles bring Inf ... form-master has about the same functions as a < /b> home-room teacher In < /b> all these uses, teacher is gaining in < /b> popularity 222 match match, n Two sides (teams) play a < /b> match, rather than a < /b> game, in < /b> Britain...
... viết giải thiết, kết luận đúng: 0 .5< /b> a)< /b> Chứng minh đợc tam giác ABC = tam giác ADE 0. 75 < /b> b) Chứng minh đợc DE//BC c) Chứng minh đợc AF=AC CFEF 0. 75 < /b> 0 .5< /b> ... Thời gian làm b i: 90 phút Câu 1: Mỗi câu trả lời đợc 0. 25< /b> câu đáp án Đ S đ s Câu 2: Mỗi ý đợc 0. 25< /b> câu a < /b> b c d đáp án a < /b> c d b Tự luận: THPT: Mỗi câu 0 .5< /b> a < /b> 20 b -36 c Tìm x: Mỗi câu 0 .5< /b> a < /b> x= ... 28 b x=9 c x= 16 x= Gọi ẩn viết đợc tỷ lệ thức: 1đ - áp dụng tính chất dãy tỉ số có kết đúng: 1đ + Lớp 7A:< /b> 35cây + Lớp 7B: 25 < /b> + Lớp 7C: 15cây Vẽ hình viết giải thiết, kết luận đúng: 0 .5< /b> a)< /b> Chứng...
... newsletters and < /b> intranets • Logo: A < /b> graphic or symbol owned by and < /b> representing a < /b> company or brand • Media Relations: communicating with the media by pro-actively speaking to journalists and < /b> sending ... they would tackle a < /b> given brief • Press Pack/Kit: a < /b> branded pack handed out to the media by an organisation It normally contains background material, photographs, illustrations and < /b> news releases ... example, you can promote a < /b> barcode printer in < /b> the printing media, packaging media and < /b> food retailing media • Viral campaign: a < /b> communications campaign which is designed to exploit the potential...
... link sau vào Windows Explorer mục Search menu Start %APPDATA%\Microsoft\Windows\SendTo Nếu b n có dropbox Favorites, phải chuột vào folder chuyển tới folder Send To Khi b n dán folder này, b n ... Trong hệ điều hành Windows XP, vào Control Panel > Folder Options > Show hidden files and < /b> folders Chuyển tới C:\Documents and < /b> Settings\[User Name]\SendTo (User Name tên máy tính b n) tạo shortcut ... folder, b n chuyển tới folder Dropbox Nếu b n có folder chia sẻ folder Dropbox, b n thêm chúng vào menu Send To với phương pháp tương tự giống ví dụ, thêm folder Dropbox chia sẻ Thêm Dropbox vào...