... bệnh), Ecoli chia thành nhóm chính: - STEC (Shiga toxin-producing E coli) VTEC (Verotoxigenic E coli) EHEC (Enterohaemorrhagic E coli) - EPEC (Enteropathogenic E coli) - ETEC (Enterotoxigenic E coli) ... coli) - EAggEC hay EAEC (Enteroaggregative E coli) - EIEC (Enteroinvasive E coli) Có ba chế chung khả gây tiêu chảy E coli: (1) Sản xuất độctố (ETEC, EAEC, STEC) (2) Tấn công / xâm lấn (EIEC) (3) ... bào ruột – locus of enterocyte effacement, LEE) Vùng LEE STEC/EHEC chứa gen mã hóa cho intimin, mã hóa receptor intimin Tir (translocated intimin receptor) số gen khác Vùng LEE không điều kiện...
... Marker ФX 174 cắt Hae III; EHEC1; EHEC2; EPEC; ETEC; EIEC; EAEC; EC 3.2.4 Gen độc lực elt M 322 bp Hình 3.4 Kết khuếch đại gen elt M Marker ФX 174 cắt Hae III; EPEC; EHEC1; EHEC2; ETEC; EAEA; EIEC; ... gen EAST1 M Marker ФX 174 cắt Hae III; EPEC; EHEC1; EHEC2;4 EIEC; ETEC, EAEC; EC Tóm tắt kết khuếch đại gen độc lực nhóm E. coli Bảng 3.1 Kết khuếch đại gen độc lực nhóm E. coli EPEC EHEC1 EHEC2 ... CÁC GEN ĐỘC LỰC CỦA CÁC NHÓM E. COLI 3.2.1 Gen độc lực eae M 872 bp 603 bp 270 bp 376 bp Hình 3.1 Kết khuếch đại gen eae M Marker ФX 174 cắt Hae III; EPEC; ETEC; EHEC1; EAEC; EHEC2; EIEC; EC 3.2.2...
... bệnh), Ecoli chia thành nhóm chính: - STEC (Shiga toxin-producing E coli) VTEC (Verotoxigenic E coli) EHEC (Enterohaemorrhagic E coli) - EPEC (Enteropathogenic E coli) - ETEC (Enterotoxigenic E coli) ... coli) - EAggEC hay EAEC (Enteroaggregative E coli) - EIEC (Enteroinvasive E coli) Có ba chế chung khả gây tiêu chảy E coli: (1) Sản xuất độctố (ETEC, EAEC, STEC) (2) Tấn công / xâm lấn (EIEC) (3) ... bào ruột – locus of enterocyte effacement, LEE) Vùng LEE STEC/EHEC chứa gen mã hóa cho intimin, mã hóa receptor intimin Tir (translocated intimin receptor) số gen khác Vùng LEE không điều kiện...
... Marker ФX 174 cắt Hae III; EHEC1; EHEC2; EPEC; ETEC; EIEC; EAEC; EC 3.2.4 Gen độc lực elt M 322 bp Hình 3.4 Kết khuếch đại gen elt M Marker ФX 174 cắt Hae III; EPEC; EHEC1; EHEC2; ETEC; EAEA; EIEC; ... gen EAST1 M Marker ФX 174 cắt Hae III; EPEC; EHEC1; EHEC2;4 EIEC; ETEC, EAEC; EC Tóm tắt kết khuếch đại gen độc lực nhóm E. coli Bảng 3.1 Kết khuếch đại gen độc lực nhóm E. coli EPEC EHEC1 EHEC2 ... CÁC GEN ĐỘC LỰC CỦA CÁC NHÓM E. COLI 3.2.1 Gen độc lực eae M 872 bp 603 bp 270 bp 376 bp Hình 3.1 Kết khuếch đại gen eae M Marker ФX 174 cắt Hae III; EPEC; ETEC; EHEC1; EAEC; EHEC2; EIEC; EC 3.2.2...
... The Ecoli strains caried diarrhegenic gens were not foud - The Ecoli strains caried the afa genes were 53.5% - The Ecoli strains carired the pap genes were 9.1% - The Ecoli strains carried ... strains carried pathogenic genes, there were: strains carried genes afa, sfa and pap strains carried genes sfa and pap strains carried genes sfa and afa No strains carried diarrhegenic gene 93 ... the sfa genes were 5.6% - The Ecoli strains isolated from bile with afa was the highest (65.5%), the from pus (54.7%), and the was from urine (42.4%) - The Ecoli strainsissolated from urine...
... gene was designed successfully The expression of plasmid pCA19 in Ecoli MGI655 was carried out by reporter gene system A reporter gene is a gene that encodes an assayable protein whose expression ... TOXIC GENE DNA EXPRESSION IN ECOLI In vivo expression technology was used to the determine Salmonella typhimurium LT2 virulence gene The result obtained that plasmid pCA 19 which contained toxic ... expression is easily detectable In this study lacZ reporter gene was used to encode for enzyme ~ - galactosidase This enzyme converts colorless substrate X - gal into galactose (colorless) and blue product...
... L.F., Yano T., Pestana de Castro A.F., Genes coding for enterotoxins and verotoxins in porcine Ecoli strains belonged to different O:K:H serotypes: relationship with toxic phenotypes, J Clin Microbiol, ... Kiuchi A & Tabuchi K., Methods for rapid cloning and detection for sequencing of cloned inverse PCR-generated DNA fragments adjacent to known sequences in bacterial chromosomes, Microbiol Immunol, ... conducted by PCR The results from 61 strains isolated showed that there were 25 isolates having the LT toxin representing 40,98%, the rate of isolates having toxin STb was 27,87% and that of isolates...
... nhóm độctố E. coli gây bệnh thường EPEC, EHEC ETEC (Levine, 1987) Dựa nhân tốđộc lực người ta chia E. coli thành nhóm khác nhau: - Enteroaggregative ( EaggEC) - Enterohemorrhagic (EHEC) - Enteroinvasive ... ngoại độctố khác gồm SEA, SEB, SEC, SED, SEG, SEH… SEO Trong đó, độctố gây ngộ độc thường gặp SEA, SEB, SEC… Các độctố có chung đặc điểm cấu trúc trình tự acid amin Mỗi loại độctố mã hoá gen ... khuẩn Kết PCR (Gen sea) S.aureus T25 [mang gen sea, seb] + S.aureus cip67.8 [mang gen sea, seb] + S.aureus cip67.7 [mang gen sea] E. coli Salmonella enteritidis Listeria monocytogens + - 38 270bp...
... L., 1996 Prevalence of the eaeA gene in verotoxigenic Escherichia coli strains from dairy cattle in Southwest Ontario Epidemiol Infect 116: - 40 45 Smith H R., and Scotland S M., 1988 Vero cytotoxin-producing ... cytotoxin of Escherichia coli Infect Immu 18: 775 - 779 32 Law D., and Kelly J., 1995 Use of heme and hemoglobin by Escherichia coli O157 and other Shiga-like-toxin-producing Ecoli serogroups Infect ... the gusA Gene That Cause the Absence of bêta-Glucuronidase Activity in Escherichia coli O157:H7 The Journal of Infectious Diseases 184: 918 - 21 38 Nataro J P and Kaper J P., 1998 Diarrheagenic...
... Kaper L P., Jerse A E. , and Wachsmuth I K., 1992 Virulence factors in Shiga-like toxin producing Escherichia coli isolated from humans and cattle J Infect Dis 165: 970 - 980 Bauer M E. , and Welch ... Gonzalez E A., Mora A., Jansen W., Gomez T A T., Zerbini L F., Yano T., de Castro A F P., and Blanco J., 1997 Note: Genes coding for enterotoxins and verotoxins in porcine Escherichia coli strains ... strains belonging to different O:K:H serotypes: relationship with phenotype J Clin Microbiol 35: 2958 - 2963 10 Botteldoorn N., Heyndrick M., Rijpens N., Herman L., 2003 Detection and characterization...
... _ TS3 _ + _ _ _ TS7 ehxA HM8 eae HM6 môi trường _ + _ _ _ 4.2 Kết phát gen độc lực Ecoli phân lập từ phân heo cai sữa tiêu chảy Kết phát gen độc lực Ecoli từ mẫu phân heo cai sữa tiêu chảy ... phân lập từ mẫu phân heo cai sữa tiêu chảy, lúc mang gen độc lực (ehxA stx1 ehxA stx2) Điều làm tăng khả gây bệnh Ecoli heo Người lứa tuổi bị nhiễm STEC với serotype khác (Beutin ctv, 1995) 27 ... ứng multiplex - PCR Kích cỡ DNA Mồi (primer) Trình tự oligonucleotide (5’3’) khuếch đại (bp) Eae – F ATTACCATCCACACAGACGGT Eae – R ACAGCGTGGTTGGATCAACCT EhxA – F GTTTATTCTGGGGCAGGCTC EhxA –R CTTCACGTCACCATACATAT...
... (USA Department of Agriculture’s Food safety and Inspection Service, 2004) Từ đó, người ta xem O157:H7 nguyên nhân phổ biến cho HC HUS Serotype có số đặc điểm khác biệt so với serotype Ecoli khác: ... dung thực - Phân lập vi khuẩn Ecoli phân bò, heo bề mặt thịt bò - Li trích DNA Ecoli phân lập - Thực phản ứng multiplex – PCR để phát gen eae, ehxA, stx1, stx2 uid Ecoli 3.3 Phương pháp thực 3.3.1 ... phát gen halothan, gen thụ thể estrogen, gen thụ thể prolactin … công tác chọn giống vật 17 nuôi, phát vi khuẩn gây ngộ độc thực phẩm : E coli, Salmonella, Staphylococcus aureus, Campylobacter,...
... Ying-Sheng Shen (2007),“Life-threatening episode after ingestion of toad eggs: a case report with literature review”, Emerg Med J ;24:215–216 Huan-Teng Chi, Dong-Zong Hung, Wei-Hsiung Hu and Dar-Yu ... Loại thứ hai: Phenethylamines dẫn xuất Bao gồm Catecholamines như: Dopamine, Norepinephrine Epinephrine Ở người gây co mạch máu thai (Lim et al, 1997) @ Loại thứ ba: Tryptamines dẫn xuất Bao ... toxicity caused by toad venom”, Chest ;102;949-950 Biff F Palmer, M.D.“ Managing Hyperkalemia Caused by Inhibitors of the Renin–Angiotensin–Aldosterone System”, N Engl J Med ;351, pp 585-92 Motilal...
... medium are the same influence for S aureus growth and ability to produce enterotoxin These S aureus strains producce SEA, SEB, SEC Among them, the rate of SEA is 80%, of SEB is 10% and of SEC ... we examine their growth and test SE by ELISA method with TECRA kit after 16, 24, 48 and 72 hours The results we find: Among 36 strains surveyed, there are ten ones having ability to produce SE ... D (SED) độctốE (SEE) Trong đó, SEC chia thành SEC1, SEC2, SEC3 Sau đó, SE với gen tương ứng tìm thấy đánh dấu từ SEG đến SER SEU (seg-ser, seu) (H.J.Jogensen, 2004) Không có độctố SEF F kí...
... medium are the same influence for S aureus growth and ability to produce enterotoxin These S aureus strains producce SEA, SEB, SEC Among them, the rate of SEA is 80%, of SEB is 10% and of SEC ... we examine their growth and test SE by ELISA method with TECRA kit after 16, 24, 48 and 72 hours The results we find: Among 36 strains surveyed, there are ten ones having ability to produce SE ... D (SED) độctốE (SEE) Trong đó, SEC chia thành SEC1, SEC2, SEC3 Sau đó, SE với gen tương ứng tìm thấy đánh dấu từ SEG đến SER SEU (seg-ser, seu) (H.J.Jogensen, 2004) Không có độctố SEF F kí...
... loại độctố phân lập vào năm 1968 - Tricothecenes chia nhỏ thành nhóm: Nhóm A Nhóm B Tricothecenes nhóm A bao gồm T-2 toxin, HT-2 toxin, neosolaniol diacetoxyscirpenol (DAS), tricothecenes nhóm ... (deoxynivalenol, DON) nivalenol 18 3.Tricothecenes • Độctố quan trọng thường hay gây độc hại DON (Vomitoxin) T2- toxin • Cấu trúc phân tử T2- toxin 19 Zearalenone (F2-toxin) F2-toxin độctố ... Thanh Tùng MỤC LỤC I Khái quát độctố nấm mốc II Điều kiện nấm mốc sản sinh độctố III Các độctố nấm mốc I Khái quát độctố nấm mốc a Định nghĩa độctố nấm mốc: - Độctố chất có nguồn gốc sinh vật,...
... E. coli Các ch ng E. coli gây ñ c ñư c chia lo i ETEC (Enterotoxigenic Escherichia coli) VTEC (Verotoxingenic Escherichia coli) , g n ñây ngư i ta th y r ng ch ng thu c nhóm AAggEC sinh ñ c t EAST1 ... Green Agar CFU: Colony Forming Unit DPF: Delayed Permeability Factor – ð c t th m xu t ch m ETEC: Enterotoxigenic Escherichia coli H: High – M n c m cao HSPs: Heat – Shock protein I: Intermediate ... b nh b Ekodiár tiêu di t bao g m : - Vi khu n: Salmonella enterica in several sero-variants, Salmonella infantis, Salmonella arizonae, E. coli, Proteus sp, Pseudomonas aeruginosa, Pasteurella multocida,...
... hay EAEC Enteroaggregative E. coli EAST1 Enteroaggregative E. coli STI-Like Toxin EHEC Enterohemorrhagic E. coli EIEC Enteroinvasive E. coli EPEC Enteropathogenic E. coli ETEC Enterotoxigenic E. coli ... Enteroinvasive E. coli (EIEC), Enterohemorrhagic E. coli (EHEC), Enteropathogenic E. coli (EPEC), Enteroaggregative E. coli (EAEC) Diffusely adherent E. coli (DAEC) Enterotoxigenic Ecoli - ETEC ETEC nguyên nhân ... ñó Enteroaggregative Ecoli - EAggEc hay EAEC Y u t ñ c l c: EAEC nhóm E. coli bám dính vào t bào HEp-2 theo ki u Aggregative adherence (AA) Nhóm EAEC g m hai dòng E. coli kh gây b nh dòng E. coli...
... qua gene cysB) tác động đến BF (khi axit ursolic) Differential Gene Expression for Investigation of Escherichia coli Biofilm Inhibition by Plant Extract Ursolic Acid Ren D, Zuo R, González Barrios ... Bedzyk LA, Eldridge GR, Pasmore ME, Wood TK Appl Environ Microbiol 2005 Jul 71(7):4022-34 Sau đánh giá nghiên cứu F1000 Factor 6.0 Eric S Gilbert Georgia State University, United States of America ... hoạt tính điều hòa hệ thống báo cáo (reporter systems) AI-1 AI-2 V harveyi Như tiên đoán nghiên cứu so sánh biểu (differential gene expression), loại bỏ gene motAB làm tác dụng kìm hãm axit ursolic...