ỨNG DỤNG KỸ THUẬT PCR TRONG VIỆC PHÁT HIỆN CÁC GEN ĐỘC LỰC CỦA E.COLI GÂY TIÊU CHẢY Ở NGƯỜI

17 646 2
  • Loading ...
1/17 trang

Thông tin tài liệu

Ngày đăng: 22/04/2013, 11:57

ỨNG DỤNG KỸ THUẬT PCR TRONG VIỆC PHÁT HIỆN CÁC GEN ĐỘC LỰC CỦA E.COLI GÂY TIÊU CHẢY Ở NGƯỜI ĐẠI HỌC THÁI NGUYÊN TRƯỜNG ĐẠI HỌC KHOA HỌC BỘ MÔN KHOA HỌC SỰ SỐNG ----------------- PHẠM THỊ NHÀN ỨNG DỤNG KỸ THUẬT PCR TRONG VIỆC PHÁT HIỆN CÁC GEN ĐỘC LỰC CỦA E.COLI GÂY TIÊU CHẢY NGƯỜI ĐỀ TÀI NGHIÊN CỨU KHOA HỌC SINH VIÊN Người hướng dẫn khoa học: ThS. Nguyễn Phú Hùng THÁI NGUYÊN - 2010 NỘI DUNG BÁO CÁO NỘI DUNG BÁO CÁO 1. Mở đầu 2. Đối tượng và phương pháp nghiên cứu 2. Đối tượng và phương pháp nghiên cứu 3. Kết quả và thảo luận 3. Kết quả và thảo luận 4. Kết luận và kiến nghị 4. Kết luận và kiến nghị 1. MỞ ĐẦU 1. MỞ ĐẦU Tiêu chảy một vấn đề sức khỏe toàn cầu. Một trong những Tiêu chảy một vấn đề sức khỏe toàn cầu. Một trong những nguyên nhân phổ biến gây tiêu chảy trẻ em là do vi khuẩn nguyên nhân phổ biến gây tiêu chảy trẻ em là do vi khuẩn E.coli. E.coli. Việc xác định nhanh các nhóm Việc xác định nhanh các nhóm E.coli E.coli bằng các kỹ thuật có độ nhạy bằng các kỹ thuật có độ nhạy và độ đặc hiệu cao sẽ có ý nghĩa rất quan trọng trong việc lựa chọn và độ đặc hiệu cao sẽ có ý nghĩa rất quan trọng trong việc lựa chọn phương pháp điều trị thích hợp cho bệnh nhân. phương pháp điều trị thích hợp cho bệnh nhân. Có nhiều phương pháp được sử dụng để xác định Có nhiều phương pháp được sử dụng để xác định E.coli E.coli gây tiêu gây tiêu chảy. Trong đó, PCR là phương pháp được sử dụng hữu hiệu nhất. chảy. Trong đó, PCR là phương pháp được sử dụng hữu hiệu nhất.  Xuất phát từ những lí do trên, chúng tôi tiến hành thực hiện đề tài Xuất phát từ những lí do trên, chúng tôi tiến hành thực hiện đề tài “ “ Ứng dụng kỹ thuật PCR trong việc phát hiện các gen độc lực của Ứng dụng kỹ thuật PCR trong việc phát hiện các gen độc lực của E.coli E.coli gây tiêu chảy người”. gây tiêu chảy người”. MỤC TIÊU NGHIÊN CỨU MỤC TIÊU NGHIÊN CỨU Sử dụng kỹ thuật PCR với các cặp mồi đặc hiệu nhằm phát hiện các gen độc lực của 5 nhóm E.coli gây bệnh tiêu chảy người, làm tiền đề cho việc tạo bộ sinh phẩm chẩn đoán các nhóm E.coli gây tiêu chảy. 2. ĐỐI TƯỢNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU 2. ĐỐI TƯỢNG VÀ PHƯƠNG PHÁP NGHIÊN CỨU 2.1. ĐỐI TƯỢNG NGHIÊN CỨU 2.1. ĐỐI TƯỢNG NGHIÊN CỨU - - Các chủng Các chủng E.coli E.coli chuẩn Quốc tế do Phòng Vi khuẩn đường ruột - Viện Vệ chuẩn Quốc tế do Phòng Vi khuẩn đường ruột - Viện Vệ sinh dịch tễ Trung ương cung cấp, gồm có: EPEC, EHEC1, EHEC2, EIEC, sinh dịch tễ Trung ương cung cấp, gồm có: EPEC, EHEC1, EHEC2, EIEC, ETEC, EAEC và EC (chủng đối chứng không có gen độc lực). ETEC, EAEC và EC (chủng đối chứng không có gen độc lực). 2.2. PHƯƠNG PHÁP NGHIÊN CỨU 2.2. PHƯƠNG PHÁP NGHIÊN CỨU Điện di kiểm tra sản phẩm trên gel agarose Điện di kiểm tra sản phẩm trên gel agarose Hình 2.1. Sơ đồ các bước được thực hiện trong quá trình nghiên cứu Hình 2.1. Sơ đồ các bước được thực hiện trong quá trình nghiên cứu Các chủng E.coli chuẩn Quốc tế Các chủng E.coli chuẩn Quốc tế Nuôi cấy qua đêm trên môi trường MPA đặc, thu khuẩn lạc Nuôi cấy qua đêm trên môi trường MPA đặc, thu khuẩn lạc Tách DNA trực tiếp từ khuẩn lạc Tách DNA trực tiếp từ khuẩn lạc Khuếch đại gen bằng phản ứng PCR Khuếch đại gen bằng phản ứng PCR Bảng 2.1. Các trình tự mồi được sử dụng trong các phản ứng PCR Gen độc lực Cặp mồi (primer) Trình tự primer (5’ → 3’) Kích thước sản phẩm PCR (bp) vt2 VT2 - F VT2 - R ACCGTTTTTCAGATTTTGCACATA TACACAGGAGCAGTTTCAGACAGT 298 vt1 VT1 - F VT1 - R GAAGAGTCCGTGGGATTACG AGCGATGCAGCTATTAATAA 130 elt LT - F LT - R TCTCTATGTGCATACGGAGC CCATACTGATTGCCGCAAT 322 eae eae - F eae - R CACACGAATAAACTGACTAAAATG AAAAACGCTGACCCGCACCTAAAT 376 IpaH IpaH - F IpaH - R GTTCCTTGACCGCCTTTCCGATACCC GCCGGTCAGCCACCCTCTGAGAGTAC 620 EAST1 EA - F EA - R CTGGCGAAAGACTGTATCAT CAATGTATAGAAATCCGCTGTT 630 Bảng 2.2. Thành phần phản ứng PCR Bảng 2.2. Thành phần phản ứng PCR STT Thành phần Thể tích (µl) 1 Nước khử ion 12,5 2 PCR Buffer (10X) 2,5 3 dNTPs (25mM) 2 4 MgCl 2 (25mM) 2,5 5 Mồi xuôi (10pM/mồi) 1 6 Mồi ngược (10pM/mồi) 1 7 DNA khuôn 3 8 Taq DNA polymerase (5 unit/µl) 0,5 Tổng thể tích 25 3. KẾT QUẢ VÀ THẢO LUẬN 3. KẾT QUẢ VÀ THẢO LUẬN 3.1. KẾT QUẢ TÁCH DNA TRỰC TIẾP TỪ KHUẨN LẠC 3.1. KẾT QUẢ TÁCH DNA TRỰC TIẾP TỪ KHUẨN LẠC DNA được tách chiết trực tiếp từ khuẩn lạc E.coli bằng phương pháp của Cebula và cộng sự (1995) có cải tiến cho phù hợp với điều kiện thí nghiệm. Ưu điểm: - Tổng thời gian tách DNA là 25 phút - Không phải tiêu tốn nhiều hóa chất - Lượng DNA thu được là rất nhỏ, nên nó được sử dụng trực tiếp (3 µl/1 phản ứng) mà không cần tiến hành pha loãng Nhược điểm: DNA thu được không đủ để phát hiện bằng phương pháp điện di thông thường 3.2. KHUẾCH ĐẠI CÁC GEN ĐỘC LỰC CỦA CÁC NHÓM 3.2. KHUẾCH ĐẠI CÁC GEN ĐỘC LỰC CỦA CÁC NHÓM E.COLI E.COLI 3.2.1. Gen độc lực 3.2.1. Gen độc lực eae eae 603 bp 270 bp M 1 2 3 4 5 6 7 376 bp 872 bp Hình 3.1. Kết quả khuếch đại gen Hình 3.1. Kết quả khuếch đại gen eae eae M. Marker ФX 174 cắt bằng Hae III; 1. EPEC; 2. ETEC; 3. EHEC1; M. Marker ФX 174 cắt bằng Hae III; 1. EPEC; 2. ETEC; 3. EHEC1; 4. EAEC; 5. EHEC2; 6. EIEC; 7. EC 4. EAEC; 5. EHEC2; 6. EIEC; 7. EC 3.2.2. Gen độc lực vt1 M 1 2 3 4 5 6 7 130 bp Hình 3.2. Kết quả khuếch đại gen vt1 M. Marker ФX 174 cắt bằng Hae III; 1. EHEC1; 2. EC; 3. EAEC; 4. EPEC; 5. EHEC2; 6. EIEC; 7. ETEC [...]... khuếch đại gen IpaH M Marker ФX 174 cắt bằng Hae III; 1 EPEC; 2 EIEC; 3 EHEC1; 4 EHEC2; 5 ETEC; 6 EAEC; 7 EC 3.2.6 Gen độc lực EAST1 M 1 2 3 4 5 6 7 630 bp Hình 3.6 Kết quả khuếch đại gen EAST1 M Marker ФX 174 cắt bằng Hae III; 1 EPEC; 2 EHEC1; 3 EHEC2;4 EIEC; 5 ETEC, 6 EAEC; 7 EC Tóm tắt kết quả khuếch đại các gen độc lực của 5 nhóm E.coli Bảng 3.1 Kết quả khuếch đại các gen độc lực của 5 nhóm E.coli. .. eae, vt1, vt2, IpaH, elt, EAST1 Kết quả nghiên cứu này là tiền đề cho nghiên cứu tiếp theo của chúng tôi để tạo bộ sinh phẩm chẩn đoán tác nhân gây bệnh là E.coli 2 KIẾN NGHỊ Tiếp tục phát triển nghiên cứu, tối ưu hoá các phản ứng PCR để có thể chẩn đoán E.coli trực tiếp trên các mẫu phân của bệnh nhân tiêu chảy ...3.2.3 Gen độc lực vt2 M 1 2 3 4 5 6 7 298 bp Hình 3.3 Kết quả khuếch đại gen vt2 M Marker ФX 174 cắt bằng Hae III; 1 EHEC1; 2 EHEC2; 3 EPEC; 4 ETEC; 5 EIEC; 6 EAEC; 7 EC 3.2.4 Gen độc lực elt M 1 2 3 4 5 6 7 322 bp Hình 3.4 Kết quả khuếch đại gen elt M Marker ФX 174 cắt bằng Hae III; 1 EPEC; 2 EHEC1; 3 EHEC2; 4 ETEC; 5 EAEA; 6 EIEC; 7 EC 3.2.5 Gen độc lực IpaH M 1 2 3 4 5 6 7 620... - - - + - Ghi chú: EHEC1 và EHEC2 là hai phân nhóm của nhóm EHEC + : Dương tính - : Âm tính 4 KẾT LUẬN VÀ KIẾN NGHỊ 1 KẾT LUẬN Đã tách chiết được DNA tổng số của các nhóm vi khuẩn E.coli bằng phương pháp tách DNA trực tiếp từ khuẩn lạc, tiết kiệm được nhiều thời gian và hoá chất nghiên cứu Khuếch đại thành công các gen độc lực đặc trưng của 5 nhóm E.coli là: eae, vt1, vt2, IpaH, elt, EAST1 Kết quả
- Xem thêm -

Xem thêm: ỨNG DỤNG KỸ THUẬT PCR TRONG VIỆC PHÁT HIỆN CÁC GEN ĐỘC LỰC CỦA E.COLI GÂY TIÊU CHẢY Ở NGƯỜI, ỨNG DỤNG KỸ THUẬT PCR TRONG VIỆC PHÁT HIỆN CÁC GEN ĐỘC LỰC CỦA E.COLI GÂY TIÊU CHẢY Ở NGƯỜI, ỨNG DỤNG KỸ THUẬT PCR TRONG VIỆC PHÁT HIỆN CÁC GEN ĐỘC LỰC CỦA E.COLI GÂY TIÊU CHẢY Ở NGƯỜI

Từ khóa liên quan

Gợi ý tài liệu liên quan cho bạn