the possible role of protein kinase c in explaining differences in gfr
báo cáo khoa học: "The expression and role of protein kinase C (PKC) epsilon in clear cell renal cell carcinoma" ppt
... radical nephrectomy or partial resection Of the 128 RCC samples, 10 were papillary RCC, 10 were chromophobe RCC, and 108 were clear cell RCC according to the 2002 AJCC/UICC classification The clear ... chemotherapy, indicating the association between PKCε and chemosensitivity of RCC Conclusions Our results confirm the role of PKCε as an oncogene in RCC, especially in the subtype of clear cell, suggesting ... Parkinson SJ: AGC protein kinase phosphorylation and protein kinase C Biochem Soc Trans 2001, 29:860-863 Griner EM, Kazanietz MG: Protein kinase C and other diacylglycerol effectors in cancer...
- 9
- 308
- 0
Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf
... Fig Mitochondrial CYP contents in yeast cells expressing CYP1A1, CYP2E1 and CYP2B1 proteins (A) The reduced CO spectra of the mitochondrial fraction expressing + 331A1 The reduced CO spectrum was ... significant intramitochondrial localization of intact or N-terminal truncated CYP2E1 in yeast cells [23] The precise nature of CYP proteins targeted to mitochondria and the conservation of targeting ... signal-containing proteins to the mitochondrial compartment [4–6,12,39] We have shown that xenobiotic-inducible CYPs such as rat CYP1A1, CYP2E1 and CYP2B1, and mouse CYP1A1, contain chimeric noncanonical-targeting...
- 16
- 650
- 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx
... effect of TS on the cell growth at higher concentrations might prevent the increase in the enhancing effect of TS on LPS/IFN-induced NO production in VSMC Therefore, we used a concentration of 10 ... of a nuclear factor kB-dependent mechanism J Immunol 161, 6206– 6214 31 Chen, C. -C. , Chiu, K.-T., Sun, Y.-T & Chen, W. -C (1999) Role of the cyclic AMP -protein kinase a pathway in lipopolysaccharideinduced ... for 5min The amount of protein of the solubilized cells was determined with a bicinchoninic acid protein assay kit (PIERCE, Rockford, IL, USA) using bovine serum albumin as a standard The solubilized...
- 6
- 494
- 0
Báo cáo khoa học: Modulation of the Arabidopsis KAT1 channel by an activator of protein kinase C in Xenopus laevis oocytes potx
... sites in the cytosolic region of KAT1 K+ channel modulation, e.g K+uptake channel inhibition during stomatal closure, may occur via protein kinases which have PKClike characteristics, such as CDPKs ... abscisic acid-activated and calcium-independent protein kinase from guard cells of fava bean Plant Cell 8, 2359–2368 Mori IC & Muto S (1997) Abscisic acid activates a 48kilodalton protein kinase ... membrane voltage which, in turn, results in the opening of inward-rectifying K+ channels, allowing the in ux of K+ ions [4] For stomatal closure, increased levels of cytosolic Ca2+ inhibit plasma...
- 11
- 531
- 0
Role of the c terminus of protein kinase c related kinase in cell signalling
... cAMP cDNA CDK CL CO COS cPKC C1 Degree Celcius Calmodulin Calmodulin Kinase Adenosine 3’, 5’- cyclic monophosphate complimentary deoxyribonucleic acid Cyclin-dependent kinases Cardiolipin carbon ... Protein Kinase A, Protein Kinase G and Protein Kinase C aPKC Atyptical Protein Kinase C Arg Arginine ATP Adenosine 5’ Triphosphate β bp BSA Beta Base Pair Bovine Serum Albumin o C CaM CaMK cAMP cDNA ... network of intramolecular interactions in the V5 domain contributes to the catalytic competence of PRK1 The C- terminal tail of PRK1 is critical in conveying stability to the kinase in vivo The full-length...
- 240
- 209
- 0
Báo cáo khoa học: Differential involvement of protein kinase C alpha and epsilon in the regulated secretion of soluble amyloid precursor protein docx
... overexpression of the PKCe V1 region, which binds specifically to the receptor for activated C -kinase (RACK), blocking the activation of the kinase specifically [13] These experiments resulted in a reduced ... metabolism of the amyloid precursor protein Mol Psychiatry 6, 520–528 Slack, B.E (2000) The m3 muscarinic acetylcholine receptor is coupled to mitogen-activated protein kinase via protein kinase C and ... suggestion is consistent with data in the literature that indicate PKCe as the only protein kinase isoform involved in the signalling pathway downstream of muscarinic m3 receptors in SK-N-BE (C) neuroblastoma...
- 8
- 458
- 0
A novel membrane pool of protein kinase c and its role in mammalian cell signaling
... phosphorylated, the protein kinases can be divided into two subgroups: protein serine/threonine kinases and protein tyrosine kinases Serine/threonine protein kinases were the first discovered kinases that catalyze ... PKCα) The second role of Ca2+ ions is to induce conformational changes of the intra -C2 domain and inter -C2 domain, which induce membrane -protein interactions331-334 (e.g PLC) The contribution of ... catalytic domain on the same PKC molecule, thereby sterically blocking protein substrate access to the active site Activation of protein kinases occurs by dissociation of the regulatory domain...
- 221
- 308
- 0
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx
... 5¢-ATAAGCTTGCTTT AAAATCCACCCCACG-3¢ and 5¢-TCGGATCCC AGTGCCCACTTATTCGAAAAG-3¢ HindIII–BamHI digested PCR product was cloned into the pBlueScript SKvector and then recloned by KpnI–BamHI into the pTZ19R ... PCRamplified from the DNA of the cosmid clone #9 [18] using the following pair of primers: 5¢-GACTGCAGTGAAGG GCATCGAGTCCTCGGG-3¢ and 5¢-GAGGATCCGG GACATTCCTTAGCCAGGAGGG-3¢ To make the b-galactosidase ... Drosophila genomic DNA using the following pair of primers: 5¢-CAGAATTCA TGACACTTCCTAGTGCGGCTCGC-3¢ and 5¢-CTG GATCCTTATTGCTGATTATTGGGATTCATTTGA CCA-3¢ EcoRI–BamHI digested PCR product was cloned as...
- 10
- 464
- 0
Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx
... 3¢) CGGGAACCACTATGCC ACACAAAGCCACTGAA (V) CCCTTCTTGCCATCG (I) GCCGGTTATTTCATAGACAC (II) AAGACGTTTAGGTGCAAT (III) CCCTTTGCTGTTGGAT (IV) TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA ... GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG TCCACCGCCTTATTGTAACC whereas a ... Together, these results suggest that lack of the exon induces a structural change in the catalytic cleft, rendering the CbD4 variants inactive When stimulating with increasing concentrations of cAMP...
- 13
- 344
- 0
Báo cáo y học: "Possible role of alpha-lipoic acid in the treatment of peripheral nerve injuries" ppsx
... nerve injury [1] The activities of SOD and CAT were found to be high in sciatic tissue of rats indicating high production of superoxide anion radical Therefore, the increase of SOD and CAT activities ... may be a response against oxidative stress The results of Senoglu and colleagues correlated with our recent findings in which the combined employment of a-LA and g-linolenic acid with a rehabilitation ... neuroprotective effects and before the use of a-LA in low back pain can be instituted, as only in diabetic neuropathy and perhaps chemotherapy-induced neuropathy has the usefulness of a-LA been...
- 2
- 438
- 0
Tài liệu Báo cáo khoa học: Models and mechanisms of O-O bond activation by cytochrome P450 A critical assessment of the potential role of multiple active intermediates in oxidative catalysis doc
... Wagenknecht, H.A & Claude, C (2001) Synthetic active site analogues of heme-thiolate proteins Characterization and identication of intermediates of the catalytic cycles of cytochrome P450cam and chloroperoxidase ... (1993) Molecular recognition in cytochrome P-450: mechanism for the control of uncoupling reactions Biochemistry 32, 1153011538 Hlavica, P (1984) On the function of cytochrome b5 in the cytochrome ... chameleons, in which small alterations in the environment can cause drastic changes in the reactivity of the active species [76] Further support in favour of the idea of the involvement of a high-valent...
- 26
- 746
- 0
Báo cáo khoa học: Neural retina leucine-zipper regulates the expression of Ppp2r5c, the regulatory subunit of protein phosphatase 2A, in photoreceptor development pdf
... promoter, 5¢-CCC TGA AGC CAG GAT GAG CCG CAG GGA AAG-3¢ and 5¢-TGG AGC TCG CTG ATT GGC CAG AAG CTG CAA3¢) was used for the following EMSA assay The DNA protein binding reaction was conducted in a mixture ... (rhodopsin, forward, 5¢-ATG AGA CAC CCT TTC CTT TCT-3¢; rhodopsin, reverse, 5¢-GTA GAC AGA GAC CAA GGC TGC-3¢; Ppp2r 5c, forward, 5¢-CCC TCT AAG AGC TGG GAT TCT-3¢; Ppp2r 5c, reverse, 5¢-CAA ACT GAA GCT ... temperature The dsDNA (oligonucleotides for the rho promoter, 5¢-ATC TCG CGG ATG CTG AAT CAG CCT CTG GC-3¢ and 5¢-GCC AGA GGC TGA TTC AGC ATC CGC GAG AT-3¢; oligonucleotides for the Ppp2r 5c promoter,...
- 10
- 378
- 0
Báo cáo y học: " The crucial role of particle surface reactivity in respirable quartz-induced reactive oxygen/nitrogen species " doc
... APE/Ref-1 in these cells As such, these in vitro findings were in concordance with our in vivo observations, concerning the predominant nuclear staining pattern Discussion The data presented in this ... lung epithelial cells (RLE) cultured in complete medium (BC) Immunocytochemical image of (B) APE/Ref-1 staining and (C) Hoechst nuclear counter-staining in RLE cells Original magnification of × ... considered as a crucial and unifying factor in the quartz-induced adverse health effects, including fibrogenicity and carcinogenicity Despite the fact that non-coated quartz caused a significant...
- 16
- 350
- 0
Role of protein misfolding pathway in HBX induced hepatocellular carcinoma
... 5’-GTACTGCCAACTGGATCCTTC-3’ R: 5’-CCTCCCAGTCCTTAAACACAC-3’ N-CoR F: 5’-TACCGCAGGAGCCATACAAGA-3’ R: 5’-GCTCAGTTGTGCTTTGGGAGC-3’ Haptoglobin F: 5’-GCCTGGGCAACAGGAGTGAAA-3’ R: 5’-CTTGGTTGGTCTTGCCTCTGG-3’ ... complex consisting of the constitutive form of the heat shock 70 kDa protein (hsc70), the heat shock protein of 40 kDa (hsp40), the heat shock protein of 90 kDa (hsp90), the hsc70-interacting protein ... in HCC incidence across different countries reflect regional differences in the prevalence of specific aetiological factors The most prominent factors associated with an increased risk of HCC...
- 117
- 193
- 0
Understanding the physiological role of cofactor f 420 in mycobacterium
... ACGGTTGCTAGCACGCGCA 3' hygR2 (Primer 6) 5' CTCGTCGTCCAGGATTTCCGCGGCG 3' 5' CACGAGCAGACCTCACTAGC 3' 3' fbiC RP - HindIII (Primer 4) hygF (Primer 5) 5' GGTCTGACGCTCAGTCGAACGAA 3' 5' ATCTCGAGAGCTGCTGGCGGTGGACAACGTA ... as the nature of peptide formed F420-(Glu)5 F420-0 FO HO O CH3 O COOO COOO COOO COOO COOCH2 O P O CH C N CH CH2 CH2 C N HC CH2 CH2 C N CH CH2 CH2 C N CH CH2 CH2 C NH CH H H H H HC OH OCH2 HC OH ... normal part of the catalytic cycle Because of the critical roles played by these cofactors in many important enzymatic functions, inhibition of cofactor biosynthesis would have a broader impact on...
- 88
- 375
- 0
phosphatidylserine exposure in red blood cells: a suggestion for the active role of red blood cells in blood clot formation
... and its consequences The appearance of PS on the surface of the cell membrane can have major physiological consequences, including increased cell-cell interactions The increased adherence of PS ... human RBCs The decline in the concentration of phosphorylated compounds thus arising in senescent cells, would lead to a reduction in their Ca2+ chelating potential Since the intracellular Ca2+ ... flippase activity leading to PS exposure [113, 138] 2.4.3 Influence of intracellular Ca2+ on protein kinase C Two decades ago, the discovery of protein kinase C (PKC) opened a new research field of...
- 151
- 581
- 0
The Potential Role Of Cyber-Liability Insurance In Data Breach Litigation
... personal information.66 The SAIC court concluded that the theft of data tapes fell short of inflicting plaintiffs with a certainly impending increased risk of identity theft, because the other plaintiffs ... fail to reflect the increased risk that insuring the client poses to the insurer, an inaccuracy which threatens insurers’ financial solvency in the event of repeated or catastrophic claims.80 Although ... http://www.rmmagazine.com/2015/03/02/how-not-to-void-yourcyberinsurance-policy/ Academic Vita of Eric S McCoy emccoy432@gmail.com Education: Major(s) and Minor(s): Bachelor of Science in Information Sciences...
- 49
- 308
- 0
Báo cáo khoa học: "Hepatic splenosis mimicking HCC in a patient with hepatitis C liver cirrhosis and mildly raised alpha feto protein; the important role of explorative laparoscopy" potx
... been the main tool in difining the correct diagnosis in a case of splenosis, suspected to be an HCC on radiological investingations and strong clinical bases 10 We therefore propose that laparoscopic ... successful diagnostic and interventional tool even in laparoscopically challenging scenarios involving the pancreas [18,19] To the best of our knowledge, this is the first case where laparoscopy ... of the extent of the disease Diagnostic laparoscopy demonstrated a cm exofitic dark brown splenunculus attached to the diaphragm and indenting the surface of segment of the liver Multiple other...
- 4
- 451
- 0
Tài liệu Báo cáo khoa học: Unfolding of human proinsulin Intermediates and possible role of its C-peptide in folding/unfolding pptx
... C terminus of the B chain and N terminus of the A chain After digestion by a speci c set of protein enzymes in the B-cell granule, proinsulin is converted into insulin and C- peptide of 31 amino ... biological activity [20–25] The double-chain insulin is synthesized in vivo as a single-chain precursor (preproinsulin) and folded as proinsulin, in which a connecting peptide of 35 residues links the ... folding process As a result of the observed differences in the molecular folding process of PIP and HPI, as shown in Fig 1B and C, we can conclude that the main function of the C- peptide in the...
- 11
- 527
- 0
Tài liệu Báo cáo khoa học: The diacylglycerol and protein kinase C pathways are not involved in insulin signalling in primary rat hepatocytes doc
... e) protein kinase C isoforms on insulin-stimulated translocation of epitope-tagged GLUT4 glucose transporters in rat adipocytes: speci c interchangeable effects of protein kinases C- Z and C- 1 ... with increase in membrane-bound PKC activity and did not increase the activity of immunoprecipitated PKCf Fifth, the action of insulin on glycogen synthesis was not abolished by the speci c PKC inhibitor, ... Table Determination of protein kinase C (PKC) activity in crude extracts (pmolÆmin-1Æmg-1 of protein) and PKCf immunoprecipitates (pmolÆmin-1Æmg-1 of lysate protein) Hepatocytes cultured for...
- 12
- 592
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25