CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster Alla I. Kalmykova 1 , Yuri Y. Shevelyov 1 , Oksana O. Polesskaya 1, *, Anna A. Dobritsa 1, †, Alexandra G. Evstafieva 2 , Brigitte Boldyreff 3 , Olaf-Georg Issinger 3 and Vladimir A. Gvozdev 1 1 Institute of Molecular Genetics, Russian Academy of Sciences, Moscow, Russia; 2 Belozersky Institute of Physico-Chemical Biology, Center of Molecular Medicine, Moscow State University, Russia; 3 Department of Biochemistry and Molecular Biology, University of Southern Denmark, Odense, Denmark An earlier described CK2btes gene of Drosophila melano- gaster is shown to encode a male germline specific isoform of regulator y b subunit of casein kinase 2. Western-analysis using anti-CK2btes Ig revealed CK2btes protein in Drosophila tes tes extract. Expression of a CK2btes– b-galactosidase fusion protein driven by the CK2btes pro- moter was found in transgenic flies at postmitotic stages of spermatogenesis. Examination of biochemical characteris- tics of a recombinant CK2btes protein expressed in Escherichia coli revealed properties similar to those of CK2b: (a) CK2btes protein stimulates CK2a catalytic activity toward synthetic peptide; (b) it inhibits phosphorylation of calmodulin and mediate s stimulation of CK2 a by polylysine; (c) it is able to form (CK2btes) 2 dimers,aswellas (CK2a) 2 (CK2btes) 2 tetramers. Using t he yeast two-hybrid system and coimmunoprecipitation analysis of protein extract from Drosophila testes, we demonstrated an associ- ation between CK2bte s and CK2a. N orthern-analysis has shown that another regulatory (b¢) subunit found recently in D. melanogaster genome i s also testis-specific. Thus, we describe the first example of two tissue-specific regulatory subunits of CK2 which might serve to provide CK2 sub- strate recognition during spermatoge nesis. Keywords: spermatogenesis; casein kinase 2; C K2 b sub unit; CK2btes; testes. Protein kinase CK2 is involved in such general cell processes as cell cycle regulation, transcriptional control, signal transduction, development and proliferation [1–4]. More than 160 different proteins serve as substrates for CK2. Phosphorylation b y CK2 has been found to affect activity of such Drosophila proteins pivotal for realization of early developmental program, a s Cut-homeodeomain protein, Cactus and Antennapedia [5–7]. A CK2 holoenzyme consists of two a-(ora¢-) and two b subunits. The a subu nit of CK2 possesses catalytic activity and the regula tory b subunit was shown to enhance stability of the holoenzyme, activate CK2a and provide substrate specificity and CK2 targeting in c ells. In spite of CK2b being ubiquitously represented among eukaryotes, it is far less conserved in comparison with the catalytic CK2a. This fact might be explained by a wide spectrum of substrates and partner proteins interacting with CK2b as a regulatory subunit. Moreover, other functions, besides being a part o f the CK2 holoenzyme, can be ascribed to the b subunit. For e xample, it has been demonstrated that the CK2 b subunit is involved in the regulation of catalytic activity of two other protein kinases (A-raf a nd Mos kinases [8–10]). The conclusion that CK2b has a more general functions is supported by the fact that significant imbalance of its amount in respect to a subunit is found in tumor cells and some mammalian tissues such as testicles [11, 12]. Recently it was shown that the CK2 activity as well as the CK2 protein level are mostly elevated in rat and mouse testicles [12, 13]. An important role for the CK2 activity in spermatogenesis was clearly shown by a Ôknock-ou tÕ of the CK2a¢ gene in mice resulting in a male sterile phenotype [14]. Spermatogenesis is a complex differentiation process comprising mitotic and meiotic division s of germline stem cells followed by sperm morphogenesis. This p rocess is known to have a lot of common features in Drosophila and mammals [15]. However, g enetic control and molecular mechanisms of both Drosophila and mammalian sperma- togenesis are still poorly understood. The genomes of most eukaryotes including mammals carry a single gene encoding bsubunit of CK2. Only Saccharomyces cerevisiae and Arabidopsis thaliana are known to have two and three isoforms of CK2b, respect- ively [16, 17]. Recently, we have described in Drosophila the SSL gene [18], later renamed CK2btes [19], as a first candidate on the role of a tissue-specific isoform of the CK2 regulatory subunit. This gene is expressed exclusively in testes and encodes a protein sharing 45% amino-acid identity with the ubiquitous Drosophila b subunit. Another potential Drosophila tissue-specific CK2 regulatory subunit (b¢) was identified in the yeast two-hybrid screen where Correspondence to Y. Y. Shevelyov, Department of Molecular Genetics of Animals, Institute of Molecular Genetics, 123182, Kurchatov Sq. 2, Moscow, Russia. Fax: + 7 095 1960221; Tel.: + 7 095 1961909; E-mail: shevelev@img.ras.ru Abbreviations:CK2,caseinkinase2;CK2b,CK2b subunit; CK2a, CK2 a subunit; IP, immunoprecipitation; RNAi, RNA interference; dsRNA, double stranded RNA; X-gal, 5 -bromo-4-chloro-3-indolyl b-galactopyranoside. *Presen t address: Molecular Neurobiology Branch, NIDA, NIH, 5500 Nathan Shock Drive, Baltimore, MD, 21224, USA. Presen t address: Department of Molecular, Cellular and Develop- mental Biology, Yale University, New Haven, CT 06520, USA. (Received 25 September 2001, revised 7 De cember 2001, accepted 14 January 2002) Eur. J. Biochem. 269, 1418–1427 (2002) Ó FEBS 2002 CK2a was used as a bait [20]. In this work we present compelling evide nce that the CK2btes protein serves as a tissue-specific isoform of the CK2 regulatory subunit in Drosophila male germline. EXPERIMENTAL PROCEDURES Plasmid constructions PCRs were performed according to the recommendations of the manufacturer using GeneAmp XL PCR Kit (Perkin Elmer, Branchburg, NJ, USA) containing high fidelity mixture of DNA-polymerases. CK2btes and CK2a expression constructs: An  850 bp BamHI–SalI fragment of the CK2btes cDNA #112 (this cDNA sequence, cloned in the pBlueScript SK- vector, contains no poly(A) tail and corresponds to nucleotides 72– 840 of the SSL (CK2btes) cDNA #911 sequence deposited in GeneBank under accession number L42285, see also [18]) was s ubcloned in the pQE 30 expression vector (Stratagene, La Jolla, CA, USA). The recombinant protein with the N-terminal His 6 -tag comprises the whole CK2btes ORF except for the 11 amino acids at the N-terminus. A 1011-bp fragment of D. melanogaster CK2a gene comprising the whole ORF region was PCR-amplified from Drosophila genomic DNA using the f ollowing pair of primers: 5¢-CAGGATCCATGACACTTCCTAGTGCG GCTCGC-3¢ and 5¢-CCAAGCTTTTATTGCTGATTAT TGGGATTCATTTGACCA-3¢ (the gene encoding the Drosophila CK2 a subunit does not contain introns in the coding region [21]). The BamHI–HindIII digested PCR fragment was s ubcloned in the pQE 30 vector. CK2b¢ probe for Northern-analysis. The161 bp 3¢-f rag- ment of the C K2b¢ gene was PCR-amplified from Drosophila genomic DNA using primers 5¢-ATAAGCTTGCTTT AAAATCCACCCCACG-3¢ and 5¢-TCGGATCCC AGTGCCCACTTATTCGAAAAG-3¢. HindIII–BamHI digested PCR product was cloned into the pBlueScript SK- vector and then recloned by Kpn I–BamHI into the pTZ19R vector. In vitro transcription was performed for 1 h at 37 °C in the buffer containing 40 m M Tris/HCl, pH 7.5, 60 m M MgCl 2 ,5 m M NaCl, 10 m M dithiothreitol, 0.5 m M of each of the ATP, GTP, CTP, 100 ng of the linearized plasmid DNA, 20–100 lCi [a- 32 P]UTP, 2–5 units of T7 RNA polymerase (Gibco BRL, Life Technologies, CA, USA), 25 U of RNAse inhibitor (Gibco BRL, Life Technologies, CA, USA). Constructs for P-element transformation To make the CK2btes–b-galactosidase fusion construct, a 934-bp fragment of the CK2btes gene including the 161 bp of promoter region linked to the whole ORF was PCR- amplified from the DNA of the cosmid clone #9 [18] using the following pair of primers: 5¢-GACTGCAGTGAAGG GCATCGAGTCCTCGGG-3¢ and 5¢-GAGGATCCGG GACATTCCTTAGCCAGGAGGG-3¢.Tomakethe b-galactosidase expressing construct, a 173-bp PCR frag- ment of the CK2btes gene including the 161 bp of promoter region joined with the first 12 bp of the ORF region was amplified from the DNA of the c osmid clone #9 using the same direct primer as for the CK2btes–b-galactosidase fusion construct and the following reverse primer: 5¢-CTGGATCCGGACACGACATGCTCACTCGAA TAA-3¢.BothPstI–BamHI digested PCR fragments were clonedinframe,withtheb-galactosidase ORF devoid of the ATG, into the pCaSpeR-bgal vector [22]. To genera te the CK2btes ÔantisenseÕ co nstruct, the XhoI fragment of the CK2btes cDNA #421 corresponding to the 12–700 bp region of the sequence of cDNA #911 (one XhoI site in the cDNA #421 is located in the MCS of BlueScript SK- vector, and another XhoI site is located in the adaptor sequence at the opposite side of insert) was cloned into the modified testis vector kindly provided by H.D. Hoyle (University of Indiana, Bloomingto n, IN, USA) [23]. This vector carries the regulatory region of t he b2-tubulin gene driving testis-specific expression of any gene substituting the b2-tubulin ORF. The regulatory region had been cloned upstream of the mini-white gene in the pCaSpeR4 vector. The m odification of the vector includes the insertion in its EcoRI cloning site of the MCS polylinker, which may now be used for cloning with EcoRI, XhoIandKpnI. The ÔantisenseÕ orientation of the CK2btes cDNA relative to the b2-tubulin promoter was v erified by restriction digestion. Constructs for the yeast two-hybrid system assay To make CK2a AD- and BD- constructs, the whole CK2a ORF region was amplified from Drosophila genomic DNA using the following pair of primers: 5¢-CAGAATTCA TGACACTTCCTAGTGCGGCTCGC-3¢ and 5 ¢-CTG GATCCTTATTGCTGATTATTGGGATTCATTTGA CCA-3¢. EcoRI–BamHI digested PCR product was clon ed as a fusion with t he GAL4 activation domain in the pGAD424 vector, or as a fusion with the GAL4 DNA- binding domain in the pGBT9 vector (Clontech, La Jolla, CA, USA). To prepare CK2btes AD- and BD- constructs, the whole CK2btes ORF region was amplified from the cDNA #911 using the following pair of primers: 5¢-CTGGATCCCT ATGTCGTGTCCCAGGAGCATCGAG-3¢ and 5¢-GTC TGCAGTTAAAAATTCGGGACATTCCTTAGCCA GG-3¢. BamHI–PstI digested PCR product was cloned as a fusion with GAL4bd in the pAS2-1 vector (Clontech, La Jolla, CA, USA). The CK2btesORFwasexcisedfromthe pAS2-1 plasmid by joint BamHI and PstI digestion, the PstI end was blunted by T4 DNA polymerase, and fragment was cloned in the BamHI–XhoI d igested (the XhoIendwasalso blunted) pACT2 vector (Clontech, La Jolla, CA, USA) as a fusion with GAL4ad. To prepare CK2b AD- and BD- constructs, the whole CK2b ORF region was amplified from the pEV55Dmb plasmid DNA (kindly provided by C.V.C. Glover (Uni- versity of Georgia, Athens, GA, USA), it contains a full size cDNA of D. melanogaster b subunit [24]) using the follow- ing p air o f p rimers: 5¢-CAGGATCCCTATGAGCAGC TCCGAGGAAGTCTCCT-3¢ and 5¢-CTGTCGACTTA GTTTTTCGCTCGTAGTGGCATTTTAAAATTGGCT GC-3¢. BamHI–SalI digested PCR fragment was cloned into BamHI–SalI digested pAS2-1 vector, or into BamHI– XhoI digested pACT2 vector. Protein purification, generation of antibodies Expression and purification of recombinant p roteins from E. coli using Ni 2+ /nitrilotriacetic acid resin (Qiagen Inc., Ó FEBS 2002 Testis-specific isoform of CK2 regulatory subunit (Eur. J. Biochem. 269) 1419 CA, USA) were performed according to the Stratagene protocols. Drosophila CK2a and CK2btes recombinant proteins purified under n ondenaturing conditions were used in the in vitro assays (measurement of CK2a activity, gel filtration experiments). Human CK2a and Drosophila CK2btes proteins p urified from E. coli inclusion bodies under denaturing conditions were used for the g eneration of antibodies in rabbits. The specificities of isolated antisera were tested by Western analysis. RNA isolation and Northern-analysis Total R NA was isolated by guanidinium thiocyanate extraction [25] from embryos, pupae, larvae, females, male carcasses and testes of gt w a strain, fractionated by electro- phoresis in denaturing formaldehyde-agarose g el and transferred t o a nylon HyBond-N filter (Amersham, Little Chalfont, UK). Filter prehybridization, hybridization and washing were performed according to standard protocols [26]. As a control for the RNA loading, hybridization of the same filter with the rp49 probe [27] was performed. CK2 activity test The equimolar mixture of CK2a and CK2btes proteins purified under nondenaturing conditions or the CK2a protein alone were assayed for the CK2 phosphorylation activity using a synthetic peptide RRRDDDSDDD as a substrate. The reaction was carried out in the buffer (45 m M Tris/HCl, pH 8.0, 5 m M MgCl 2 ,1 m M dithiothreitol, 50 l M ATP, 2 lCiÆmL )1 [c- 32 P]ATP (3000 CiÆmmol )1 ), 200 l M peptide) containing different N aCl concentrations (from 0m M to 200 m M )at37°C for 5 min The reaction aliquots were loaded onto P81 phosphocellulose paper, washed with 85 m M phosphoric acid, and incorporated radioactivity was measured by the liquid scintillation counter. For the phosphorylation of calmodulin (kindly provided by N. B. Gusev, Moscow State University) t he aliquots of fractions after gel filtration assay containing  50 ng of CK2a either alone or in combination w ith equimolar amount of CK2btes protein were used. T he reaction was carried out in 50 m M Tris/HCl, pH 8.0, 10 m M MgCl 2 , 150 m M NaCl, 20 l M ATP, 10 lCiÆmL )1 [c- 32 P]ATP (3000 CiÆmmol )1 ), 10 l M calmodulin at 37 °C for 15 min Polylysine (Sigma, St Louis, MI, USA) at concentration 100 lgÆmL )1 was added where necessary. The reaction was stopped by cooling in ice, and the samples were subjected to 15% SDS/PAGE. The gels were dried and autoradiographed. Assays for detection of protein-protein contacts in yeast two-hybrid system Protein–protein interactions were assayed using three different approaches. For the b-galactosidase filter assay, single colonies cotransformed with AD- and BD- constructs were picked and transferred to a Whatman no. 5 paper, which was further incubated on a fresh plate for 2–3 days. The filters were frozen in liquid nitrogen, layered over a second filter prewetted with Z-buffer (16.1 gÆL )1 Na 2 H- PO 4 Æ7H 2 O, 5.5 gÆL )1 NaH 2 PO 4 ÆH 2 O, 0.75 gÆL )1 KCl, 0.246 g L )1 MgSO 4 · 7H 2 O), which contained 0.27 mL 2-mercaptoethanol and 1.67 mL 5-bromo-4-chloro-3-indo- lyl b-galactopyranoside (X-gal; 20 mgÆmL )1 in dimethyl- formamide) per 100 mL. Incubation was performed at 30 °C for up to 12 h. For the liquid assay 5 mL cultures with synthetic medium were inoculated with single colonies cotransformed with AD- and BD- c onstructs and were grown until D 600  1. Each culture (1 mL) was transferred to a microcentrifuge tube and c entrifuged for 5 s. The yeast pellet was dissolved in 100 lL of Z buffer and frozen in liquid nitrogen. After thawing, 700 lL of Z buffer with mercaptoethanol and 160 lL O-nitrophenyl-b- D -galacto- side ( 4 mgÆmL )1 in Z buffer) were added and the reaction was incubated for 1 h at 30 °C. The reaction was stopped by addition of 400 lL1 M Na 2 CO 3 . After centrifugation for 10 min at 13 400 g,theA 420 was measured. b-Galac - tosidase activity was calculated in Miller units according to the formula: units ¼ 1000 · A 420 /(culture volume in ml · incubation time in min · D 600 ). In addition, the ability of the yeast strain HF7c (carrying HIS3 reporter gene) being cotransformed with AD- and BD- constructs to grow on the medium without histidine was used to verify protein–protein interactions. Immunoprecipitation A total of 100 hand-dissected pairs of testes were homo- genized in the buffer containing 50 m M Tris/HCl, pH 8.0, 150 m M NaCl, 0.05% Nonidet P40, cocktail of protease inhibitors. After 3 h of incubation at 4 °C followed by 15 min centrifugation at 4000 g, crude extract was fivefold diluted with IP buffer (50 m M Tris/HCl, pH 8.0, 150 m M NaCl, 0.05% NP40, 5 m M EDTA, 0.2% BSA, 0.02% NaN 3 , cocktail of protease inhibitors). Immunoprecipita- tion was carried out over night at 4 °Cwith1lLofanti- DmCK2a Ig, kindly provided by C.V.C. Glover. The complex was precipitated by incubation with protein A–Sepharose (4 Fast Flow, Pharmacia Biotech, Uppsala, Sweden) for 1 h at 4 °C. Immunoprecipitate was washed fourfold with 0.5 mL IP buffer and then fractionated on the 8% SDS/PAGE followed by Western analyses with poly- clonal anti-( b-galactosidase) Ig (ICN Pharmaceuticals inc., Costa Mesa, CA, USA). Western blot analysis For the detection of CK2 btes and CK2a proteins in testes extracts by Western analysis the following antibodies were used: anti-CK2btes nonpurified serum at a dilution of 1 : 5000; and anti-(Drosophila CK2a) serum, kindly provi- ded by C.V.C. Glover, at a dilution of 1 : 5000. For detection of CK2a in gel filtration assay rabbit anti-(human CK2a) polyclonal IgG was used. Alkaline-phosphatase- conjugated anti-(rabbit IgG) Ig (Sigma, St Louis, MI, USA) was used as a secondary reagent. Samples were resolved by electrophoresis in SDS/PAGE and blotted onto Hybond-C membrane (Amersham, Little Chalfont, UK). Blots were developed using the CDP-star detection system (Tropix, Bedford, MA, USA) according to the recommendations of the manufacturer. Gel-filtration experiments Proteins were passed through the Pharmacia SMART system chromatographic Superose 6 column in the buffer 1420 A. I. Kalmykova et al. (Eur. J. Biochem. 269) Ó FEBS 2002 (25 m M Tris/HCl, pH 8.5, 1 M NaCl) in the flow rate regime (40 lLÆmin )1 ). P-element transformation Transgenic lines were generated using standard P-element mediated germline transformation technique [28] with Df(1)w 67c23(2) , y strain and the pTURBO transposase source. Three transformant lines were established for the b- galactosidase bearing construct, two lines for the CK2btes- b-galactosidase fusion construct, and one line for the ÔantisenseÕ CK2btes construct. Histochemical staining of tissues For the b-galactosidase staining, testes from adult Drosophila males, as well as carcasses, were hand-dissected, fixed in 2% glutaraldehyde in KCl/NaCl/P i buffer (8 m M Na 2 HPO 4 ,137m M NaCl, 0 .5 m M MgCl 2 ,1.6m M KH 2 PO 4 ,2.7m M KCl, pH 8.0) for 30 min, washed twice in KCl/NaCl/P i buffer and stained with 0.25% X-gal at 37 °C for 1.5 h in the buffer containing 150 m M NaCl, 10 m M NaH 2 PO 4 ,pH7.5,1m M MgCl 2 ,3.1m M K 3 [Fe II (CN) 6 ], 3.1 m M K 4 [Fe III (CN) 6 ]. RESULTS CK2btes protein is generated in Drosophila testes at postmitotic stages of spermatogenesis Previously we have revealed the CK2btes transcripts in Drosophila testes only [18]. To detect the CK2btes protein in testes, we raised rabbit polyclonal antibodies against a recombinant CK2 btes protein purified from E. coli.These antibodies recognize a protein with mobility of approxi- mately 30 kDa in testes extract, but do not reveal any specific signal in the corresponding region in the extracts from males with removed testes and from ovaries (Fig. 1A). The electrophoretic mobility of the recognized protein in testes extract is slightly different from that expected for the protein with the calculated molecular mass of 25 kDa. The recombinant CK2btes protein purified from E. coli during electrophoresis also runs slower than expected. The retardation might be due to the peculiarities of amino-acids content of the CK2btes protein. A similar gel retardation was seen in case of ubiquitous Drosophila CK2b when a 24.8-kDa protein runs as a 28-kDa one [24]. The generated antibodies are expected not to cross react noticeably with the b and b¢ subunits of CK2 because these subunits are rather divergent from the CK2btes protein (45% and 46% of identity, respectively [18,20]). Thus, we conclude that CK2btes protein is expressed in Drosophila testes and we are able to detect it using the anti-CK2btes Ig. To study spatial e xpression pattern of the CK2btes protein in the male germline, we generated transgenic flies expressing either the b-galactosidase protein alone or the CK2btes–b-galactosidase fusion protein, both being under the control of the CK2btes promoter (Fig. 1B). Expres- sion of the reporter genes was monito red by h istochemical X-gal staining of whole adult testes. Both constructs give thesameX-galstainingpatternatpremeioticand postmeiotic stages of spermatogenesis ( Fig. 1C). No b-galactosidase activity was revealed in the apical part of a testis where mitotic divisions take place. Other Drosophila male tissues were not stained also (not shown). This expression pattern suggests that CK2btes protein is expressed only at postmitotic stages of m ale germline, and it re sembles that of other Drosophila male germline specifically expressed genes, such as b2-tubulin, dhod, Sdic and others [29–31]. Recombinant CK2btes protein stimulates catalytic activity of recombinant CK2 a subunit towards a synthetic peptide substrate The CK2 holo enzyme is known to be a heterotetramer of a 2 b 2 structure. The b subunit is catalyticaly inactive by i tself but it specifically stimulates the phosphorylation activity of CK2a 5- to 10-fold [1]. To test the CK2btes protein for i ts ability to stimulate catalytic activity of CK2a, Drosophila CK2btes and CK2a recombinant proteins were expressed in E. coli. Proteins purified under nondenaturation condi- tions were used for the CK2 activity assay. In the reac- tion buffer without NaCl, the CK2btes protein 2.5-fold Fig. 1. Expression of the CK2btes protein in test es. (A) Detectio n of CK2btes protein in Drosophila tissues. Western analysis using poly- clonal anti-CK2btes Ig: R, recombinant CK2btes protein purified from E. coli; T, protein extract from 7 pairs of adult testes; C, protein extract from three male carcasses with removed testes; O, protein extract from seven pairs of ovaries. Molecular mass markers are shown to the left. (B) Diagram of microinjected constructs. CK2btes region is black, b-galactosidase region is gray. (C) X-gal staining (dark region) of testes from a transgenic fly line carrying the CK2btes–b-galactosi- dase fusion construct under the control of the CK2btes promoter region. The arrow marks the tip of the testis, no b-galactosidase staining of somatic tissues was observed (not shown). Ó FEBS 2002 Testis-specific isoform of CK2 regulatory subunit (Eur. J. Biochem. 269) 1421 stimulates t he CK2a activity (Fig. 2). Recombinant human b subunit at the same conditions activates Drosophila CK2a twofold (not shown). While the CK2a activity is practically independent of NaCl concentration in the absence of CK2btes, it is increased 5.5 times under physiological conditions (150 m M NaCl) in the presence of the equimolar amount of CK2btes (Fig. 2). It was shown that the regulatory b subunit of D. melanogaster CK2 purified from baculovirus expression system en - hanced the activity of catalytic a s ubunit towards synthetic peptide fivefold [24]. Therefore, CK2btes protein stimulates CK2a activity in vitro at the optimal NaCl concentration approximately t o the same extent as the ubiquitous b subunit. Recombinant CK2btes protein inhibits the ability of CK2 a subunit to phosphorylate calmodulin and this inhibition can be overcome by the polylysine It was shown that in contrast to the stimulatory effect on phosphorylation of majority of substrates, b subunit from Drosophila, as well as from m ammals, suppresses the calmodulin phosphorylation by the CK2 a subunit [32, 33]. Polybasic compounds such as polylysine and protamine abolish this inhibition. We asked whether the CK2btes protein behaves similarly in respect to calmodulin phos- phorylation by a subunit. As shown in Fig. 3 (lanes 3 and 5), calmodulin is phosphorylated by recombinant Drosophi- la CK2a, whereas the addition of equimolar amount of CK2btes results in less efficient incorporation of radio- activity in this substrate. The addition of polylysine practically has n o effect on the phosphorylation of calmodulin by free a subu nit (Fig. 3, lane 4), but drastically stimulates activity of the equimolar mixture of a with btes (Fig.3,lane6).Thus,CK2btes protein, such as canonical b subunit, mediates stimulation of CK2 by polylysine. Recombinant CK2btes protein forms tetrameric complexes with CK2 a subunit in vitro To elucidate the structure of CK2a–CK2btes complexes in vitro, recombinant CK2a and CK2btes proteins, purified under native conditions, were analyzed separately, or in the equimolar mixture, in gel-filtration experiments. Proteins eluted from the column were detected by Western blot analysis using anti-(CK2btes) Ig and polyclonal anti- (human CK2a) Ig that a lso recognizes the Drosophila CK2a. Figure 4 shows the results of Western analysis of fractions 15–20 with a protein marker range from 158 kDa (fraction 16, IgG) to 17 kDa (fraction 19, myoglobin). It is seen that CK2btes protein is mainly eluted in the fraction 18 marked with ovalbumin possessing a molecular mass of 44 k Da. The appearance of CK2btesinthisfraction indicates that most of t he protein molecules are associated in the (CK2btes) 2 homodimers with a calculated molecular mass of 50 kDa. When CK2a and CK2btes molecules were mixed together before passing through the column each type of subunits was mainly detected in the fraction 17 where protein complexes of a larger size (less than 1 58 k Da, but more than 44 kDa) were eluted. This elution profile most likely reflects the proposed (CK2a) 2 (CK2btes) 2 tetr- amer structu re with the predicted molecular mass o f 130 kDa. The ability to dimerize and to fo rm heterotetra- metic complexes with the a subunit a re the canonical features of the regulatory s ubunit of CK2. CK2btes protein interacts with CK2 a subunit in yeast two-hybrid system To examine whether the CK2 a subunit is a ble to interact with the CK2btes protein in vivo, two-hybrid system experiements were carried out. This system was designed to test protein–protein i nteractions in yeast cells. The PCR- amplified ORF regions of both a subunit and CK2btes cDNAs were cloned into the two-hybrid system vectors pACT2 (or pGAD424) and pAS2-1 (or pGBT9) as the Fig. 2. CK2a phosporylation activity dependence on the NaCl concen- tration in the presence (open circles) or absence (filled circles) of equi- molar quantity of CK2btes recombinant protein. The equimolar mixture of CK2a and CK2btes recombinant proteins purified from E. coli under nondenaturing condi tions or the CK2a protein alone were as- sayed for the CK2 phosphorylation a ctivity using a synthetic peptide RRRDDDSDDD as a s ubstrate. The reaction was carried out in the buffer containing different NaCl concentrations (from 0 m M to 200 m M ). Fig. 3. Effect of polylysine on the phosphorylation of calmodulin by catalytic subunit or by holoenzyme reconstituted from CK2a and CK2btes proteins. Calmodulin was phosphorylated in the presence (lanes 2, 4, 6) or absence (lanes 1, 3, 5) of polylysine by either catalytic subunit alone (lanes 3, 4), or by equimolar mixture of CK2a and CK2btesproteins(lanes5,6).Lanes1and2,noCK2a was added. Samples were electrophoresed in 15% SDS/PAGE and autoradio- graphed. The arrows indicate the position of calmodulin, which runs as a doub let. 1422 A. I. Kalmykova et al. (Eur. J. Biochem. 269) Ó FEBS 2002 fusions with GAL4-activator (AD), or GAL4-binding (BD) domains. Besides, the ubiquitous Drosophila CK2 b subunit was cloned in both AD- and BD-vectors. To assay interactions, different combination s of AD- and BD- constructs were cotransformed into SFY526 and HF7c yeast strains carrying lacZ or HIS3 reporter genes, respect- ively, under the control of the GAL4-binding sites. When protein interactions take place, the reporters proteins are expressed and this expression can be monitored by X-gal staining or the cell growth on medium without histidine. The filter and liquid b-galactosidase assays, as well as the growth on His – selection medium were carried out in order to detect and quantify the strength of an interaction. The results of these experiments are presented in Table 1. The pronounced b-galactosidase activity in cells cotransformed with CK2a(BD) and CK2btes(AD) constructs, as well as the cell growth on the medium without histidine indicate that CK2btes protein does interact with the CK2 a subunit in yeast c ells. Moreover, the strength of such interaction is nearly the same a s in the case of a/b CK2 interaction (124 vs. 156 Miller units, Table 1). We also observed the nearly equal ability of different b subu nits to form dimers com- posed of two b subunits, of two btes subunits and, of the mixture of b/btes subunits. These interactions are weaker than interaction of a subunit with btes or b subunit, but nevertheless, they are quite significant. The two-hybrid system data give clear evidence that the Drosophila catalytic CK2 a subunit is able to interact with the CK2btes protein in yeast cells. It is also seen from the obtained results that CK2btes protein might compose homodimeric as well as heterodimeric (with ubiquitous b) structures which are well known to be the prerequisite for the CK2 h oloenzyme formation. CK2btes protein is coimmunoprecipitated with CK2 a subunit in Drosophila testes extracts To demonstrate the association of CK2btes and CK2a in vivo in Drosophila testes, coimmunoprecipitation experi- ments were performed. T he main difficulty in these experi- ments was the insufficient avidity of polyclonal antibodies directed against CK2btes protein as well as those directed against the D. melanogaster CK2 a subunit (the latter were kindly provided by C.V.C. Glover). This problem was circumvented by the use of the transgenic flies expressing the fusion CK2btes–b-galactosidase protein i n testes. Anti- (CK2a) Ig were used for IP of protein complexes from testes extracts of two transgenic lines, one of which expressed the fusion CK2btes–b-galactosidase protein a nd the other, used as a negative control, expressed b-galactosidase alone (the structure of transgenic constructs is depicted on Fig. 1B). The IP c omplexes were bound to protein-A–Sepharose, washed and separated by SDS/PAGE. The immunostaining of Western blot was performed by commercially available, high affinity anti-(b-galactosidase) Ig. Anti-(b-galactosidase) Ig staining revealed single bands of different mobility in testes extracts of transgenic flies (Fig. 5, lanes 1, 3), corresponding to the b-galactosidase or the CK2btes–b-galactosidase fusion protein, respectively. Lanes Fig. 4. Analysis of oligomerization status of the CK2a and CK2btes proteins by gel filtration. The CK2a and CK2btes proteins alone or in the equimolar mixture were passed through the Pharmacia SMART system chromatographic Superose 6 column and fractions were ana- lysed by W estern blotting using anti-CK2a or anti-CK2btes Ig. Posi- tions of the corresponding protein markers run in parallel are designated by arrows. Table 1. CK2 subunits interactions in two-hybrid system. The interactions were determined by growth on His – medium (activation of HIS reporter gene) and quantitative and qualitative assays for b-galactosidase (activation of LacZ reporter gene). BD, pGBT9; BD*, pAS2-1; AD, pGAD424; AD**, pACT2. Activity values are given as mean values ± standard deviation from two to four different experiments. Type of interaction Filter b-galactosidase assay Growth on His – medium b-Galactosidase activity (Miller units) CK2a(BD): CK2btes(AD**) Blue Yes 124 ± 12 CK2a(BD): CK2b(AD**) Blue Yes 156 ± 7 CK2a(BD): CK2a(AD) White Weak growth 0.05 ± 0.02 CK2a(BD): (AD**) White No 0.06 ± 0.02 CK2b(BD*): CK2btes(AD**) Blue Yes 3.1 ± 0.4 CK2b(BD*): CK2b(AD**) Blue Yes 2.1 ± 0.1 CK2b(BD*): (AD**) White No 0.05 ± 0.05 CK2btes(BD*): CK2btes(AD**) Blue Yes 1.8 ± 0.3 CK2btes(BD*): (AD**) White No 0.05 ± 0.04 Ó FEBS 2002 Testis-specific isoform of CK2 regulatory subunit (Eur. J. Biochem. 269) 1423 2 and 4 show th e results of precipitation. Antibodies against CK2a precipitate the protein complex containing the CK2btes–b-galactosidase fusion protein, but not the b-galactosidase alone. Clearly, the precipitated complex is formed due to the association betwe en CK2a and CK2btes. These c omplexes are not the result of nonspecific aggrega- tion of over-expressed CK2btes protein with a subunit, but rather they reflect the physiological situ ation, because Northern-analysis has shown that the CK2btes–b-galac- tosidase transgene was transc ribed several times less efficiently than the endogenous CK2btes gene (not shown). Thus, C K2btes protein is a part of the CK2 holoenzyme in Drosophila testes. Drosophila b¢ subunit of CK2 is also testis-specific Another Drosophila CK2 regulatory subunit (b¢)was recently identified in the yeast two-hybrid screen of a Drosophila embryo cDNA library where CK2a was used as a bait [20]. However, its profile of expression was not determined. Using Northern analysis we have examined its tissue-specific and developmental pattern of transcription and, to our surprise , f ound the abundant transcript of b¢ subunit only in testes (Fig. 6). In our experiments no mRNA in embryos, pupae, larvae, male carcasses and females w as detected, althougt we c annot exclude the presence of some minor transcripts in these tissues or stages of Drosophila development. Consequently, CK2b¢ is likely to be another testis-specific regulatory subunit in Drosophila. DISCUSSION Our previous studies [18, 19] have shown that the SSL gene, later renamed CK2btes, is a candidate for being a testis- specific regulatory subunit of CK2: CK2btes transcripts, encoding a putative protein with 45% identity to CK2 b subunit, were revealed in Drosophila testes only. The degree of sequence identity between Drosophila CK2btes protein and b s ubunit was noticeably lower than among b subunits from different organisms (chicken, mouse and human sequences are 100% identical, Drosophila and human sequences are 88% identical [16]), but still at the same level as between S. cerevisiae b and b¢ subunits (45%, [34]). Therefore, it was likely but not strikingly obvious that CK2btes protein functions as a regulatory subunit of CK2 during Drosophila spermatogenesis. The data of this work provide direct evidence that the CK2btes gene encodes a male germline-specific protein possessing typical properties of the b subunit of CK2. The CK2btes protein is able to bind the CK2 a sub unit and to stimulate its phosphorylation activity towards a synthetic peptide in the in vitro experi- ments. Like the canonical b subunit [32, 33], the CK2btes protein negatively regulates the CK2 catalytic a ctivity toward calmodulin and this suppression is overcome by polylysine. The CK2btes binding with a subunit occurs in yeast cells as was shown by registration of strong CK2a– CK2btes interaction in the two-hybrid system experiments. The CK2btes p rotein forms homodimer molecules in vitro and in vivo, in yeast cells. It is known [35] that the CK2b dimerservesasaprecursoroftheformationoftheCK2 holoenzyme tetrameric structure. This (CK2a) 2 (CK2btes) 2 complex has been detected during our gel filtration experi- ments. Finally, coimmunoprecipitation analysis corrobor- ates the association between CK2btes and CK2a in Drosophila testes extracts. Therefore, CK2btes protein is indeed a testis-specific isoform of the CK2 regulatory subunit. The determined crystal structure of human CK2 holo- enzyme [36] allowed authors t o identify amino-acid residues in the b subunit participating in the b–b and b–a intersub- unit contacts. The analysis of conservation of these residues in the CK2btes sequence has shown that only 19 out of 39 residues contacting between two b subunits, and 12 out of 22 residues contacting between b–a are kept intact in the btes sequence. This observation underlines the idea that probably not all contacting residues in the CK2 holoenzyme are important for the strong subunit interactions. Detailed analysis is necessary to elucidate amino-acid residues in the regulatory subunit, which are crucial and sufficient to form CK2 holoenzyme. Mutational a nalysis [ 37] o f f unctionally im portant domains in the b subunit has shown that the acidic region Fig. 5. Immunoprecipitation of the CK2btes–b-galactosidase fusion protein from testes extract by anti-CK2a Ig. Protein extracts from testes of transgenic males expressing b-galactosidase alone (lanes 1) or CK2btes–b-galactosidase fusion protein (lane 3) were precipitated by anti-CK2a Ig. The IP complexes were bound to protein-A–Sepharose, washed, separated by SDS/PAGE followed by Western analysis and immunostaining with polyclonal anti-(b-galactosidase) Ig (lanes 2 and 4, resp ectively). T, testes extract; IP, immunoprecipitated complexes bound to protein-A–Se pharose afte r washing. P ositions of CK2btes– b-galactosidase or b-galactosidase alone are indicated to the right. Fig. 6. Testis-specific transciption of CK2b¢ gene. Approximately equal amounts of total RNA isolated from carcasses (male body remnants after removal of testes), testes, embryos, larvae, pup ae an d fem ales wereelectrophoresedin1%formaldehydegel,blottedtoHybond-N membrane, an d hybridiz ed with either CK2b¢ probe (upper pane l) or rp49 probe (lower panel). Hybridization signal with the CK2b¢ probe was detected only in the testes RNA. 1424 A. I. Kalmykova et al. (Eur. J. Biochem. 269) Ó FEBS 2002 (residues 55–64), which is highly conservative among b subunits from different organisms, is responsible for the downregulation of catalytic activity of a subunit toward calmodulin and for the activation by polybasic compounds. The examination of amino-acid alignment in the acidic region of three Drosophila CK2 regulatory subunits (Fig. 7) reveals the lack of two charged residues (Glu57 and Asp60) in the btes sequence, which might be responsible for less pronounced CK2btes-mediated effects on the calmodulin phosphorylation by an asubunit. The b¢ subunit has more significantly reduced negative charge density in the acidic region than btes subunit (Fig. 7), but it is still able both to suppress calmodulin phosph orylation and mediate activa- tion by polylysine and protamine [20]. Further structural studies are required to unravel mechanism of this regula- tion. In the previous studies it was shown that Drosophila possesses tandemly repeated Stellate genes e ncoding a protein with striking sequence similarity to the CK2 b subunit [38]. Moreover, i n the in vitro assay it was demonstrated that the Stellate protein, although used in at least 10-fold molar excess, was able t o bind to and stimulate t he phosphorylation activity of the CK2 a subunit [39]. The functional homology of the Stellate protein with the CK2 b subunit rises the f ormal possibility t hat the Stellate protein may take part in the CK2 regulation. Nevertheless, all experimental evidences have shown that the S tellate protein is absent in normal males [38, 39]. Stellate genes are expressed only in testes of the X0 males, or males lacking the cry locus on the Y-chromosome. In this case the accumulated Stellate protein forms proteinaceous crystals in primary spermatocytes of the cry-defic ient males, thus disturbing the spermatogenesis. Therefore, Stellate protein c ould not be viewed as an additional testis-specific isoform of the CK2 r egulatory subunit in normal males. The CK2 regulatory subunit is ubiquitous among eukaryotes, but an amino-acid sequence of different b sub- units is far less conservative as compared to the CK2 a subunits. This fact might be referred to the sup posed function of b subunit as the regulator of substrate specificity and targeting of the CK2 holoenzyme in cells. It is suggested that greater variability and specificity is required for the realization of these functions. Recent discovery of two distinct b subunit genes in S. c erevisiae and three genes in A. thaliana rises a possibility that different b subunits may serve to provide different substrate specificity or targeting of the CK2 holoenzyme in cells [16, 17]. Our data extend this suggestion showing that some b subunits are specialized for a specific tissue. It seems likely that Drosophila CK2btes and CK2 b¢ subunit genes were evolutionary adapted for spermatogenesis. As was shown earlier [12], quantity of the b subunit reaches its maximum in the testicles of mammals, as compared to other tissues. On the other hand, in Drosophila the ubiquitous CK2 b subunit gene is poorly expressed in testes [18]. Therefore, the supposed requirement of massive b subunit production during spermatogenesis is resolved by different ways in Drosophila and in mammals: while mammals utilitize the upregulation of expression of a single b subunit gene, the fruit fly has generated in evolution two specialized genes f or this purpose. Despite the accumulation of large amount of information about it, CK2 remains an enigmatic enzyme. Its un- doubtedly crucial role in signalling is based only on a variety of indirect observations, rather than on clear evidence of cause-and-effect relations. Xu et al.[14]have shown that the CK2 activity was essential for the spermato- genesis in mammals. The gene Ôknock-outÕ of the CK2 a¢ subunit in mice resulted in male sterility without any other physiological defects. In S . cerevisiae , the deletions of both CK2 a and a¢ subunit genes appeared to be lethal [40], whereas, the disruption of CK2b,orCK2b¢, or both resulted in no phenotype or morphology alterations except the elevated sensitivity to salt concentration in the medium [34]. Thus, the question concerning vital functions of the CK2 b subunits in higher eukaryotes is still open. We tried to address this issue on the model of spermato- genesis in Drosophila by making a Ôknock-downÕ of the CK2btes gene by means of the RNAi mechanism. This approach has been applied recently in Drosophila for disruption of gene function as an alternative to the classical mutational analysis [41]. To use such an approach, we generated transgenic flies transcribing in testes the ÔantisenseÕ CK2btes RNA under the control of the b2-tubulin promo- ter. We hoped that this RNA would anneal in vivo to the CK2btes mRNA t hus forming dsRNA, a nd that this would lead to the CK2btes mRNA degradation. In fact, we observed a detectable decrease in the CK2btes mRNA and protein level (2–4 times lower) in testes of transgenic males when the Drosophila stock w as maintained at 28 °C, while no effect on amount of RNA and protein was observed at 18 °C (not shown). The example of temperature sensitivity of the RNAi effect was already described in Drosophila [42] but the molecular mechanism underlying it is unclear. Nevertheless, we were able to Ôknock-downÕ to some extent the CK2btes gene in Drosophila testes, althought it should be mentioned that this effect was rather unreproducible. These unreproducible variations in the degree of the CK2btes protein drop down did not allow us to make any conclusions concerning the influ ence of the CK2btes decrease on the Drosophila male fertility. Recent evidence for the existence of a Ôfree Õ fraction of the CK2 b subunit in mouse testicles [12] implicates a new role for the b subunit in spermatogenesis, a part from the regulation of CK2 catalytic activity. It is known that the CK2 b subunit might specifically, but with lower strength, interact with some partner proteins, other t han CK2 a subunit. These interactive partners are represented, for example, by A-raf and Mo s kinases [8–10]. If this is the case in Drosophila, the achieved decrease of the CK2btes p rotein level in testes of transgenic males might be insufficient to affect the CK2 activity, a s it could be compensated by the initial m olar excess of total pool of b subunits over the CK2 a subunit. Taking into account the CK2btes ability to form Fig. 7. Alignment of acidic region 55–64 in three Drosophila CK2 regulatory subunits. The GenBank accession numbers for t he se quen- ces shown are the following: D. melanogaster CK2b (M16535), D. melanogaster CK2b¢ (U51209), D. melanogaster CK2btes (L49382). Dashes indicate gaps introduced to improve the alignment. Ó FEBS 2002 Testis-specific isoform of CK2 regulatory subunit (Eur. J. Biochem. 269) 1425 heterodimers with other b subunits shown in ou r yeast two- hybrid system experiments, it is reasonable to suppose a possibility of a replacement of one b subunit by another i n the case of a deficiency of any of the subunits, i.e. a so called ÔbypassÕ mechanism may operate in order to maintain appropriate levels and targeting of CK2 activity in testes. In accordance with this hypothesis are our results showing that two to fourfold downregulation of the CK2btes gene in transgenic males does not lead to the noticeable decrease of total CK2 activity in testes (not shown). Drosophila CK2b- related genes expressed in testes undoubtedly require further investigation a s a system for understanding how evolution of structural properties i s responsible for subtle functional differences between related genes. ACKNOWLEDGEMENTS We are grateful to Dr C.V.C. Glover for providing us with the pEV55Dmß plasmid a nd the a nti-DmCK2a antiserum, and to Dr H .D. Hoyle for providing the testis vector. We wou ld like to thank P rof. N.B. Gusev for providing calmodulin and for fruitful advice. We thank B. Guerra for the help with gel filtration experiments and M. Silicheva for technical assistance. This work was supported by the Russian Founda- tion for Bas ic Researches Grants # 00 -15-97896 and # 03-04-48420, as well as by a FEBS short-term fellowship to A. I. K. and by an EMBO short-term fellowship (ASTF 9160) to Y. Y. S. REFERENCES 1. Allende, J.E. & Allende, C.C. (1995) Protein kinase CK2: an enzyme with multiple substrates and a puzzling regulation. FASEB J. 9, 313–323. 2. Pinna, L.A. & Meggio, F. (1997) Protein kinase CK2 (Ôcasein kinase-2Õ) and its implication in cell division and proliferation. Prog.CellCycleRes.3, 77–97. 3. Glover, C.V.C. (1998) On the physiological role of casein kinase II in Saccharomyces cerevisiae. Prog. Nucleic Acid Res. Mol. Biol. 57, 95–133. 4. Guerra, B. & Issinger, O G. (1999) Protein kinase CK2 and its role in cellular proliferation, development a nd pathology. Elec- trophoresis 20, 391–408. 5. Coqueret, O., Martin, N., Berube, G., Rabbat, M., Litchfield, D.W., Nepveu, A. (1998) DNA binding by Cut homeodomain proteins is down -regulated by casein kinase 2. J. Biol. Chem. 273, 2561–2566. 6. Liu, Z.P., Galindo, R.L., Wasserman, S.A. (1997) A role for CKII phosphorylation of the cactus PEST domain in dorsoventral patterning of the Drosophila embryo. Genes Dev. 11, 3413–3422. 7. Jaffe, L., Ryoo, H D., Mann, R.S. (1997) A role for phos- phorylation by casein kinase 2 in modulating Antennapedia activity in Drosophila. Genes Dev. 11, 1327–1340. 8. Boldyreff, B. & Issinger, O G. (1997) A-Raf kinase is a new interacting partner of protein kinase CK2 b subunit. FEBS Lett. 403, 197–199. 9. Hagemann,C.,Kalmes,A.,Wixler,V.,Wixler,L.,Schuster,T., Rapp, U.R. (1997) The regulatory subunit of protein kinase CK2 is a specific A-Raf activator. FEBS Lett. 403, 200–202. 10. Chen, M. & Cooper, J.A. (1997) The b-subunit of CKII negatively regulates Xenopus oocyte matu ration. Proc. Natl Acad. Sci. USA 94, 9136–9140. 11. Lu ¨ scher, B. & Litchfield, D. (1994) Biosynthesis of casein kinase II in lymphoid cell lines. Eur. J. Biochem. 220, 521–526. 12. Guerra, B., Siemer, S., Boldyreff, B., Issinger, O G. (1999) Protein kinase CK2: evidence for a protein kinase CK2b subunit fraction, devoid of the catalytic CK2a subunit, in mouse brain and testicles. FEBS L ett. 462, 353–357. 13. Diaz-Nido, J., Mizuno, K., Nawa, H., Marshak, D.R. (1994) Regulation of protein kinase CK2 isoform expression during rat brain d evelopm ent. Cell. Mol. Biol. Res. 40, 581–585. 14. Xu, X., Toselli, P.A., R ussel, L.D., Seldin, D.C. (1999) Globo- zoospermia in mice lacking the casein kinase II a catalytic subunit. Nat. Genet. 23, 118–121. 15. Fuller, M.T. (1998) Genetic control of cell proliferation and dif- ferentiation in Drosophila spermatogenesis. Semin. Cell. Devel. Biol. 9, 433–444. 16. Reed, J.C., Bidwai, A.P., Glover, C.V.C. (1994) Cloning and disruption of CKB2, the gene encodin g the 32-kDa regulatory b-subun it of Saccharomyces cerevisiae casein kinase II. J. Biol. Chem. 269, 18192–18200. 17. Sugano, S., Andronis, C., Green, R.M., Wang, Z Y., Tobin, E.M. (1998) Protein kinase CK2 interacts with and phosphorylates the Arabidopsis circadian clock-associated 1 protein. Proc. Natl Acad. Sci. US A 95, 11020–11025. 18. Kalmykova, A.I., Shevelyov, Y.Y., Dobritsa, A.A., Gvozdev, V.A. (1997) Acquisition and amplification of a testis expressed autosomal gene, SSL,bytheDrosophila Y chro mosome. Proc. Natl Aca d. Sci. USA 94, 6297–6302. 19. Kalmykova, A.I., Dobritsa, A.A., Gvozdev, V.A. (1997) The Su (Ste) repeat in the Y chromosome and bCK2tes gene encode predicted isoforms of regulatory b-subunit of protein kinase CK2 in Drosophila melanogaster. FEBS Lett. 416, 164–166. 20. Bidwai, A.P., Zhao, W., Glover, C.V.C. (1999) A gene located at 56F1-2 in Drosophila melanogaster encodes a novel metazoan b-like subunit of casein kinase II. Mol. Cell. Biol. Res. Commun. 1, 21–28. 21. Saxena, A., Padmanabha, R., Glover, C.V.C. (1987) Isolation and sequencing of cDNA clones encoding a and b subunits of Dro- sophila melanogaster casein kinase II. Mol. Cell. Biol. 7, 3409– 3417. 22. Thummel, C.S., Boulet, A.M., Lipshitz, H.D. (1988) Vectors for Drosophila P-element-mediated transformation and tissue culture transfection. Gene 74, 445–456. 23. Hoyle, H.D. & Raff, E.C. (1990) Two Drosophila b tubulin iso- forms are not functionally equivalent. J. C ell Biol. 111, 1009–1026. 24. Birnbaum, M.J., Jianguo, W., O’Reilly, D.R., Rivera-Marrero, C.A., Hanna, D.E., Miller, L.K., Glover, C.V.C. (1992) Expres- sion and purification of the a and b subunits of Drosophila casein kinase II using a baculovirus vector. Prot.Exp.Purif.3, 142–150. 25. Chomczynsky, P. & Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium th iocyanate- phenol-ch loroform extraction. Anal. Biochem. 162, 156–159. 26. Sambrook, J., Fritsch, E.F., M aniatis, T. (1989) Molecular Clo- ning. A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA. 27. O’Connel, P.O. & Rosbash, M. (1984) Sequence, structure and codon preference of the Drosophila ribosomal protein 49 gene. Nucleic Acids Res. 12, 5495–5513. 28. Spradling, A.C. (1986) P-element-mediated transformation. In Drosophila, a Practical Approach (Roberts, D.B., ed.), 1 78–197. IRL P re ss, Oxford, UK. 29. Michiels, F., Gasch, A., Kaltschmidt, B., Renkawitz-Pohl, R. (1989) A 14 bp promoter element directs the testis specificity of the Drosophila b2 tubulin gene. EMBO J. 8, 1559–1565. 30. Yang, J., Porte r, L., Rawls, J. (1995) Expression of the dihydroorotate dehydrogenase gene, dhod, during spermato- genesis i n Drosophila melanogaster. Mol. Gen. Genet. 246, 3 34–341. 31. Nurminsky, D.I., Nurminskaya, M.V., De Aguiar, D., Hartl, D.L. (1998) Selective sweep of a newly evolved sperm-specific gene in Drosophila. Nature 396, 572–575. 32. Bidwai, A.P., Reed, J.C., Glover, C.V. (1993) Phosphorylation of calmodulin by the catalytic subunit of casein kinase II is inhibited by the regulatory subunit. Arch. Biochem. Bioph ys. 300, 265–270. 1426 A. I. Kalmykova et al. (Eur. J. Biochem. 269) Ó FEBS 2002 33. Meggio, F., Boldyreff, B., Marin, O., Marchiori, F., Perich, J.W., Issinger, O G., Pinna, L.A. (1992) The effect of polylysine on casein-kinase-2 activity is influenced by both the structure of the protein/peptide substrates and the subunit composition of the enzyme. Eur. J. Biochem. 205, 939–945. 34. Bidwai, A.P., Reed, J.C., Glover, C.V. (1995) Cloning and dis- ruptionofCKB1,thegeneencodingthe38-kDab subunit of Saccharomyces cerevisiae casein kinase II (CKII). Deletion of CKII regulatory subunits elicits a salt-sensitive phenotype. J. Biol. Chem. 270, 10395–10404. 35. Gietz, R.D., Graham, K.C., Litchfield , D.W. (1995) Interaction s between the subunits of casein kinase II. J. Biol. Chem. 270, 13017–13021. 36. Niefind, K., Guerra, B., Ermakowa, I., Issinger, O G. (2001) Crystal structure of human protein kinase CK2: insights into basic properties of the CK2 holoenzyme. EMBO J. 20, 5320–5331. 37. Meggio, F., Boldyreff, B., Issinger, O G., Pinna, L.A. (1994) Casein kinase 2 down-regulation and activation by polybasic peptides are mediated by acidic residues in the 55–64 region of the b-su bunit. A study with calmod ulin as phosphorylatable sub- strate. Biochemistry 33, 4336–4342. 38. Livak, K.J. (1990) Detailed structure of the Drosophila mela- nogaster Stellate genesandtheirtranscripts.Genetics 124, 303– 316. 39. Bozzetti, M.P., Massari, S., Finelli, P., Meggio, F., Pinna, L.A., Boldyreff,B.,Issinger,O G.,Palumbo,G.,Ciriaco,C.,Bonac- corsi, S., Pimpinelli, S. (1995) The Ste locus, a component of the parasitic cry-Ste system o f Drosophila melanogaster, encodes a protein that forms crystals in primary spermatocytes and mimics properties of the b subunitofcaseinkinase2.Proc. Natl Acad. Sci. USA 92, 6067–6071. 40. Padmanabha, R., Chen-Wu, J.L., Hanna, D.E., Glover, C.V. (1990) Isolation, sequencing, and disruption of the yeast CKA2 gene: c asein kinase II is essential for viability in Saccharomyces cerevisiae. Mol. Cell. Biol. 10, 4089–4099. 41. Misquitta, L. & Paterson, B .M. (1999) Targeted disruption of gene function in Drosophila by RNA interference (RNA-i): a role for nautilus in embryonic somatic muscle formation. Proc. Natl Acad. Sci. USA 96, 1451–1456. 42. Fortier, E. & Belote, J.M. (2000) Temperature-dependent gene silencing by an expressed inverted repeat in Drosophila. Genesis 26, 240–244. Ó FEBS 2002 Testis-specific isoform of CK2 regulatory subunit (Eur. J. Biochem. 269) 1427 . CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster Alla I. Kalmykova 1 , Yuri Y. . replacement of one b subunit by another i n the case of a deficiency of any of the subunits, i.e. a so called ÔbypassÕ mechanism may operate in order to maintain appropriate