the controller queries the content provider with a managedquery on the content provider model
The Project Gutenberg eBook, American Addresses, with a Lecture on the Study of Biology, by Thomas potx
... day was signalised by the apparition of the sun, the stars, the moon, and the planets; that, on the fifth day, aquatic animals originated within the waters; that, on the sixth day, the earth gave ... the space of six natural days, in such a manner that, on the first of these days, light appeared; that, on the second, the firmament, or sky, separated the waters above, from the waters beneath ... that these operations of degradation and elevation might compensate each other; and that thus, for any assignable time, the general features of our planet might remain what they are And inasmuch...
- 330
- 324
- 0
báo cáo khoa học: "The occurrence and management of fluid retention associated with TKI therapy in CML, with a focus on dasatinib" pptx
... Khorashad JS, Gabriel IH, Chaidos A, Olavarria E, Goldman JM, Apperley JF, Marin D: Pleural effusions in patients with chronic myeloid leukaemia treated with dasatinib may have an immune-mediated pathogenesis ... years) and/ or patients with advanced CML disease The CML Program is sponsored by a grant from the Norris Foundation The authors take full responsibility for the content of the paper but thank ... side effects associated with dasatinib therapy are predominantly mild or moderate (grade or by the National Cancer Institute Cancer Therapy Evaluation Program criteria), and are self-limiting...
- 6
- 337
- 0
The herpetofauna of the peruvian dry forest along the andean valley of the marañón river and its tributaries, with a focus on endemic iguanians, geckos and tegus
... Porculla (Duellman 1979; Duellman & Pramuk 1999) along the flanks of the Chinchipe, Chamaya, Huancabamba and Utcubamba rivers and tributaries (Regions Piura, Cajamarca, Amazonas) southwards along the ... in Balsas, in the Southern part of the Region Amazonas, in Chacanto, Region Cajamarca and in various localities in the Region La Libertad (San Vicente/Pusac, Santa Rosa/El Tingo, Vijus, Chagual, ... Pramuk 1999, Brack 2004) The Huancabamba Depression in the Piura, Cajamarca, Amazonas and San Martin Regions is the major structural and physiographic break of the Andes consisting of a complex system...
- 264
- 492
- 0
PUBLIC PERCEPTIONS OF URBAN AIR POLLUTION WITH A FOCUS ON DEVELOPING COUNTRIES potx
... Saksena Sumeet Saksena is a Fellow in the Research Program at the East-West Center He is also Affiliate Faculty at the Department of Urban And Regional Planning, University of Hawai`i at Manoa ... Perceptions about the health effects of air pollution There has been a realization in the recent times that health impacts are a major way by which people realize the extent of the risks associated with ... technical terms and jargons made the information seem irrelevant to people The issue of spatial scale is important too – people cannot relate to regional or national statistics, but demand local statistics...
- 32
- 381
- 0
Báo cáo khoa học: "Historical Analysis of Legal Opinions with a Sparse Mixed-Effects Latent Variable Model" potx
... because that SVM, as a strong large margin learner, is a more natural approach in a binary classification setting, but might not be the best choice in a fourway or multiclass classification task ... This model is built on the state-of -the- art in latent variable mod- 747 Figure 6: Comparison with Wahl (2002) classification elling and extends that model to a setting where metadata is available ... variable that captures the interactions among the region, time and topic latent variables We also introduce a multiclass perceptron-style weight estimation method to model the contributions...
- 10
- 290
- 0
báo cáo sinh học:" Information needs of health care workers in developing countries: a literature review with a focus on Africa" doc
... churchowned primary health care facilities in Dar Es Salaam and other Tanzanian coast regions East Afr Med J 2001, 78(10):510-514 Ratanawijitrasin S, Soumerai SB, Weerasuriya K: Do national medicinal drug ... problems with understanding and/or implementation of international and/or national guidelines The South Africa study, mentioned above, looked at national guidelines Also a review on India and diabetes, ... investigate further the link between lack of information and feelings of professional isolation and general dissatisfaction among rural health workers How important is lack of information as a contributing...
- 13
- 558
- 0
ICTs for e-EnvironmentGuidelines for Developing Countries, with a Focus on Climate Change pptx
... organizations There are many organizations to list under this heading, including: • National Aeronautics and Space Administration (NASA), National Oceanic and Atmospheric Administration (NOAA) and ... Meteorological Organization (WMO), the World Health Organization (WHO), the International Civil Aviation Organization (ICAO), and UN-Habitat Additional information on WSIS Action Line C7 on e-Environment ... such as Las Vegas, forest loss in the Amazon, rapid oil and gas development in Wyoming and Canada, forest fires across sub-Saharan Africa and the decline of the Aral Sea in Central Asia and Lake...
- 182
- 275
- 0
Báo cáo y học: " Paratuberculosis control: a review with a focus on vaccination" ppt
... with national tuberculosis eradication programs The latter is in fact the major hurdle affecting MAP vaccine approval for cattle by medical and agricultural authorities all over the world and the ... the avian tuberculin indicates infection or vaccination with avian type mycobacteria and allows to rule out mammal tuberculosis infection according to standardized criteria An additional drawback ... eradication a realistic goal? Is it necessary? Is it profitable for the society in general? Answers to these questions are not readily available because we lack accurate information on the actual...
- 17
- 512
- 0
Essays in modeling health care expenditures with a focus on singapore
... of Japan and Sweden, while under-five mortality rate of Germany is 4, Australia 5, U.K 6, Canada and U.S What makes Singapore’s achievement laudable is that it has done so at a fraction of the ... together with a program to educate Singaporeans on the “correct” attitude towards older persons in the community (Teo et al., 2003) A National 12 Advisory Council on Family and Aged (NACFA) was also ... Chronic Care Program and Primary Care Partnership Scheme are also in place 1.5 The Focus of the Thesis As discussed above, the ageing population is expected to have a sizeable impact on the health...
- 189
- 311
- 0
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx
... interaction with factor Xa brought about by the heparin pentasaccharide-mediated conformational change occurs through a combination of the changes in the structure of the RCL, allowing the interaction ... concentration of AT and the rates of interaction in the presence and absence of heparin pentasaccharide (Table 1), one can calculate that the half-life of enzyme activity in the absence of heparin pentasaccharide ... usually increasing the reaction rates from values that are not relevant under physiological conditions to rates that are relevant This control over the action of serpins that have the particular...
- 10
- 668
- 0
The World with a Thousand Moons pdf
... formula, and tried it on a gravitation-paralysis case a space-man who's lain paralyzed for years The formula was designed to strengthen the human nervous system against the shock of varying gravitations, ... was leading them They were as ignorant as babies of the dark evil and unearthly danger of the interplanetary frontier He hardened himself against the qualms of conscience There was that at stake, ... saved them The pirates needed a doctor They had kept the two brothers prisoner on their ship for that reason Kenniston and Ricky had still been on the Falcon as prisoners, when the Patrol had...
- 52
- 408
- 0
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx
... primers TEHA1: ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG ... this leakage, the analyzed differences in mRNA levels most probably are a slight misrepresentation of the total mRNA levels within the cell at harvest One reason for the spread in the amount ... et al sequence verified and named pAff8eGFPLacUV5 and pAff8eGFPTrc, respectively The gene for the T7 promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGATCCCGCGAAATTAATAC and...
- 11
- 445
- 0
Đề tài " The distribution of integers with a divisor in a given interval " ppt
... to lie all above their expected values An analogy from probability theory is to ask for the likelihood that a random walk on the real numbers, with each step haveing zero expectation, stays completely ... constant support and many helpful conversations about the paper Much of this paper was written while the author enjoyed the hospitality of the Institute of Mathematics and Informatics, Bulgarian Academy ... 3, and in Section The first step in all estimations is to relate the average behavior of τ (n, y, z), which contains local information about the divisors of n, with average behavior of functions...
- 68
- 409
- 0
SIMPLE OPEN ECONOMY MACRO WITH COMPREHENSIVE ACCOUNTING A RADICAL ALTERNATIVE TO THE MUNDELL FLEMING MODEL ppt
... sequentially through time on their way towards a full steady state The main properties of the model solutions are revealed in the following charts There is a particular interest in confronting the major ... IS-LM model itself), while the money supply” plays a key role, money has no accounting relationship to any other variable The model also contains no explicit analysis of what happens when either ... exports, wealth and its allocation between the available assets and the exchange rate are all endogenously determined When the exchange rate changes, this changes the import propensity, disposable...
- 13
- 491
- 0
Báo cáo khoa học: The crystal structure of NlpI A prokaryotic tetratricopeptide repeat protein with a globular fold potx
... the failure of an isolated motif to form critical intra- and intermolecular contacts These observations demonstrate the capacity, and on occasion the necessity, of TPRs to participate at all levels ... by the W M Keck Core Facility (Yale University, New Haven, CT, USA) Primers to amplify mature NlpI (residues 20–294) were 5¢-aataatccatggggagtaatacttcctggcgta aaagtgaagtcc-3¢ and 5¢-attattggatccctattgctggtccgattctgccag-3¢ ... NlpI A C G M Wilson et al B D E C F Fig Contact map of mature NlpI and packing interactions (A) Backbone (upper left from diagonal) and side chain (lower right from diago˚ nal) contacts within A...
- 14
- 433
- 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
... considerably longer than the above and suggesting a weaker interaction with the positive charge on the heme-iron It could be speculated that wat3, adjacent to the M100 ˚ ligand at a distance of 6.0 A ... data collection and refinement are summarized in Table The program procheck [34] was used to analyse conformational variations from the defined norms, with the quality of the Ramachandran plots [35] ... in ligand-exchange at alkaline conditions Despite this, no conformational ligand switching is observed at alkaline pH for the M100K variant This contrasts with the unfolding data accumulated in...
- 15
- 509
- 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt
... software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured bond cleavage frequencies The calculations are based on the equation: DGl þ À ... can vary according to the calculations The primary calculated subsite energy values can be refined to the best agreement of the measured and recalculated BCF data by the iteration Fig shows the ... followed by a barrier subsite The action of barley a- amylase on amylose as substrate was also studied earlier by MacGregor & MacGregor [20] and a ‘6 + model was proposed Our calculations seem to...
- 6
- 387
- 0
Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx
... a- helix content, as a function of water percentage in the mixture The ellipticity increases with the water concentration, reaching a plateau at approximately 20% water Correspondingly, the helix content, ... described as a random coil, with only a small population of local nonrandom structures Overall, these data indicate that bulk water is not suitable for high resolution conformational analysis of Ab ... constant (e ¼ r) was used The cut-off ˚ for non–bonded interactions was 12 A At this stage, the protonation states of the amino acid side chains were chosen to correspond to a low pH value, on account...
- 7
- 624
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008