Enhancing the protein production levels in Escherichia coli with a strong promoter Hanna Tegel, Jenny Ottosson and Sophia Hober School of Biotechnology, Department of Proteomics, Royal Institute of Technology, AlbaNova University Center, Stockholm, Sweden Keywords Escherichia coli; promoter; protein production; transcription; translation Correspondence S Hober, School of Biotechnology, Division of Proteomics, Royal Institute of Technology, AlbaNova University Center, 106 91 Stockholm, Sweden Fax: +46 55378481 Tel: +46 55378330 E-mail: sophia.hober@biotech.kth.se (Received July 2010, revised December 2010, accepted 10 December 2010) doi:10.1111/j.1742-4658.2010.07991.x In biotechnology, the use of Escherichia coli for recombinant protein production has a long tradition, although the optimal production conditions for certain proteins are still not evident The most favorable conditions for protein production vary with the gene product Temperature and induction conditions represent parameters that affect total protein production, as well as the amount of soluble protein Furthermore, the choice of promoter and bacterial strain will have large effects on the production of the target protein In the present study, the effects of three different promoters (T7, trc and lacUV5) on E coli production of target proteins with different characteristics are presented The total amount of target protein as well as the amount of soluble protein were analyzed, demonstrating the benefits of using a strong promoter such as T7 To understand the underlying causes, transcription levels have been correlated with the total amount of target protein and protein solubility in vitro has been correlated with the amount of soluble protein that is produced In addition, the effects of two different E coli strains, BL21(DE3) and Rosetta(DE3), on the expression pattern were analyzed It is concluded that the regulation of protein production is a combination of the transcription and translation efficiencies Other important parameters include the nucleotide-sequence itself and the solubility of the target protein Introduction Recombinant protein production in bacteria represents a common strategy for obtaining large amounts of a protein of interest Although the use of Escherichia coli has a long tradition in biotechnology, it is still not a trivial task to determine the optimal production conditions for all proteins A system that is optimal for the production of one protein might be nonfunctional for another Apart from the conditions of temperature and induction, the choice of promoter, bacterial strain and the solubility of the target protein are other parameters that affect total protein production, as well as the amount of soluble protein Commonly used promoters in E coli include the T7 promoter, which originates from bacteriophage T7 [1] and the E coli lac promoter [2], as well as its modified form lacUV5 [3] The synthetic trc promoter [4], derived from the E coli trp and lacUV5 promoters, is also commonly used The strength of the different promoters is determined by the relative frequency of transcription initiation This is mainly affected by the affinity of the promoter sequence for RNA polymerase T7 RNA polymerase is very selective and efficient, resulting both in a high frequency of transcription initiation and effective elongation These features result Abbreviations ABP, albumin binding protein; eGFP, enhanced green fluorescent protein; His6, hexahistidyl tag; PrESTs, protein epitope signature tags; SD, Shine–Dalgarno FEBS Journal 278 (2011) 729–739 ª 2011 The Authors Journal compilation ª 2011 FEBS 729 Protein production levels in E coli H Tegel et al in an RNA elongation that is approximately five-fold faster than for E coli RNA polymerase; hence, the T7 promoter is a much stronger promoter than the E coli promoters [5] The T7 system is also very tightly regulated as a result of the two-step process: the gene encoding the T7 RNA polymerase that is able to bind and start transcription from the T7 promoter (the Ø10 promoter from Bacteriophage T7) is positioned in the E coli genome and governed by the lacUV5 promoter [1] Another important criterion when choosing a suitable promoter, apart from strength, is the level of basal transcription A tightly regulated promoter has a minimal level of basal transcription, which is particularly important if the protein of interest is toxic or harmful for the host cell [6] A drawback to the trc promoter is the high basal level of transcription [7] To further reduce the basal level of the T7 system, different approaches could be used For example, a lac operator could be added downstream of the T7 promoter region [8] Another means of regulating the total mRNA production is via the number of DNAcopies ⁄ plasmids available for transcription To direct this, different origins of replication [7] are used The choice of bacterial strain also affects protein production An E coli strain frequently used for routine protein production is BL21 [7] To overcome problems related to recombinant protein production, this strain has been modified for different purposes Derivatives of BL21 include strains that decrease the protease activity and enhance cytoplasmic disulfide bond formation, as well as strains with a more efficient protein folding [9] One commonly used BL21 strain is BL21(DE3) This strain has an insert on the chromosome encoding the T7 RNA polymerase controlled by a lacUV5 promoter This feature allows the use of the T7 promoter Another problem when producing human proteins in E coli relates to differences in codon usage between the two organisms This difference can lead to translational errors and reduced production levels of recombinant protein [9] To overcome the codon bias, genes encoding rare tRNAs can be co-expressed, as in the case of Rosetta(DE3) (Novagen, Merck, Darmstadt, Germany) The solubility of a protein is often of interest in protein science, especially in structural genomics where soluble proteins are a requirement for obtaining information about the 3D structure [10] Several inherent parameters affect the solubility of a protein, such as folding velocity and hydrophobicity When proteins are produced, the synthesis rate of the protein may affect the proportion of soluble protein Previously, it was reported that a decreased protein synthesis rate 730 (e.g by using a weaker promoter) gives a higher yield of soluble and correctly folded protein [7] Great efforts have been made with respect to the development of high throughput methods for the production and purification of recombinantly produced proteins Different methods for cloning, production and analyses have been developed [11–16] Moreover, purification tags, their positions in relation to the target protein and their effect on productivity and solubility have been evaluated [17] In the present study, the effects of three different promoters (T7, trc and lacUV5) on E coli production of target proteins with different characteristics are presented Protein fragments fused to a hexahistidyl tag (His6) and an albumin binding protein (ABP) were produced, both alone and fused to enhanced green fluorescent protein (eGFP), under the control of the three different promoters The total amount of target protein as well as the amount of soluble protein was analyzed, demonstrating the benefits of using a strong promoter such as T7 To understand the underlying causes, transcription levels have been correlated with the total amount of target protein and protein solubility in vitro has been correlated with the amount of soluble protein that is produced In addition, the effects of two different E coli strains, BL21(DE3) and Rosetta(DE3), on the expression pattern were analyzed Results To investigate how different promoters affect protein production and the solubility of the target protein, a set of 16 protein epitope signature tags (PrESTs) was chosen (Table and Doc S1) PrESTs are short regions of human proteins with low similarity to all other human proteins, without transmembrane regions and signal peptides [18] These protein tags are used for immunization aiming to acquire antibodies directed to the human full-length protein Produced and purified antibodies are used for annotation of the human proteome (relevant data are available at: http: ⁄ ⁄ www.proteinatlas.org) The PrESTs were fused with eGFP into vectors with three different promoters; T7, trc and lacUV5 (Doc S2) Upstream of the PrEST, all proteins contained a His6-tag followed by ABP All constructs were transformed into E coli BL21(DE3) and fifteen of the constructs also into E coli Rosetta(DE3) Protein production in shake flasks was performed to assess the different expression patterns It was not necessary to use BL21(DE3)-based strains when proteins were produced under the control of the trc and lacUV5 promoters because the main purpose of the strain modifications was to create an FEBS Journal 278 (2011) 729–739 ª 2011 The Authors Journal compilation ª 2011 FEBS H Tegel et al Protein production levels in E coli Table Summary of the proteins, their characteristics and production levels in E coli BL21(DE3) Proteins A–P correspond to the PrEST part of the His6-ABP-PrEST-eGFP fusion protein For the exact nucleotide and amino acid sequences of each PrEST, see Doc S1 Solubility class is defined as described in the Materials and methods, with group as the most insoluble and group as the most soluble The symbols shown are the same as those used in Figs and The amount of produced protein for 17 different fusion proteins under the control of three different promoters is summarized In addition, the amount of soluble target protein is shown All values for the amount of protein are adjusted to cell density and normalized to the highest production value (total amount for protein F under the control of the T7 promoter) The fraction of soluble protein is shown on the right The average error based on two separately cultured samples was 0.031 (T7), 0.011 (trc) and 0.084 · 10)3 (lacUV5) for the total amount of protein; 0.0012 (T7), 0.00049 (trc) and 0.057 · 10)3 (lacUV5) for the amount of soluble protein; and 0.0075 (T7), 0.0034 (trc) and 0.027 (lacUV5) for the soluble fraction NA, Not Applicable Total (· 103) Solubility class Protein A B C D E F G H I J K L M N O P Q Accession number (Uniprot) P00480 P01033 P78540 B7Z3I5 P00441 B6ZDM2 Q6PKC0 P10600 Q13023 Q99714 P00740 P00740 Q9NSI8 P50990 P01040 Q6ZNE5 His6ABP eGFP Gene name Without eGFP With eGFP OTC TIMP1 ARG2 EVL SOD1 C14orf135 GMPR2 TGFB3 AKAP6 HSD17B10 F9 F9 SAMSN1 CCT8 CSTA KIAA0831 5 1 5 3 2 3 2 3 Soluble (· 103) Soluble fraction (%) Symbol T7 trc lacUV5 T7 trc lacUV5 T7 trc lacUV5 Ô 330 3.6 230 41 270 1000 280 290 380 470 530 330 430 390 640 390 660 79 0.46 66 39 140 340 72 55 95 160 120 120 77 88 210 110 160 0.29 0.43 0.44 1.5 1.4 1.2 0.20 0.46 1.7 0.81 0.23 0.35 0.41 0.30 1.5 0.48 1.8 2.9 0.21 2.1 19 9.6 8.6 3.2 5.2 3.9 4.5 9.0 8.9 4.5 3.1 9.4 14 51 1.5 0.10 1.1 9.4 6.3 3.2 1.9 1.7 1.2 1.4 2.4 2.6 1.3 1.0 4.4 4.6 15 0.16 0.26 0.33 1.3 1.3 0.83 0.15 0.41 0.054 0.64 0.14 0.22 0.29 0.21 1.3 0.40 1.6 0.91 6.2 0.95 48 3.5 0.85 1.1 1.8 1.0 1.0 1.7 2.7 1.1 0.80 1.5 3.7 7.7 1.9 23 1.6 24 4.8 0.95 2.6 2.9 1.2 0.90 2.0 2.1 1.7 1.1 2.1 4.0 9.5 53 65 74 89 93 72 76 87 3.1 79 60 61 70 70 89 83 91 j NA NA m NA NA NA NA – NA + · NA • NA NA inducible expression of T7 RNA polymerase However, to minimize the differences in behavior both during cultivation and in the fluorescence activated cell sorting measurements, the same strain was used for all promoters In addition to the direct induction of the trc and lacUV5 promoters, expression of T7 RNA polymerase is anticipated but, because T7 RNA polymerase by itself is not toxic to the E coli cells and only recognizes the T7 promoter, this should not interfere with the transcription initiated by the trc and lacUV5 promoters [1] Analysis of the total amount of produced protein For analysis of protein production, cells from the cultures were disrupted and separated into a soluble and an insoluble fraction by centrifugation Both fractions were analyzed by SDS ⁄ PAGE and western blotting using quantityone software (Bio-Rad Laboratories, Hercules, CA, USA) (Fig 1A) The amount of target protein was correlated with the amount of cells loaded and to protein samples with a known concentration The relative amount of produced protein, normalized according to cell density, is presented in Table As expected, the data show that protein production under the control of the T7 promoter gives the largest total amount of target protein, whereas lacUV5 gives the lowest A large difference between different proteins produced under the control of the same promoter could also be detected To determine whether the transcription rate is only dependent on the three different promoters or whether the transcription rate is also sequence-dependent, realtime PCR was used to compare the number of mRNA molecules before and after induction Even more importantly, the impact of mRNA levels on protein production was investigated Five His6-ABP-PrESTeGFP constructs (chosen to represent proteins with different solubilities and production levels) under the control of the three different promoters were produced and samples were taken to determine the fold change of mRNA caused by the induction Figure 1B shows that the fold change of mRNA after induction is correlated with the amount of target protein that is produced Again, all data were normalized according to cell density As seen in Fig 1, the transcription levels FEBS Journal 278 (2011) 729–739 ª 2011 The Authors Journal compilation ª 2011 FEBS 731 Protein production levels in E coli H Tegel et al Table Summary of results from the codon analysis A T7 trc lacUV5 T7 trc lacUV5 Protein Number of codons Number of rare codons Number of AGG and AGA codons A E J L O M1 106 121 120 126 80 11 12 12 M2 97.0 Target protein 66.0 45.0 30.0 20.1 14.4 Insoluble fraction Soluble fraction B 14 Fold change 12 140 10 120 0.000 0.001 0.002 0.003 Relative amount of produced protein Fold change 100 80 60 40 20 0.0 0.2 0.4 0.6 0.8 1.0 1.2 Relative amount of produced protein Fig Analysis of the total target protein production in E coli BL21(DE3), adjusted to cell density The mean amount of produced target protein was 6.6 mgỈ100 mL)1 culture for T7; 2.3 mgỈ100 mL)1 culture for trc; and 12 lgỈ100 mL)1 culture for lacUV5 For an explanation of protein symbols, see Table (A) An example of a representative SDS ⁄ PAGE for determination of protein production levels, western blotting (upper) and Coomassie stain (lower) analysis In each analysis, the insoluble and soluble fractions of six cell samples were analyzed For western blotting, the insoluble T7 and trc fractions were diluted : 1000 and the soluble T7 and trc fractions were diluted : 100 As a marker in the western blotting, a protein of known concentration was used; 100 ng was loaded in the first marker lane and 10 ng in the second marker lane Low molecular weight markers were used to identify protein sizes in the gel The target protein is indicated by an arrow (B) The correlation between mRNA fold change and amount of produced protein, normalized to the highest value, for five proteins under the control of the three promoters The fold change was calculated as the mean of three separate experiments in all cases but one For protein E under the control of lacUV5, an outlier by a factor of 7.8 was excluded Light grey, black and grey represent the T7, trc and lacUV5 promoters, respectively Inset: magnification showing data points representing the proteins that are produced the under the control of the lacUV5 promoter are dependent on the promoter used, and the relative order of these appears as expected, with the lacUV5 promoter giving the lowest change of mRNA level and the T7 promoter the highest However, the differences among the constructs including the T7 promoter are larger than expected both with respect to changes in 732 mRNA levels and the correlation between the amount of mRNA and protein With respect to mRNA concentration, protein L under the control of the T7 promoter showed a much higher fold change than the other proteins When repeated, the analyses resulted in diverse data for this protein, although the average fold change for protein L was clearly higher than for the other proteins One consideration worthy of note when studying the result shown in Fig 1B is the high level of basal transcription (promoter leakage) caused by the trc promoter Because of this leakage, the analyzed differences in mRNA levels most probably are a slight misrepresentation of the total mRNA levels within the cell at harvest One reason for the spread in the amount of protein that is produced could be the number of rare codons, which might stall the ribosome when translating the mRNA to an amino acid sequence Therefore, we also analysed the codon composition of the different proteins (Table 2) Both proteins J and O, which have a higher relative amount of produced protein, have a few rare codons, especially rare arginine codons Hence, the translation process in E coli BL21(DE3) is probably faster for these proteins than for proteins containing a higher amount of rare codons Analysis of the amount of soluble produced protein Apart from the analyses aiming to determine whether the total amount of produced protein is affected by different promoters, the present study investigated how different promoters affect the amount of soluble protein obtained Therefore, the fraction of soluble protein was analyzed Interestingly, the weakest promoter generates the largest fraction of soluble protein and vice versa and, generally, the fraction of soluble protein is very small when proteins are produced under the control of T7 or trc (Table 1) However, three of the proteins (B, D and I) differ from the rest regarding these aspects B and D both show a relatively large fraction of soluble protein when produced under the FEBS Journal 278 (2011) 729–739 ª 2011 The Authors Journal compilation ª 2011 FEBS H Tegel et al Impact of the solubility of the protein on the amount of soluble produced protein Because one aim of the present study was to assess information about protein solubility during protein production, the PrEST proteins used were chosen with the aim of covering a large span of different protein solubilities when produced as a fusion of His6-ABPPrEST One method that we wanted to use for the assessment of in vivo solubility was flow cytometric analysis, which takes advantage of the solubilitydependent fluorescence of GFP Because eGFP was fused to the C-terminus of the protein, it was of great importance to determine whether eGFP affects the solubility of the different target proteins The fusion proteins were therefore produced with and without eGFP, followed by immobilized metal ion affinity chromatography purification to determine the solubility by using an in vitro solubility test [19] All proteins were graded from to Class constitutes the most insoluble proteins and class represents the most soluble proteins As shown in Table 1, eGFP generally decreases the solubility of proteins belonging to classes with a high solubility and increases the solubility of proteins belonging to classes with a low solubility without eGFP In other words, eGFP appears to be a burden for highly soluble proteins, whereas it can increase the solubility of a poorly soluble protein The correlation between the amount of soluble produced protein and in vitro solubility data was assessed (Fig 2) Data providing information about the amount of soluble produced protein was obtained from the SDS ⁄ PAGE and western blotting analyses and compared with the data obtained when analyzing the same protein in vitro Because eGFP does affect the solubility, the solubility class used in this case is the one with eGFP As shown in Fig 2, there is a slight positive correlation between the relative amount of soluble protein and solubility class in vitro The proteins with 1.2 Relative amount of soluble protein control of the stronger promoters When the trc promoter is used, these two proteins show equally large fractions of soluble protein, whereas D is the only protein with a large soluble fraction under the control of T7 On the other hand, protein I appears to be very insoluble even under the control of lacUV5 Although the fraction of soluble protein is very interesting, it is still the amount of soluble protein that is most important Table shows the relative amount of soluble protein correlated with cell density It is clear that, even though lacUV5 gives the largest fraction of soluble protein, T7 is the promoter that gives the largest amount of soluble protein Protein production levels in E coli T7 trc lacUV5 1.0 0.8 0.6 0.4 0.2 0.0 Solubility class with eGFP Fig The correlation between the relative amount of soluble protein in E coli BL21(DE3), normalized to the highest value, and the in vitro solubility class with eGFP higher protein solubility class are more likely to yield a higher amount of soluble protein Interestingly, this correlation is independent of the choice of promoter Comparison of protein production in E coli BL21(DE3) versus Rosetta(DE3) Because the PrEST parts of the fusion proteins are derived from the human genome and there is a codon difference between human and E coli, it is interesting to determine whether the expression pattern differs when the production is made in E coli Rosetta(DE3), a strain that, as a result of additional genetic information, compensates for the tRNAs commonly used by eukaryotes Five of the fusion proteins, under the control of all three different promoters, were therefore transformed into Rosetta(DE3) cells, produced and analyzed The total amount of produced protein was analyzed and compared with the results obtained after production in BL21(DE3) cells As shown in Table 3, the two strains give the same expression pattern when comparing the different promoters with each other However, Rosetta(DE3) generates a larger amount of produced protein irrespective of the promoter In an attempt to explain the increased production when using Rosetta(DE3), the occurrence of rare codons within each PrEST sequence was compared with the amount of produced protein, although no obvious correlation was found (data not shown) The fraction of soluble protein after production in Rosetta(DE3) was compared with the data obtained with respect to production in BL21(DE3) As shown in Table 3, independent of the strain, lacUV5 gives the largest fraction of soluble protein; however, of even more interest is a comparison of the amount of soluble FEBS Journal 278 (2011) 729–739 ª 2011 The Authors Journal compilation ª 2011 FEBS 733 734 0.36 1.6 0.15 0.49 0.29 0.19 0.11 ± ± ± ± ± ± ± ± 0.12 ± 1.0 57 ± 3.2 150 ± 71 0.32 52 ± 5.2 97 ± 11 260 ± 11 55 ± 0.95 380 ± 54 150 ± 23 210 ± 29 0.25 0.21 1.4 0.47 0.02 0.72 0.045 0.15 0.16 0.29 ± ± ± ± ± ± ± ± ± ± 0.91 1.7 6.2 2.0 3.5 3.0 1.1 1.2 1.5 2.2 0.27 4.1 0.021 0.10 0.77 3.5 0.53 1.8 1.1 3.0 ± ± ± ± ± ± ± ± ± ± 2.1 6.3 0.15 1.6 6.8 28 3.2 8.4 6.7 16 35 200 0.90 14 23 350 62 64 23 42 BL21(DE3) Rosetta(DE3) BL21(DE3) Rosetta(DE3) BL21(DE3) Rosetta(DE3) BL21(DE3) Rosetta(DE3) BL21(DE3) Rosetta(DE3) A O M E B 240 360 2.6 83 190 1000 300 660 450 730 ± ± ± ± ± ± ± ± ± ± Total (· 103) Strain Protein Relative whole cell fluorescence 1.0 14 8.3 0.16 11 0.61 5.1 1.7 8.2 ± ± ± ± ± ± ± ± ± 53 18 65 28 93 65 70 50 89 65 0.061 0.022 0.068 0.010 0.022 0.039 0.048 0.031 0.017 ± ± ± ± ± ± ± ± ± 0.11 0.33 0.18 0.20 0.92 0.56 0.20 0.42 0.95 0.50 0.24 0.10 0.034 0.0086 0.12 0.053 0.011 0.014 0.13 ± ± ± ± ± ± ± ± ± 1.9 7.6 23 3.8 4.8 6.0 1.7 2.8 2.1 2.4 1.1 ± 0.13 11 ± 3.8 0.073 1.9 ± 0.013 4.5 ± 1.0 16 ± 1.0 0.92 ± 0.28 10 ± 0.40 3.1 ± 0.17 5.2 ± 0.94 0.21 1.8 0.30 0.70 0.98 0.88 0.29 0.84 1.1 0.79 Soluble fraction (%) Soluble3 (· 103) Total (· 103) Soluble fraction (%) Total (· 103) T7 Soluble (· 103) Soluble fraction (%) trc Soluble (· 103) lacUV5 H Tegel et al Promoter Table Summary of the production levels in E coli BL21(DE3) and Rosetta(DE3) for five proteins under the control of the three promoters All protein amount values are adjusted to cell density The data are based on the analysis of two separately cultured samples Because of incomplete SDS ⁄ PAGE results, two values are based on a single cultured sample: protein A under the control of lacUV5 and protein B under the control of trc, both produced in BL21(DE3) The amount of produced protein is normalized to the highest value [protein E under the control of the T7 promoter produced in Rosetta(DE3)] In addition, the amount of soluble target protein as well as the fraction of soluble protein is also shown Protein production levels in E coli 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0.0 0.0 0.2 0.4 0.6 0.8 Relative amount of soluble protein 1.0 1.2 Fig Solubility analysis of eGFP fusion proteins The correlation between whole cell fluorescence and amount of soluble protein, normalized to the highest value, for 30 cell samples Five proteins were produced under the control of three different promoters in two bacterial strains: E coli BL21(DE3) and Rosetta(DE3) The filled data points represent the proteins that are produced in BL21(DE3) and the unfilled data points represent the proteins that are produced in Rosetta(DE3) The data are based on measurements performed with two separately cultured samples The average error in the fluorescence activated cell sorting analysis was 13% Two populations of different fluorescence, depending on the choice of E coli strain, are indicated by trend lines For an explanation of the different symbols used, see Table protein after production in BL21(DE3) and Rosetta(DE3) From a comparison of the data provided in Table 3, it is obvious that, even in this respect, it is beneficial to use Rosetta(DE3) rather than BL21(DE3) If the desired goal is the highest possible amount of soluble protein, the strain Rosetta(DE3) is the best choice Possibly more interesting is the changed expression pattern As can be seen from Table 3, the combination of the trc promoter and the Rosetta(DE3) strain gives more soluble protein than T7 and Rosetta(DE3) in three out of five cases It was previously shown that the levels of soluble protein can be determined, during protein production in vivo, by using a flow cytometer Proteins are fused to the N-terminus of eGFP and the cells producing these fusion proteins can then be analyzed [20] This method was used to further assess the production in BL21(DE3) and Rosetta(DE3) Thus, after protein production in the two different strains, the cells were analyzed by using a flow cytometer The behavior in the flow cytometer correlates well with the amount of soluble protein (Fig 3) Interestingly, the strain appears to affect the signal achieved because two populations are formed Figure clearly shows that the whole cell fluorescence after production in BL21(DE3) is higher than in Rosetta(DE3), although the amount of soluble protein is similar By using this alternative method, the results shown in Table could be confirmed Rosetta(DE3) is favorable if soluble protein is desired FEBS Journal 278 (2011) 729–739 ª 2011 The Authors Journal compilation ª 2011 FEBS H Tegel et al In the flow cytometric analysis, the production in BL21(DE3) of some additional samples was analyzed Except for three samples, they all showed the same correlation as the BL21(DE3) population in Fig The outliers all had a large amount of soluble protein without showing any whole cell fluorescence To determine whether this was caused by an inactive but soluble eGFP, the eGFP activity of purified protein from the soluble fraction was studied The three outliers did not show any eGFP activity, as was the case for the positive control (data not shown) An additional evaluation of the correlation between the amount of soluble and insoluble protein achieved was performed for this data set A constant ratio was seen between the two protein fractions for almost all proteins when using the T7 and trc promoters, regardless of the strain used (data not shown) Interestingly, there are two proteins (A and E) that show a larger fraction of soluble protein than the other proteins when produced in Rosetta(DE3) under the control of the trc promoter For proteins produced under the control of lacUV5, the amount of insoluble protein is generally low and an increased protein production gives mostly soluble protein In other words, lacUV5 has a larger fraction of soluble protein, although, as an effect of the low total production, the amount of soluble protein is much lower than for T7 and trc Discussion To further understand the effect of the promoter on the acquired protein, 17 different proteins have been produced under the control of three different promoters Because the final amount of protein achieved also is dependent on other important features, such as mRNA stability, transcription and translation efficiencies, and protein stability, a comparison of the total amount of protein as well as the fraction of soluble protein achieved with different promoters was analyzed for 17 different proteins with different characteristics, pI and solubility As expected, the data show that a strong promoter is a benefit when a large amount of protein is desired (Table 1) Noteworthy, when comparing the mRNA level with the amount of protein achieved, a high correlation between these parameters could be seen (Fig 1B) Hence, the weak lacUV5 promoter shows a low fold change as well as low protein production compared to the stronger promoters, trc and T7, which both show higher values Interestingly, there are some proteins that not follow the expected pattern A lower protein production than expected could be an effect of poor mRNA stability or proteolysis within the cell However, to Protein production levels in E coli minimize proteolytic effects, we limited the induction time to h [20] Accordingly, the bacteria should not experience any limitations with respect to oxygen supply or nutrition Both proteins J and O show a larger amount of produced protein under the control of the T7 promoter than expected This behavior could be explained by these mRNA molecules being more effectively translated as a result of having few rare codons, especially a low number of the rare arginine codons (Table 2) One way to compensate for differences in codon usage is by co-expression of genes encoding rare tRNAs; for example, by using the E coli strain Rosetta(DE3) When comparing the protein production of five different proteins in E coli BL21(DE3) with the production in Rosetta(DE3), the Rosetta(DE3) strain generated a higher amount of protein for all three promoters (Table 3) However, as in a previous study carried out by Tegel et al [21], the benefit of using Rosetta(DE3) could not be explained solely by the number of rare codons within the translated genes (data not shown) Also, the efficiency of different tRNA synthetases and the 3D structure of the translated mRNA may effect the translation efficacy These conclusions were also drawn by Welch et al [22] Surprisingly, in three of five cases, the combination of Rosetta(DE3) and the trc promoter gives more soluble protein than does Rosetta(DE3) and the T7 promoter (Table 3) However, in the other two cases, the T7 promoter gave substantially larger amounts of target protein With respect to translation, one parameter that is even more important for overall translation efficiency than codon usage is the efficiency of translation initiation This step is mainly influenced by features related to the Shine–Dalgarno (SD) sequence, such as the sequence itself, the length of the sequence and the distance between the SD sequence and the initiation codon Within the SD sequence used in the expression vectors in the present study, some differences could be observed The most obvious differences are the sequence itself and the sequence length The SD sequence in the T7 vector, AAGGAG, is longer than the one used in the lacUV5 and trc vectors, AGGA (Doc S2) A study by Ringquist et al [23] concluded that the SD sequence UAAGGAGG initiates translation approximately four-fold more efficiently than AAGGA Comparing these sequences with the SD sequences used in the present study, the translation efficiency will most likely be higher for mRNA transcribed from the T7 vector In other words, the same number of mRNA molecules could generate different amounts of protein depending on the SD However, in the present study, the correlation between the fold FEBS Journal 278 (2011) 729–739 ª 2011 The Authors Journal compilation ª 2011 FEBS 735 Protein production levels in E coli H Tegel et al change in mRNA levels and the amount of protein indicates that the differences between the translation efficiency for different SD sequences are rather small Moreover, if the leakage of the trc promoter is taken into account, the final concentration of mRNA for this vector is even higher, which indicates that the translation efficiency of the SD sequence included in the T7 promoter is no higher than for the other vectors One explanation for this could be that the T7-driven transcription is uncoupled from translation and proceeds several times faster than the ribosomes are able to follow Hence, the transcribed mRNA is not as efficiently used for translation as those that exhibit a coupled transcription ⁄ translation activity [24] Depending on the final application of the produced protein, the need for soluble protein differs As shown in Table 1, the largest fraction of soluble protein is generated by lacUV5, which is the weakest promoter However, when it comes to the amount of soluble protein, the two stronger promoters are beneficial as a result of higher total production The T7 promoter should therefore also be used when large amounts of soluble protein are desired The larger fraction of soluble protein generated by lacUV5 is explained by the weaker promoter giving a lower protein synthesis rate as a result of less mRNA, and thereby each protein has more time to fold correctly and form a soluble protein before forming an insoluble protein precipitate by colliding with other recently translated proteins Even though the majority of all proteins had a large fraction of soluble protein under the control of lacUV5, protein I was shown to be very insoluble regardless of the promoter By contrast, proteins B and D appeared to be more soluble than the other proteins when produced under the control of trc and T7 One explanation for this might involve differences in folding rate or the structural features of the translated protein The differences in the fractions of soluble protein achieved for the different proteins could, in most cases, also be correlated with the solubility of the protein itself Hedhammar et al [20] has previously shown that the levels of soluble protein within the cell could be determined using a flow cytometer In the present study, we show that this correlation is highly dependent on the strain used for protein production (Fig 3) In addition, there might be soluble proteins with inactive eGFP resulting in misleading results Moreover, it has also been shown that GFP captured in inclusion bodies also could contribute to the measured fluorescence [25] However, the high correlation between fluorescence and the amount of soluble protein shown in the present study indicates that the main part of the 736 measured fluorescence originates from correctly folded and soluble protein Finally, we conclude that the regulation of protein production is a combination of the transcription and translation efficiencies Other important parameters include the gene itself and the solubility of the protein A general recommendation, if a large amount of protein is needed, is to use the T7 promoter in combination with the Rosetta(DE3) strain If the amount of soluble protein is important, protein production should be performed in Rosetta(DE3) cells under the control of the T7 or trc promoter Materials and methods Materials and strains All recombinant work was performed in E coli strain RR1DM15 [26], essentially as described by Sambrook et al [27] Oligonucleotides for cloning of the different constructs were purchased from MWG-biotech AG (Edersberg, Germany), whereas the oligonucleotides for real-time PCR were purchased from Thermo Electron GmbH (Ulm, Germany) Restriction enzymes were manufactured by New England Biolabs (Ipswich, MA, USA) and ligase by Fermentas Life Sciences (Vilnius, Lithuania) All enzymes were used in accordance with the manufacturers’ instructions To sequence verify the constructs, an ABI Prism 3700 DNA sequencer (Applied Biosystems, Foster City, CA, USA) was used Plasmids were purified using Qiaprep Spin Miniprep kit (Qiagen GmbH, Hilden, Germany) Production of the fusion proteins was performed in E coli strain BL21(DE3) and E coli strain Rosetta(DE3) (co-expression of tRNA genes for AGG, AGA, GGA, AUA, CUA and CCC) (Novagen) Cloning DNA sequences coding for the promoters lacUV5 and trc were amplified by PCR from vectors including the relevant genes By using primers TEHA1: ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG were used for trc amplification The exact nucleotide sequence of each promoter region is provided in Doc S1 A common handle sequence introduced the restriction sites for BglII and PstI upstream and NcoI downstream of the promoters The resulting PCR fragments were digested with BglII and NcoI and ligated into pAff8eGFP (with a pBR322-ori and encoding kanamycin resistance) [20], cut with the same enzymes and thereby replacing the sequence encoding the T7 promoter, using solid-phase cloning [18] The resulting vectors were FEBS Journal 278 (2011) 729–739 ª 2011 The Authors Journal compilation ª 2011 FEBS H Tegel et al sequence verified and named pAff8eGFPLacUV5 and pAff8eGFPTrc, respectively The gene for the T7 promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGATCCCGCGAAATTAATAC and TEHA8: ACACCCATGGTATATCTCCTTCT, introducing restriction sites for PstI upstream and NcoI downstream of the promoter The PCR fragment and pAff8eGFPTrc were digested with PstI and NcoI before the PCR fragment was ligated into the cut vector using solid-phase cloning, replacing the trc with the T7 promoter The resulting vector was sequence verified and named pAff8eGFPT7 Sixteen different PrESTs (Table 1) were PCR-amplified from the pAff8cPrEST [18] plasmids using primers introducing an upstream NotI site and a downstream AscI site, although without introducing a downstream stop codon The PCR products were digested with NotI and AscI and ligated into pAff8eGFPT7, pAff8eGFPTrc and pAff8eGFPLacUV5 using solid-phase cloning, resulting in plasmids encoding His6-ABP-PrEST-eGFP under the control of three different promoters All constructs were transformed into E coli strain BL21(DE3) and some of them also into E coli strain Rosetta(DE3) Protein expression One milliliter of overnight culture in tryptic soy broth (Merck KGaA, Darmstadt, Germany), 30 gỈL)1, supplemented with gỈL)1 yeast extract (Merck KGaA, Darmstadt, Germany) and 50 lgỈmL)1 kanamycin (Sigma-Aldrich, Munich, Germany) was used to inoculate 100 mL of identical media in L Erlenmeyer flasks When using the E coli Rosetta(DE3) strain for protein production, 20 lgỈmL)1 chloramphenicol was also added to the culture media The cultures were incubated on shakers (150 r.p.m.) at 37 °C until OD600 of 0.5–0.8 was reached Protein production was then induced by addition of isopropyl thio-b-d-galactoside (Appollo Scientific Ltd, Stockport, UK) to a final concentration of 1.0 mm Incubation continued at 30 °C for h The cells were harvested by centrifugation (2400 g for at °C) and the pellet was re-suspended in 30 mL of 1· PBS (20 mm NaH2PO4, 80 mm Na2HPO4, 150 mm NaCl) At harvest, the cell density varied between 3.9 (for T7) and 5.2 (for trc), with a mean of 4.5 Analysis of the total and soluble protein production SDS ⁄ PAGE and western blotting To be able to fractionate the soluble and insoluble proteins, the cells were disrupted by sonication at 60% duty cycle for with 1.0 s pulses (Vibra cellÔ; Sonics and Materials, Inc., Danbury, CT, USA) The sonication level was evaluated using viable count One milliliter of the sonicated cells Protein production levels in E coli was centrifuged for 10 at 9500 g in a microcentrifuge to separate the soluble from the insoluble proteins The pellets were then washed twice with 200 lL of 1· NaCl ⁄ Pi and the washing solution was added to the soluble fraction To concentrate all soluble fractions, lyophilization (Automatic Environmental SpeedVac system AES2010; ThermoSavant, Holbrook, NY, USA) was used Both soluble and insoluble fractions were then diluted to the same volume and all fractions were analyzed on Criterion Precast SDS ⁄ PAGE 10– 20% gradient gels (Bio-Rad Laboratories) and stained with GelCode Blue Stain Reagent (Thermo Scientific, Rockford, IL, USA) in accordance with the manufacturers’ instructions The gels were destained with distilled water before scanning at 400 d.p.i To be able to detect low producing proteins, all fractions were also analyzed on western blots After SDS ⁄ PAGE separation, the proteins were electroblotted onto a polyvinylidene fluoride membrane (Criterion Gel Blotting Sandwiches; Bio-Rad Laboratories) in accordance with the manufacturer’s instructions The blotted proteins were detected using a Ni-NTA horseradish peroxidase conjugate (Qiagen GmbH) in combination with SuperSignal West Dura extended duration substrate (Thermo Scientific) in a ChemiDoc CCD camera (Bio-Rad Laboratories), all in accordance with the respective manufacturers’ instructions All gels and western blots were evaluated using quantityone 4.6.3 software (BioRad Laboratories) The bands of the recombinant proteins, both soluble and insoluble, were normalized against some of the soluble E coli house-keeping proteins that are produced equally in all cells Real-time RT-PCR Samples were taken from the cultures before induction and at harvest The total RNA from the bacteria was purified using RNeasy Protect Bacteria Mini Kit (Qiagen) Two separate cDNA synthesis reactions were performed for each total RNA: synthesis of the reference gene (ribosomal protein rpmE) and the target gene (eGFP) using reversespecific primers, rpmE_R: GGGATGTTGAAACGCTT GTTG and GFP6_R: CGGTCACGAACTCCAGCAG, respectively The input of total RNA was lg A mixture containing total RNA, dNTPs (Invitrogen, Carlsbad, CA, USA) and pmol of each reverse primer was denatured at 70 °C for 10 and then cooled on ice for Subsequently, 200 units of SuperScript III reverse transcriptase (Invitrogen) were added and cDNA synthesis was performed at 46 °C for h The enzyme was inactivated at 85 °C for The total volume of the cDNA synthesis reaction was 20 lL and contained 0.25 lm specific primer, 0.5 mm dNTP, mm dithiothreitol (Invitrogen) and 1· First-Strand Synthesis Buffer [50 mm Tris-HCl (pH 8.3), 75 mm KCl, mm MgCl2; Invitrogen] Real-time PCR was performed with an iCycler iQ 3.0 (Bio-Rad Laboratories) in 25 lL reactions containing FEBS Journal 278 (2011) 729–739 ª 2011 The Authors Journal compilation ª 2011 FEBS 737 Protein production levels in E coli H Tegel et al 12.5 lL of iQ SYBR Green Supermix (Bio-Rad Laboratories), lL of cDNA template and pmol of reverse (rpmE_R, GFP6_R) and forward (rpmE_F: AAGTGCCACCCGTTCTTCAC, GFP6_F: GACAACCACTACCTGAGCAC) specific primers PCR amplification was carried out at 95 °C for 30 s followed by 35 annealing and extension cycles (94 °C for 20 s, 62 °C for 30 s and 72 °C for min) After the amplification, a melt curve analysis was performed by ramping the temperature from 60 °C to 100 °C The obtained CT values of the analysis were then determined using icycler Software (Optical System Software, version 3.0a) The CT values were converted into the fold change data using the 2)DDCT method [28] the T7 promoter were used as positive and negative controls, respectively, in each analysis The relative fluorescence for each construct was normalized with the two controls [20] Acknowledgements The authors would like to thank Dr C Agaton, Dr M Hedhammar, Mrs C Asplund and Dr J Steen for fruitful discussions and technical assistance The authors would also like to thank the referees for their constructive comments that helped to improve the manuscript This work was financially supported by grants from the Knut and Alice Wallenberg Foundation In vitro solubility assay His6-ABP-PrEST proteins, with and without eGFP, were purified by immobilized metal ion affinity chromatography [29] using a fully automated purification set-up [30] The in vitro solubility of each recombinant protein was assessed using a method developed by Stenvall et al [19] The concentration of all purified proteins was adjusted to 0.8 mgỈmL)1 in m urea All samples were then diluted five-fold in 1· NaCl ⁄ Pi resulting in a final urea concentration of 0.2 m Immediately after dilution, the initial protein concentration was determined using the bicinchoninic acid kit (Thermo Scientific) Thereafter, the samples were incubated at 30 °C for 20 h After incubation, the precipitated proteins were separated from the soluble proteins by centrifugation at 2800 g followed by a second concentration determination of the soluble fraction The difference between the two measurements corresponds to the amount of precipitated protein The proteins were classified from to depending on the degree of precipitation, where grade was the least soluble (80–100% precipitation), followed by grade (60–80% precipitation), grade (40–60% precipitation) and grade (60–80% precipitation), with grade being the most soluble (0–20% precipitation) [19] Flow cytometric analysis The flow cytometric analysis was performed on a FACS Vantage SE stream-in-air flow cytometry instrument (BD Biosciences, San Jose, CA, USA) To align the laser flow cytometry alignment beads for 488 nm (Molecular Probes, Leiden, The Netherlands) were used Samples, containing whole cells diluted : 100 in 1· NaCl ⁄ Pi, were illuminated with an air-cooled argon ion laser (488 nm) The fluorescence from 10 000 cells was detected at a rate of approximately 500–750 eventsỈs)1 via a 530 ± 15 nm (green) band pass filter The analytical flow cytometric histograms were recorded using standard procedures cellquestpro software (BD Biosciences) was used to analyze the flow cytometric data E coli BL21(DE3) cells producing His6-ABP-eGFP and His6-ABP-SOD1 under the control of 738 References Studier FW & Moffatt BA (1986) Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes J Mol Biol 189, 113–130 Gronenborn B (1976) Overproduction of phage lambda repressor under control of the lac promotor of Escherichia coli Mol Gen Genet 148, 243–250 Wanner BL, Kodaira R & Neidhardt FC (1977) Physiological regulation of a decontrolled lac operon J Bacteriol 130, 212–222 Brosius J, Erfle M & Storella J (1985) Spacing of the – 10 and –35 regions in the tac promoter Effect on its in vivo activity J Biol Chem 260, 3539–3541 Golomb M & Chamberlin M (1974) Characterization of T7-specific ribonucleic acid polymerase IV Resolution of the major in vitro transcripts by gel electrophoresis J Biol Chem 249, 2858–2863 Hannig G & Makrides SC (1998) Strategies for optimizing heterologous protein expression in Escherichia coli Trends Biotechnol 16, 54–60 Terpe K (2006) Overview of bacterial expression systems for heterologous protein production: from molecular and biochemical fundamentals to commercial systems Appl Microbiol Biotechnol 72, 211–222 Dubendorff JW & Studier FW (1991) Controlling basal expression in an inducible T7 expression system by blocking the target T7 promoter with lac repressor J Mol Biol 219, 45–59 Sorensen HP & Mortensen KK (2005) Advanced genetic strategies for recombinant protein expression in Escherichia coli J Biotechnol 115, 113–128 10 Pedelacq JD, Piltch E, Liong EC, Berendzen J, Kim CY, Rho BS, Park MS, Terwilliger TC & Waldo GS (2002) Engineering soluble proteins for structural genomics Nat Biotechnol 20, 927–932 11 Alzari PM, Berglund H, Berrow NS, Blagova E, Busso D, Cambillau C, Campanacci V, Christodoulou E, FEBS Journal 278 (2011) 729–739 ª 2011 The Authors Journal compilation ª 2011 FEBS H Tegel et al 12 13 14 15 16 17 18 19 20 21 Eiler S, Fogg MJ et al (2006) Implementation of semi-automated cloning and prokaryotic expression screening: the impact of SPINE Acta Crystallogr D Biol Crystallogr 62, 1103–1113 Graslund S, Nordlund P, Weigelt J, Hallberg BM, Bray J, Gileadi O, Knapp S, Oppermann U, Arrowsmith C, Hui R et al (2008) Protein production and purification Nat Methods 5, 135–146 Graslund S, Sagemark J, Berglund H, Dahlgren LG, Flores A, Hammarstrom M, Johansson I, Kotenyova T, Nilsson M, Nordlund P et al (2008) The use of systematic N- and C-terminal deletions to promote production and structural studies of recombinant proteins Protein Expr Purif 58, 210–221 Savitsky P, Bray J, Cooper CD, Marsden BD, Mahajan P, Burgess-Brown NA & Gileadi O (2010) High-throughput production of human proteins for crystallization: the SGC experience J Struct Biol 172, 3–13 Cornvik T, Dahlroth SL, Magnusdottir A, Flodin S, Engvall B, Lieu V, Ekberg M & Nordlund P (2006) An efficient and generic strategy for producing soluble human proteins and domains in E coli by screening construct libraries Proteins 65, 266–273 Cornvik T, Dahlroth SL, Magnusdottir A, Herman MD, Knaust R, Ekberg M & Nordlund P (2005) Colony filtration blot: a new screening method for soluble protein expression in Escherichia coli Nat Methods 2, 507–509 Hammarstrom M, Woestenenk EA, Hellgren N, Hard T & Berglund H (2006) Effect of N-terminal solubility enhancing fusion proteins on yield of purified target protein J Struct Funct Genomics 7, 1–14 Agaton C, Galli J, Hoiden Guthenberg I, Janzon L, Hansson M, Asplund A, Brundell E, Lindberg S, Ruthberg I, Wester K et al (2003) Affinity proteomics for systematic protein profiling of chromosome 21 gene products in human tissues Mol Cell Proteomics 2, 405–414 Stenvall M, Steen J, Uhlen M, Hober S & Ottosson J (2005) High-throughput solubility assay for purified recombinant protein immunogens Biochim Biophys Acta 1752, 6–10 Hedhammar M, Stenvall M, Lonneborg R, Nord O, Sjolin O, Brismar H, Uhlen M, Ottosson J & Hober S (2005) A novel flow cytometry-based method for analysis of expression levels in Escherichia coli, giving information about precipitated and soluble protein J Biotechnol 119, 133–146 Tegel H, Tourle S, Ottosson J & Persson A (2010) Increased levels of recombinant human proteins with the Escherichia coli strain Rosetta(DE3) Protein Expr Purif 69, 159–167 Protein production levels in E coli 22 Welch M, Govindarajan S, Ness JE, Villalobos A, Gurney A, Minshull J & Gustafsson C (2009) Design parameters to control synthetic gene expression in Escherichia coli PLoS ONE 4, e7002 23 Ringquist S, Shinedling S, Barrick D, Green L, Binkley J, Stormo GD & Gold L (1992) Translation initiation in Escherichia coli: sequences within the ribosome-binding site Mol Microbiol 6, 1219–1229 24 Mattanovich D, Weik R, Thim S, Kramer W, Bayer K & Katinger H (1996) Optimization of recombinant gene expression in Escherichia coli Ann NY Acad Sci 782, 182–190 25 Garcia-Fruitos E, Martinez-Alonso M, GonzalezMontalban N, Valli M, Mattanovich D & Villaverde A (2007) Divergent genetic control of protein solubility and conformational quality in Escherichia coli J Mol Biol 374, 195–205 26 Ruther U (1982) pUR 250 allows rapid chemical sequencing of both DNA strands of its inserts Nucleic Acids Res 10, 5765–5772 27 Sambrook J, Fritsch EF & Maniatis T (1989) Molecular Cloning: A Laboratory Manual Cold Spring Harbor Laboratory Press, New York 28 Livak KJ & Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(–Delta Delta C(T)) method Methods 25, 402–408 29 Porath J, Carlsson J, Olsson I & Belfrage G (1975) Metal chelate affinity chromatography, a new approach to protein fractionation Nature 258, 598–599 30 Steen J, Uhlen M, Hober S & Ottosson J (2006) High-throughput protein purification using an automated set-up for high-yield affinity chromatography Protein Expr Purif 46, 173–178 Supporting information The following supplementary material is available: Doc S1 Nucleotide and amino acid sequence of each PrEST part of the His6-ABP-PrEST-eGFP fusion proteins (A–P) Doc S2 Nucleotide sequences of the T7, trc and lacUV5 promoters This supplementary material can be found in the online version of this article Please note: As a service to our authors and readers, this journal provides supporting information supplied by the authors Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset Technical support issues arising from supporting information (other than missing files) should be addressed to the authors FEBS Journal 278 (2011) 729–739 ª 2011 The Authors Journal compilation ª 2011 FEBS 739 ... ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG were used for trc amplification The exact nucleotide sequence of each promoter. .. protein was obtained from the SDS ⁄ PAGE and western blotting analyses and compared with the data obtained when analyzing the same protein in vitro Because eGFP does affect the solubility, the solubility... pAff8eGFPTrc, respectively The gene for the T7 promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGATCCCGCGAAATTAATAC and TEHA8: ACACCCATGGTATATCTCCTTCT, introducing restriction sites