the construction of a model stellar atmosphere
GUIDELINES TO THE CONSTRUCTION OF A SOCIAL ACCOUNTING MATRIX ppt
... that a SAM is meant to fit into the existing national statistical and planning infrastructure That is to say that, first, a SAM is typically built on the basis of data which are already available ... accounts totals Finally, a SAM always has a matrix format 72 because of its emphasis on the identification of source and use of all transactions Summarizing, a SAM in our view serves as an alternative ... separate blocks, without integrating them into a SAM as yet The computer retabulates the raw data from the surveys, data already available (e.g the 1-0 table) are scrutinized (e.g the treatment...
- 30
- 520
- 0
Báo cáo y học: "Genetic analysis of the human infective trypanosome Trypanosoma brucei gambiense: chromosomal segregation, crossing over, and the construction of a genetic map" doc
... genetic map of T b gam- Marker segregation proportions The availability of segregation data across the length of each chromosome allows a full analysis of the inheritance of the STIB 386 parental chromosome ... BLASTN search of the primers against the T brucei contigs database [55] The details of the primers used and the markers scored are provided as supplementary material (Additional data file 1) A ... experiments, analyzed the data, and wrote the manuscript AC, LS, ATw, and LM carried out the experimental work All authors read and approved the final manuscript 14 15 16 Additional data files The following...
- 12
- 281
- 0
The construction of a CI group a study of qiyuan cihua
... teachers and staffs in the Department of Chinese Studies and Chinese Library, in appreciation of their kind assistance during the two years I would like to thank all my friends, with whom I had ... III Abstract Qiyuan Cihua 憩园词话(Ci Discourse of the Leisure Garden), written by Du Wenlan 杜文澜 in the late Qing Dynasty, reflects the social network of ci-poets in Zhejiang, Jiangsu and Hubei area ... supervisor, Associate Professor Lam Lap I have learned so much from his patiend guidance, warm encouragement and kindly help, which can never be fully expressed I also want to extend my thanks to all the...
- 110
- 1,010
- 0
Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model
... populations The data was tabulated and analyzed through qualitative analysis of the gathered data, which reveal the behaviors and decision making patterns in lower income populations towards ... behavioral and attitudinal aspects of individuals An in-depth analysis in each of the broad parameters revealed the following: Educational Facet Education plays a vital role in shaping up a personality ... expectations The academia in Pakistan may facilitate the MFIs in producing relevant research work in understanding the broader social paradigms of borrowers, which may actually lead to the success...
- 23
- 552
- 0
Summary of Ph.D thesis: A study on the embankment caculation method reinforced by geotextile in the construction of highway in Vet Nam
... (Hanoi) , before spreading the layer of macadam people to spread a layer of geotextile Specifications for separating the sand embankment that separates below the mixed layer between the sand and ... with a grading of certain materials For the first time in Vietnam , the filtering function , drainage was used in the retaining wall of the path to the bridge on National Road , Tan Thinh , Hanoi ... with the local reality of the ground fabric Calculation of geotextile jet curve behaves as follows : Jet geotextile in the calculation of load balancing at each step of the iterative solution of...
- 31
- 563
- 0
Báo cáo khoa học: "Interpreting the variations in xylem sap flux density within the trunk of maritime pine (Pinus pinaster Ait.): application of a model for calculating water flows at tree and stand levels" pdf
... was calculated on a leaf area basis by: = where A is the cross-sectional area of the conc ductive pathway and L the leaf area (all sided) of the tree A was measured after the experic ment on the ... shape, and calculating the sap flux as the average of the measurements made at a height of m on a sample of ten trees at Carrasqueira and at a height of 8.5 m on seven We trees at the Bray site The ... temperature and transpi- a crown ration rate; the resistance and capacitance of each compartment are independent of the flux or water potential of the compartment and remain constant during the day...
- 18
- 406
- 0
Báo cáo y học: "Construction of a high-resolution genetic linkage map and comparative genome analysis for the reef-building coral Acropora millepora" ppt
... comparative genome analysis SW, EM and MVM drafted the manuscript All authors read and approved the final manuscript Additional data files The following additional data are available with the ... RE: MapChart: Software for the graphical presentation of linkage maps and QTLs J Hered 2002, 93:77-78 Fanarraga ML, Parraga M, Aloria K, del Mazo J, Avila J, Zabala JC: Regulated expression of ... that Placozoa are basal relative to all other non-Bilaterian animals ([70], but see [71]) Whole genome analysis of placozoan T adhaerens shows that the placozoan genome has the lowest amount of...
- 17
- 268
- 0
Báo cáo khoa hoc:" Applying the Stages of Change model to Type 2 diabetes care in Trinidad: A randomised trial" pptx
... while there was a simultaneous increase in the number of patients in the action and maintenance stages (collectively) at the end of the study In that publication application of a stage of change model ... UKPDS [12] and an audit described above which provided a mean HbA1c of 8.48% and a standard deviation (S) of the mean of 1.94% gave a sample size of 61 patients in each arm Inclusion and exclusion ... variable The primary outcome variable measured was HbA1c level All HbA1c samples were tested at the same laboratory in the San Fernando hospital, Southwest Regional Health Authority in Trinidad Other...
- 8
- 260
- 0
báo cáo khoa học: " Construction of a potato consensus map and QTL meta-analysis offer new insights into the genetic architecture of late blight resistance and plant maturity traits" pps
... according to the number of available markers, the size of the progeny and the frequency distribution profile of the raw or transformed data (non-parametric statistical tests or ANOVA, Interval Mapping, ... 29% of the total number of markers per chromosome The name, map position and occurrence of each marker are given in Additional file and on the SGN database [37] QTL dataset for meta-analysis Table ... juxtaposed to the last two digits of the publication year, the name of the population consensus map or of the parental map where the QTL was detected, and an Arabic number that can be followed by a letter...
- 17
- 593
- 0
Báo cáo khoa học: " Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon" ppsx
... GGCGCGCCTTACTTGTACAGCTCGTCCATGC TCTAGACCAACCACCGGTGCCACCATGGTGAGCAAG GGGGAGCTCGCTAGCTGGATTTATCCTGATGAGTCCGTGAGGACG AAACTATAGGAAAGGAATTCCTATAGTCGATAAATCCAAAAGC CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG ... CCGAATTCGTTAAATCCAAAAGCATACATATATCAATGATGC CCCGGGGCGGCCCCAAGGTCGAGAACTGAGTTG CCCGGGAGGAGTGACCGACTACTGCGTGAAGAAG GGTCTAGAGTATGATGCAGAAAATATTAAGG GAGCTCATGACTGCGGCTGCC GTTAACCAAGACTTCCTCTTCGGC GGCGCGCCATTCCGGTATATAAA GGCGCGCCTTACTTGTACAGCTCGTCCATGC ... CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG TATGCTTTTGGATTTATCGACTATAGGAATTCCTT CCGCGGCCGCTCTAGAT25ATTGAAAATTTTAAAAACC CCGCGGCCGCTCTAGAT23ATATTGAAAATTTTAAAACC EcoRI 3HHribo2 NotIXbaIPolyAR NotIXbaIPolyA3R XbaI SacI HpaI AscI AscI...
- 6
- 270
- 0
Báo cáo y học: " Construction of doxycyline-dependent mini-HIV-1 variants for the development of a virotherapy against leukemias" pps
... AAA GGA CCA GCA AAG CTC CTC TGG AAA GGT 3') and WS3 (5'TAG AAT TCA AAC TAG GGT ATT TGA CTA AT) The same PCR was performed on DNA from a vpU-deletion construct [pDR2484, [39]] The PCR fragments ... (vpU startcodon inactivation) and rtTAΔ6B (vpU deletion) As part of the vpU inactivation strategy, the Y2 6A inactivating mutation in the tat gene of HIV-rtTA is replaced by the wt tat gene of the ... left panel) Surprisingly, replication of the minimized rtTAΔ 6A and rtTAΔ6B variants is significantly faster than that of the parental HIV-rtTA virus and even faster than the wild type LAI virus...
- 12
- 318
- 0
Báo cáo y học: " Construction of a polycystic ovarian syndrome (PCOS) pathway based on the interactions of PCOS-related proteins retrieved from bibliomic data" docx
... differentially expressed genes Their findings on the upregulation of GATA-6, which is involved in the transcription of CYP1 1A supported earlier linkage analyses [5] Several other microarray analyses have ... presence of additional basic residues at the N- or C-terminus of the target amino acid enhances the Vmax and Km of the phosphorylation reaction [23] Several differentially expressed genes that were ... the pathophysiology of PCOS These results contributed to the dataset used in this study The goal of this study was to obtain a clearer view of the mechanism of PCOS, since the definition of the...
- 7
- 358
- 0
Báo cáo y học: " The value of a risk model for early-onset candidemia" ppt
... have a profound impact on early therapy and intervention in these cases The role of early appropriate therapy has become important as inappropriate or delayed therapy leads to higher mortality [8-10] ... of all bacteremia cases), certain high-risk patients have much higher rates approaching 27% as outlined in this study Risk stratification by application of the validated risk model can have a ... candidemia, studies have show that delayed therapy can lead to a higher mortality in hospitalized patients with late candidemia [11] Early identification of these patients therefore becomes paramount...
- 2
- 304
- 0
Báo cáo y học: " A stochastic model of oncogene expression and the relevance of this model to cancer therapy" ppt
... other therapies applied such as radiation and/or chemotherapy Table (1) yields theoretical calculations of survival fractions as a function of changes of oncogene expression, differentiation and the ... whether this is a specific feature of Bcr-Abl positive disease or a manifestation of a more general principle of cellular transformation and cancer Namely, does an oncogene act in a similar fashion ... N particular cell population The mathematical relations that we have formulated can quantitatively determine how ablation of an oncogene's protein activity can result in apoptosis and/or a decrease...
- 7
- 297
- 0
luận văn Toxicity assessment of small molecules using the zebrafish as a model system
... CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix SYBR Hi-ROX Kit (Bioline; Meridian Life Science) and the reaction ... the dark Larvae responded to the onset of darkness with a strong startle, causing a maximal peak on the speed actogram, then their speed decreased as they adapted to darkness The habituation ... compare all median values of larval velocity and activity All significant effects of chemicals on larval locomotion are shown in Figure 3.6 Figure 3.6: Comparative analysis of larval activity Bars...
- 58
- 262
- 0
Higher education and the construction of institutional identities in a globalising world
... Coca Cola and Levi’s and being ‘global’ as a brand In both instances, these arise out of the processes of globalization In the case of global brands such as Coca Cola, there is the case of branding ... neoliberal way as primarily the liberalization and global integration of markets, linked to the spread of a particular version of ‘(western) democracy’, and the strategies it is associated with are aimed ... between globalization and Americanization and the prevalence of ‘global’ brands arising out of America, there is a perception that the American (especially top-tier) universities are ‘global’ as well...
- 355
- 431
- 0
The study of a kind of contemporary chinese middle construction
... semantics among the structure The goal of this thesis is to make a deep anaylsis on Chinese middle construction (including the grammatical features, the semantic features and the defination of ... the grammatical feathers and the generated rules of each kinds of middle construction Chapter six is the conclusion and summarization Key words: middle construction, VP shell Theory, evaluation, ... aspects : the grammatical features of middle construction, the standards of definating the middle construction and the composition and toletation to each other, but there are still some questions...
- 88
- 343
- 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System
... dirty pages • Data manager floods the cache This is rather similar in nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious ... for another thread in that task • Server tasks which cannot tolerate changing data, or which must ensure that all of the necessary data is available, may use a separate thread to copy that data ... copied) data in a message • Data manager backs its own data Deadlock may occur if a data manager becomes blocked in a page fault waiting for data which it provides Fortunately, there are several techniques...
- 23
- 1,290
- 1
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25