... al Statistical analysis The arthritis scores at the different times were compared between the two groups using the nonparametric Mann–Whitney U test All data are expressed as the mean ± standard ... standard deviation Statistical analysis was performed using SPSS 10.0 for Windows (SPSS, Chicago, IL, USA) The differences between groups were analyzed using an unpaired Student 'st test, assuming equal ... adjuvant was administered to the hind leg Starting 18 days after the primary immunization, three independent observers examined the severity of arthritis three times a week for up to 11 weeks The severity...
... the 7 5T or TF variant viruses; whereas their cytotoxic activity was less potent toward MDMs infected with either the wt or the 85F mutant virus (Figure 4) These data suggest that the diminished ... Next, we also determined CTL cytotoxic activity toward MDMs infected with 7 5T, 85F, and TF variant viruses The A24-Nef CTLs showed the most potent activity toward MDMs infected with either the ... influence the susceptibility to killing of HIV-infected MDMs by CTLs To test this, we first created the variant virus having M20A or P82A (numbering based on the SF2 strain) because these mutations...
... diagnostic test data collection instruments, and on the design of the interview schedules My analysis Diagnostic assessments Research fellow/assistant Analysis Diagnostic assessments Video data Transcripts ... Progress in Numeracy tests I carried out pre and post diagnostic assessments with support from a research assistant I analysed the diagnostic assessments and inter-rater reliability assessments were ... critical incidents, disseminated in academic papers In- depth analysis of two lessons from ten transfer classes Standardised attainment tests Diagnostic tests Transcripts of pupil-pupil talk Transcripts...
... t- test was used to assess the statistical significance in the data RESULTS Substitution I181M in B19 NS1 interferes with NS1-induced apoptotic cell death To test the hypothesis that B19-associated ... cells were identified The results were quantified as number of trypan blue staining cells out of total cells counted http://www.medsci.org Int J Med Sci 2010, Statistical Analysis Student t- test ... at 4°C Table Primers Used for B19 NS1 and Substitution Construct Cloning Construct Primer External Primers F- 5’ GGCGACGAATTCATGGAGCTATTTAG GG R- 5’ GGCCATCTAGATTACTCATAATCTACAAAGCT PathT PRMTTA...
... romanticism through the four marriages, Elizabeth and Jane Austen s outer sensibility and inner romanticism Design the study The assignment is divided into three main parts: Introduction: includes the ... Prejudice notices that Mr Collins, a minister with money and status makes an offer of marriage to her, she accepts his proposal immediately without thinking whether there is love and same tastes between ... at restraining her own passion She pursues happiness under the condition that she must obey the moral standards So, the author still arranges a happy marriage for her After all, it is Austen’s...
... Intra-system-shifts Structural-shifts Unit-shifts In the data, the strategy “Class-shifts” stays on the first rank by appearing 39 times with 51% Next to this one, the strategy “Intra-system-shifts” ... sentences both in the Vietnamese and English versions were examined to find out which strategy is used Number Strategy Structural-shifts Class-shifts Unit-shifts Intra-system-shifts In this part, ... Unit-shifts 0% Intra-system-shifts 21 27% The table above indicates the frequency order of the strategies suggested by Catford from the highest to the lowest as follows: Strategy Class-shifts Intra-system-shifts...
... 14 tranh Cho học sinh ho t động nhóm để nêu t m tt Thêm : tranh toán, vi t vào chỗ chấm thích hợp Có tt : ? tranh Giải S tranh có tt là: 14 + = 16 (bức) Đáp s : 16 tranh Học sinh nêu: Lấy s ... dùng toán III.CÁC HO T ĐỘNG DẠY HỌC : TL 5’ 30’ Ho t động GV Ho t động HS Học sinh nêu 1.KTBC: Hỏi t n học Gọi học sinh đ t đề toán giải theo s đồ Học sinh xung phong đ t đề toán giải t m tt sau: ... dài : Ngun ThÞ Hµ Ho t động HS Học sinh làm bảng lớp Học sinh khác nhận x t Học sinh nhắc Học sinh theo dõi thước giáo viên hướng dẫn Học sinh quan st làm theo Học sinh thực hành thước để xác...
... ADSs This is a feature added to the NTFS file system for compatibility with Macintosh computers The Mac maintains certain information about a file that Windows does not When you share files between ... reset date-time stamps Two utilities to manipulate date-time stamps are: • Attribute Magic (http://www.elwinsoft.com/atm.html) • File Tweak (http://www.febooti.com/products/filetweak/) Creating ... features in the computer world, they can also be misused in invalid and malicious ways When that occurs, it is important for systems administrators to understand ADSs as completely as possible...
... GtkText widget insert_text() takes two parameters, the text to add and the position As with most string functions in PHP, -1 indicates the end of the string Listing shows the code for this page It ... distinct parts to this process: authentication and authorization The authentication process is about ascertaining who the person is; the web server says something akin to “Stop! Who goes there?” ... to set up a session, which it does as follows: session_start(); $sessionStarted = true; The $sessionStarted variable is used to tell the login Listing 5 10 11 ...
... use, but also the reader must know how to use a strategy successfully and combines its use with other strategies In this regard, Anderson states that it is not sufficient to know about strategies; ... used Readers scoring high and those scoring low appear to be using the same kinds of strategies This seems to indicate that strategic readings is not only a matter of knowing what strategy to ... his advice and suggestions right from the beginning when this study was only in its formative stage I also wish to send my sincere thanks to the students of the classes I visited in order to...
... Students’ Opinions Chart 3.4: Students’ Focuses in Listening Learning Chart 3.5: Students’ Interest in Listening Topics and Tasks in the Textbook Chart 3.6: Students’ Interest in Type of Listening ... to solve the difficulties that students and teachers are facing, then finding the best ways to motivate students’ interest in English listening lessons 3.4 Data Analysis and Results This part ... research entitled: “Motivating Students’ Interest in English Listening Lessons at Thai Hoa High School” Aims of the Study The thesis aims to: - Investigate the reasons why the students at Thai Hoa...
... amendments to the policies in the light of market changes or changes in your business or domestic situation This expertise is aimed at saving insurance costs and improving the effectiveness of the cover ... management is all about taking precautions to reduce the risk of loss - this might include fitting smoke alarms or sprinkler systems, or extra security on windows and doors In commercial premises It ... in the most effective way He or she can canvass the market to obtain competitive terms and costs, and then suggest a contract which best fits your needs Innovation: Many brokers are now helping...
... ADSs This is a feature added to the NTFS file system for compatibility with Macintosh computers The Mac maintains certain information about a file that Windows does not When you share files between ... reset date-time stamps Two utilities to manipulate date-time stamps are: • Attribute Magic (http://www.elwinsoft.com/atm.html) • File Tweak (http://www.febooti.com/products/filetweak/) Creating ... features in the computer world, they can also be misused in invalid and malicious ways When that occurs, it is important for systems administrators to understand ADSs as completely as possible...
... outputs “time share” parking lots; as the outputs of the initial splitter modules are placed into service, the parking lots associated with those outputs become available for parking subsequent splitter ... network The optical splitters allow the PON OLT port to be shared among multiple subscribers via the 1xn split, thus defraying the cost of the OLT By locating the splitters in the outside plant ... access The PON architecture has been adopted as a standard in ITUT G.983.x that defines the protocols, data rates and operating wavelengths necessary to support network services At the same time,...
... GtkText widget insert_text() takes two parameters, the text to add and the position As with most string functions in PHP, -1 indicates the end of the string Listing shows the code for this page It ... distinct parts to this process: authentication and authorization The authentication process is about ascertaining who the person is; the web server says something akin to “Stop! Who goes there?” ... to set up a session, which it does as follows: session_start(); $sessionStarted = true; The $sessionStarted variable is used to tell the login Listing 5 10 11 ...
... is built As such they are ubiquitous From passenger counts on transport systems to the constructs used in the most abstract discussion, data always have a place’ (Lindsay, 1997: 21) Data (in the ... about topics to study, data sources to consult and field methods to deploy, and then Part II is entitled ‘Constructing geographical interpretations’, so as to stress that what we are talking about ... such jottings that the seeds of more developed interpretations start to emerge, and it is also at this stage that the ‘textualization’ of our research – the conversion of it into written forms for...
... The Hospital at Westlake Medical Center Austin TX Beaumont ‐ Port Arthur, TX Baptist Beaumont Hospital Beaumont TX CHRISTUS Saint Elizabeth Hospital Beaumont TX including: CHRISTUS Saint Mary Hospital ... Heartland Regional Medical Center Saint Joseph MO St. Louis, MO Missouri Baptist Medical Center Saint Louis MO SSM Saint Mary s Health Center Richmond Heights MO SSM St. Clare Health Center Fenton MO St. Luke 's Hospital ... Texas Health Harris Methodist Hospital Southlake Southlake TX x Texas Health Presbyterian Hospital Dallas Dallas TX x USMD Hospital at Arlington Arlington TX USMD Hospital at Fort Worth Fort Worth...
... main issues in women s health and describes different trends, risk factors, and health determinants Supplementing this information, Chapter concentrates on the main lifestyle-related determinants ... Medicine (ASRM) The severity of endometriosis is described as minimal (Stage 1), mild (Stage 2), moderate (Stage 3), or severe (Stage 4) This definition was developed to assist in determining the ... recent decades, potentially due to increased similarities in lifestyles between the sexes (e.g increased smoking among women), and this trend is likely to continue, with the greatest gains for...