regulus in whom we have an example of the voluntary endurance of captivity for the sake of religion which yet did not profit him though he was a worshipper of the gods
... interests Authors' contributions AK, SK and AT were involved with the conception and design ofthe study AK and SK arranged the data collection, took part inthe interpretation ofthe data, and the Page ... points for passing a subtest, as is the case forthe MEAMS, a formal test ofthe validity ofthe cut point is the absence of DIF For example, if a cut point is set for passing a subtest and DIF ... pooled the data from the normal and patient groups where, inthe latter case, the first level of education also included a number of illiterate patients The basis ofthe DIF approach lies in the...
... goals, the upgraded and strengthened LECOTOX will havean important task inthe future, as well as the capability and capacity to offer its expertise and advice to policy and decision makers as well ... Each fraction contains different types of contaminants depending on their polarity, planarity and theof aromatic system, and the most active ones have been prioritised for further analysis aimed ... (presentations available at project’s homepage) To enable further exchange of experiences and information about the research potential and capacities of local (Serbian) and regional research institutions and...
... Figure 2.1 Flat and tall organization As an organization grows, the increase inthe size ofthe managerial component is less than proportional to the increase inthe size ofthe organization 1.2.2 ... that fit a company’s need is a large challenge Each structure has advantages and disadvantages, and managers have to be ready and willing to redesign the organization in order to obtain the advantages ... reason is the ability of manager The two main factors that affect the span of control are task complexity and task interrelatedness 1.2.5 The shape of hierarchy and the way it works are also affected...
... method For example, the productID variable is used to store the ProductID column value, and since ProductID is ofthe SQL Server int type, the appropriate C# type forthe productID variable is int ... type You can see this type correspondence in Table 9.3, shown earlier You can get the database type fora column using the GetDataTypeName() method of your DataReader object For example: Console.WriteLine("ProductID ... productsSqlDataReader.GetOrdinal("UnitsInStock"); int discontinuedColPos = productsSqlDataReader.GetOrdinal("Discontinued"); // use the GetFieldType() method ofthe DataReader object // to obtain the...
... SqlBoolean Let's assume that you already havea SqlDataReader object named productsSqlDataReader and it may be used to read the columns from the Products table The following while loop uses the GetSql* ... some ofthe methods shown in Table 9.7 AnExampleof Using the GetSql* Methods Let's take a look at anexample that reads the ProductID, ProductName, UnitPrice, UnitsInStock, and Discontinued ... SqlString GetSqlString() binary SqlBinary GetSqlBinary() varbinary SqlBinary GetSqlBinary() image SqlBinary GetSqlBinary() sql_varient object GetSqlValue() timestamp SqlBinary GetSqlBinary()...
... year after defraying the expenses of roads and embankments and unforeseen contingencies And that the States ofthe said Island not exceed in any case the amount of their annual income without the ... a mutual exchange of their respective notes, each party paying interest forthe balance of notes remaining against it; in this way all the notes ofthe States would have found themselves inthe ... Members, the Committee which they have appointed specially for this purpose, when we think ofthe publicity, ofthe exact acquaintance from year to year which all the inhabitants haveofthe liabilities,...
... Resource Management Plan, the SEQ Regional Plan, and inthe Healthy Waterways Action Plan There is consistency and a top down adaptation from the standards produced by the Australian and New Zealand ... 2007) The Moreton Bay Marine Park Zoning Plan designates various areas ofthe bay as national park – including the Moreton Bay Marine Park, the St Helena Island National Park and the Southern ... plans that have come out ofthe Strategy The main Action Plans addressing the issue of non-point pollutant loading are the following: Managing diffuse water pollution in SEQ: an analysis of the...
... structure) and a high-frequency signal the other way In this manner the same components can change their concentrations such that they may be at the same instantaneous levels while nevertheless having ... is increasingly commonplace to have access to large datasets of variables (Âomics data) against which to test a mathematical model ofthe system that might generate such data In these cases, the ... biology) that denes the participants inthe process of interest and the (qualitative) nature ofthe interactions between them; then we try to develop equations, preferably mechanistic rather than empirical,...
... might also be important for binding to the toxin The change of Val to Phe may result ina better interaction in terms ofan increased contact area Changes at CDRs and in clone 61 0A had a synergistic ... is the first report ofthe generation ofa human recombinant antibody fragment capable of neutralizing the toxic effects ofthe whole venom from a deadly animal L Riano-Umbarila et al ˜ formed in ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC...
... enzyme each and then their inhibitory activities were checked against another enzyme, they displayed inhibitory activity that was at least one order of magnitude higher On the basis of these results, ... proteinases and remained intact inthe presence ofthe other enzyme Consequently, the hypothesis that the inhibitory activity ofthe permutants inthe presence of both enzymes could have been caused ... inhibitor was designed by combining two binding loops of BBI As postulated by Jaulent and Leatherbarrow [11], the size ofthe inhibitor was incompatible with the simultaneous binding of trypsin and...
... to the North Atlantic, forcing the ocean into a state with weak Atlantic overturning and NADW south of Iceland, similar to a stadial period The assumption under whichthe ocean needs to shift into ... (implying an oceanic subsurface warming) after one thousand years at 17 ka BP The star and circle indicate the location ofthe Hudson Strait ice stream mouth and source, respectively the annual mean ... from the ocean to the ice due to subsurface warming induces an increase ofthe basal melt below the Labrador ice shelf (Fig 1) The reduced shelf thickness increases the calving rate substantially...
... the EFA The Brazilian dataset showed coefficients of 863 forthe Subscale I (and 845 forthe International dataset), 804 forthe Subscale II (.822 forthe International sample) and 671 forthe ... Brazilian scale fit and performance These potential alterations should not promote crucial modifications inthe scale format, since they can be made during the statistical analysis phase and not ... Items in bold were retained inthe international final version the International dataset too Out of these, only item 18 remained inthe final international AAQ version The Multi-trait Analysis...
... the ergometer testing, collected force and kinematic data, performed the statistical analysis and drafted the manuscript PDF participated inthe design and coordination ofthe study, data analysis, ... tip ofthe malleolus, and on the lateral side ofthe ergometer boot at the approximate location ofthe fifth metatarsal Additional markers were placed at the center ofthe pedal spindle, on the ... and cycling motion coincide The range between the two tails indicates the standard error ofthe mean Standard error was set at 95% Page of 12 (page number notfor citation purposes) Journal of...
... 4:55 An analysis ofthe clinical meaning ofthe DIF problem was then conducted by testing whether the meaning ofthe summed score reflected the same amount of independence between the SCI, TBI and ... to the Norwegian centres and Denmark The centres did however nothave to state which version ofthe manual was used, however the manuals are quite similar Rasch analysis The Rasch model [12] was ... multidimensionality inthe data, and thus the formal test of local independence assumption (for a unidimensional scale) wasnot performed Summed score comparison Forthe analysis ofthe clinical meaning of...
... the EFA The Brazilian dataset showed coefficients of 863 forthe Subscale I (and 845 forthe International dataset), 804 forthe Subscale II (.822 forthe International sample) and 671 forthe ... Brazilian scale fit and performance These potential alterations should not promote crucial modifications inthe scale format, since they can be made during the statistical analysis phase and not ... Items in bold were retained inthe international final version the International dataset too Out of these, only item 18 remained inthe final international AAQ version The Multi-trait Analysis...
... using a Rasch analysis rather than sample and item dependent classical test models Forthe reason of space limitation for this manuscript, wehavenot explored the dimensionality and invariance ... 1Department of Pharmacy, Chi-Mei Medical Center, Tainan, Taiwan, 2Department of Hospital and Health Care Administration, Chia-Nan University of Pharmacy and Science, Tainan, Taiwan, 3School of ... items, s x is the variance ofthe observed total test scores forthe sample of examinees and s Yi is the variance of item i forthe sample of examinees Formula shows the equation for skewness:...
... Enquiries were then made from inhabitants ofthe island itself The information gathered was vague and not much to the point With a few notable exceptions, the average Guernseyman seems to know or care ... Brock, can tell how, at the opening ofthe Market he "sprinkled the packages (of redeemed notes) with perfume, and while the band was playing a dirge he laid them on the fire, where they were quickly ... than £10,000, whichthe adjoining parishes subject to this charge were notina condition to raise The state ofthe finance wasnot more consolatory with a debt of £19,137, and an annual charge...