provided with a strong performance computer virtualdj can decode video content even when it is hidden this will prevent some jolts that may occur when video content is brought into the mix with the crossfader
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx
... primers TEHA1: ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG ... compared with the data obtained when analyzing the same protein in vitro Because eGFP does affect the solubility, the solubility class used in this case is the one with eGFP As shown in Fig 2, there ... shows that the fold change of mRNA after induction is correlated with the amount of target protein that is produced Again, all data were normalized according to cell density As seen in Fig 1, the...
- 11
- 445
- 0
Báo cáo khoa học: Human mesotrypsin exhibits restricted S1¢ subsite specificity with a strong preference for small polar side chains docx
... a1 AT band that migrated somewhat faster than the free a1 AT Western blot analysis showed that the N-terminus was intact on this a1 AT species, suggesting that this band corresponded to C-terminally ... substrate binding leads to conformational changes that mitigate the conflict with Arg198 at the S2¢ site and result in the partial obstruction of the S1¢ site The original objective of this study was ... initial Michaelis complex In contrast to wild-type a1 AT, the Pittsburgh variant inhibited mesotrypsin via the classic serpin mechanism with a rapid association rate and high kinetic stability...
- 13
- 433
- 0
an oh maser flare with a strong magnetic field in w75n
... close to VLA2, at a distance of 55 mas (±40 mas), or at the projected distance of 110 AU (±80 AU) Therefore, the OH masers may well be located in the same shell as the water masers The magnetic ... This Zeeman pair was probably overlooked by the authors, or dismissed as showing too large a velocity separation d From EVN data are really new as they are related to the flare which took place ... water masers associated with star-forming regions is typically around 100 mG, which is about the same order of magnitude as in the OH maser flare reported here The appearance of new strong maser...
- 2
- 250
- 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt
... position of the cleavage site can vary according to the calculations The primary calculated subsite energy values can be refined to the best agreement of the measured and recalculated BCF data ... Subsite map of barley a- amylase isoenzyme The binding a nities were calculated according to the data of Table Fig Subsite maps for porcine pancreatic a- amylase (PPA) The solid bars are related ... has been made to use this program for subsite mapping of other a- amylases found in the literature Evaluations of subsite maps of rice and barley a- amylases are thus also presented MATERIALS AND...
- 6
- 387
- 0
Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx
... separation allowed a quantitative estimation of the relative amount of each protein component from the area underlying each peak This was facilitated by the fact that the biliproteins are strongly ... likely that the higher molecular mass measured with respect to that expected is due the presence of a particular functional group that may distinguish this linker from the others Alternatively this ... other linkers It is generally accepted that aromatic amino acids can absorb UV, but the DNA sequence of this particular linker does not indicate a high percentage of aromatic amino acids It is...
- 9
- 477
- 0
what can you do with a major in biology real people, real jobs, real rewards (what can you do with a major in...)
... recommendations it may make Further, readers should be aware that Internet Websites listed in this work may have changed or disappeared between when this work was written and when it is read For ... possibilities, even if you can t get a job with that organization immediately Finally, a fourth reason to an internship is that you can t find a paying job This may not be the best of all reasons; it ... school What Can You Do with a Major in Biology? Some may disagree with that philosophy They argue that students should make their educational decisions based on their future careers because the world...
- 142
- 375
- 0
Báo cáo sinh học: " A high-performance quantum-dot superluminescent diode with two-section structure" potx
... emission and the ES1 emission of QDs is achieved at ISLD = 200 and 100 mA for a given ISOA of 8.5 and 9.5 A, respectively With ISOA fixed at 8.5 A, when the SLD section is driven with a 200-mA ... InAs-QD layers separated from each other by a GaAs spacer; each of them is formed by depositing a 1.8-monolayer InAs at 480°C and covered by a 2-nm In0.15Ga0.85As Ten QD layers plus the GaAs waveguide ... GS emission The relatively wide GS emission is attributed to the size inhomogeneity that is naturally occurring in self-assembled QDs With the increasing ISOA, the emission spectra are clearly...
- 15
- 338
- 0
báo cáo hóa học:" A high-performance quantum-dot superluminescent diode with two-section structure" doc
... emission and the ES1 emission of QDs is achieved at ISLD = 200 and 100 mA for a given ISOA of 8.5 and 9.5 A, respectively With ISOA fixed at 8.5 A, when the SLD section is driven with a 200-mA ... InAs-QD layers separated from each other by a GaAs spacer; each of them is formed by depositing a 1.8-monolayer InAs at 480°C and covered by a 2-nm In0.15Ga0.85As Ten QD layers plus the GaAs waveguide ... GS emission The relatively wide GS emission is attributed to the size inhomogeneity that is naturally occurring in self-assembled QDs With the increasing ISOA, the emission spectra are clearly...
- 15
- 367
- 0
Báo cáo y học: "Uric acid is a strong independent predictor of renal dysfunction in patients with rheumatoid arthritis" docx
... participated in data acquisition, provided technical assistance and assisted in analysis and interpretation of data TT, HJ and IA participated in data acquisition PN performed the statistical ... direct pathogenic association of UA with renal dysfunction, alternative explanations may also apply To start with, UA may just be 'marking' patients with increased cardiovascular or renal risk [46] ... shown that renal dysfunction in RA is associated mainly with cardiovascular risk factors and not RA-related factors such as disease activity, severity or therapy [21] In that study, UA was shown...
- 8
- 327
- 1
Báo cáo y học: "Anxiety is associated with diminished exercise performance and quality of life in severe emphysema: a cross-sectional study" ppt
... quality of life, as measured by the SGRQ total score For female patients this association was much weaker, although still statistically significant This finding is somewhat surprising given that ... capacity, as measured by the 12-minute walk test in patients with COPD They found that anxiety was linked to exercise capacity, but only through its association with depression and dyspnea It is ... Toshima; Susan Golden (1998-2000) Other participants Page of 11 AA and SKM participated in statistical analyses and writing the manuscript, VSF, ML and IL participated in writing the manuscript All...
- 11
- 519
- 0
Báo cáo y học: "The Nordic back pain subpopulation program: Can low back pain patterns be predicted from the first consultation with a chiropractor" ppt
... explanatory variable Thereafter, the variables that were associated with one of the outcome variables were considered for a multivariable analysis, providing that these associations had a p-value ... (Answer with X if you are not working) The answers were automatically entered into a data file that was later used for the analysis Variables of interest Independent variables The independent variables ... on the performance of the clinical tests and their interpretation, and this was practised The first author then visited the participating clinics once to supervise their clinical procedures when...
- 8
- 293
- 0
MEN CAN FIX EVERYTHING - LEARNING ENGLISH WITH A SMILE - 08/14/2011
... fixed that Wiper motor burned out? I can fix that! What ? Display rack falling over? I can fix that! Display rack falling over? I can fix that! Exhaust pipe dragging? I can fix that! Exhaust ... I can fix that! Bookshelf cracking under the weight? I can fix that! Bookshelf cracking under the weight? I can fix that! Can' t afford a real GPS? I can fix that! No ice chest? I can fix that! ... fix that! Can' t read the ATM screen? I can fix that! Car imported from the wrong country? I can fix that ! Satellite go out in the rain? I can fix that! Electric stove broken & can' t heat coffee?...
- 18
- 218
- 0
ON THE HALL EFFECT IN PARABOLIC QUANTUM WELLS WITH AN IN PLANE MAGNETIC FIELD IN THE PRESENCE OF a STRONG ELECTROMAGNETIC WAVE (LASER RADIATION)
... we can see that the dependence of the HC on the amplitude E0 is nonlinear The HC parabolically increases with increasing amplitude E0 , also this dependence is stronger at small value of the ... (HC) taking account of arbitrary transitions between the Landau levels The analytical result is numerically evaluated and graphed for a specific quantum well, GaAs/AlGaAs, to show clearly the dependence ... field at different values of the confinement frequency in Fig It is seen that the HC is positive and varies strongly with increasing the magnetic field Each curve has one maximum peak and the values...
- 7
- 317
- 0
Drawing - Fun With A Pencil
... and adding to it or taking some away The forehead may be flattened, cut down, or built up as the case may be The cranium may be elongated, widened, or narrowed The facial plane may also be altered ... slight and others quite exaggerated, to fit the various types of skull Nevertheless, we can take as a basic form a ball sliced off at the sides, leaving it a little wider one way than the other, and ... tracing paper over any face You can thus quickly find a feature that has been incorrectly placed You can also “find” the ball and plane position in a photographic head this way Whether you are...
- 123
- 1,965
- 6
Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"
... optimal cut-off values Data are displayed as median and range (minimum to maximum) unless otherwise stated All statistical analyses were performed with the SPSS Page of (page number not for citation ... be statistically significant at a 10% level in the univariate analysis and subjected to multivariate Cox regression analysis: lactate, APACHE II score, SOFA score and circulating Ang-2 (Table ... pre-load (ITBVI) and after-load (SVRI), as well as for vasopressor support in the present study These data reveal an important limitation for Ang-2 as a quantitative marker for vascular permeability:...
- 9
- 634
- 0
Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"
... roots of the adjacent teeth 22 with loss of their vitality and symptomatology • Tumefaction on the vestibular or palatine/lingual area Hyperdontia therapy depends on the area and on the number ... exams, such as X-Ray Dental Panoramic Tomogram and Denta-Scan (Fig 6) of the inferior maxillary bone Exodontia led to remission of the algic symptomathology, without compromising somesthesia ... patients is a rare condition 25 After a careful examination of the international literature and in the light of the described case, the hereditary etiology of non-syndromic hyperdontia can be clinically...
- 7
- 597
- 0
Báo cáo y học: " Evaluation of Lumbar Facet Joint Nerve Blocks in Managing Chronic Low Back Pain: A Randomized, Double-Blind, Controlled Trial with a 2-Year Follow-U"
... bupivacaine with or without Sarapin Group II = bupivacaine and steroids with or without Sarapin WC = Workers compensation MVA = Motor vehicle injury Analysis of Data Numbers Analyzed Data were analyzed ... local anesthetic with steroids; the conclusion is that intraarticular steroids are not an effective therapy The issue is also exemplified by the fact that Birkenmaier et al47, utilizing either ... groups One-way analysis of variance was used for comparison of means among groups Initially, categories with or without Sarapin in each group were analyzed by comparing them to each other Subsequently,...
- 12
- 669
- 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... IgG, Santa Cruz Biotech, CA) The assay was developed using a stabilized HRP substrate All samples were analyzed in the linear range of the ELISA using over-expressed human Vgf as a standard Assessment ... complex was precipitated with 100 µl of goat anti rabbit IgG and 10 µl of normal rabbit serum (Peninsula Laboratories Inc., San Carlos, CA) dissolved in RIA buffer After incubating at room temperature ... associates with clinical severity Quantitative ELISA assay revealed that the decreased CSF levels of total full-length Vgf (P
- 8
- 499
- 0
What To Do If Trapped In A Lift With A Dentist
... observer rather like the wave/particle duality at the heart of quantum physics I had no idea that would be the last line when I started writing this poem But it isn't now because that was No that was ... life is so ephemeral, one small mistake, it disappears I know it' s unavoidable, but it' s haunted me these thirty years that one day I just won't exist, I'll disappear into the mist and there'll ... without a head like my body has been stolen and I've another one instead I just cannot relate to this gristle and this bone and can' t shake the feeling that this bodies not my own It won't what...
- 34
- 515
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25