property rights in outer space a crucial issue in the wake of the commercialisation of outer space and its resources
allina-pisano j. the post-soviet potemkin village. politics and property rights in the black earth. cambridge, 2008
... Fifty-five percent of the total land mass of Ukraine, an area larger than Germany, was transferred from state ownership into the hands of individuals In both Ukraine and Russia, land privatization drew ... way They include Adil Baizhumanov, Laina and Sarah Bay-Cheng, Jarrett Barrios and Doug Hattaway, Fr Robert Bowers, Elizabeth Cohen, and Elaine Goldenberg Thanks are also due to the Allina family ... parameters and causally proximate political mechanisms explains the Max Spoor, “Agrarian Transition in Former Soviet Central Asia: A Comparative Study of Kazakhstan, Kyrgyzstan and Uzbekistan,”...
- 247
- 638
- 0
Báo cáo lâm nghiệp: "Age trends in genotypic variation of wood density and its intra-ring components in young poplar hybrid crosses" doc
... a slight increase of clonal variation starting at to years of age as well as a steady decrease of environmental variation was observed, thus resulting in an increase in clonal repeatability The ... combined: means and standard errors, F-criteria and probability of fixed effects and variance components and standard errors for random effects as percent of the total random variation Estimates ... for the same trait measured at an early age and at a later age Because of sampling errors and mathematical approximation, some genotypic correlations exceeded ˘1 In these cases, they were assumed...
- 13
- 373
- 0
Báo cáo sinh học: " Identification of gametes and treatment of linear dependencies in the gametic QTL-relationship matrix and its inverse" pptx
... (2b), and the fact that the sire of is base animal Hence in individual A1 can be maternal or paternal with probability 0.5 The dam of animal is no base animal So it is clear that A1 is the paternal ... For illustration, let us consider animal in Table I in [1] and Table I of this paper Animal has a marker genotype A1 A1 and is offspring of animal (sire, A1 A2 ) and animal (dam, A1 A2 ) It is ... proposal [10] therefore combines a special case of the condensing algorithm with gamete identification by parental origin Assuming the QTL in the middle of a certain marker interval and rounding the...
- 22
- 268
- 0
A method for 3d nano focusing of optical energy and its application to the surface enhanced raman spectroscopic study of protein 2
... focusing action arises because of the vectorial changes in the xy-plane velocity v (i.e k xy ) of the SPP traversing across the thin layer above the cavity, in a manner akin to the focusing of a ... bound) from the surface rather than propagating away Inside the metal (i = 2), on the other hand, k z of the SPP will v possess a negative imaginary part (see Eqn and 7), which suggests that the E2 ... than that attainable with a cavity-less semiinfinite Au slab It thus follows from the Au slab dispersion shown in Figure 18b that the thin Au layer between the embedded nano-cavity and the metal...
- 163
- 449
- 0
A method for 3d nano focusing of optical energy and its application to the surface enhanced raman spectroscopic study of protein 1
... at Laboratory of Optical Imaging and Photodynamic Therapy in the National Cancer Centre, namely Dr Patricia Thong, Ms Ramaswamy Bhuvaneswari, Mr William Chin and Ms Lucky Sasidharan, and also to ... thicknesses are indicated in the graph Data are calculated based on the EM theory of a 3-layers stratified system Dielectric constants of Au are evaluated using the experimental data obtained by ... 12 A schematic sketch of the cavity system considered in this chapter The distance of the center of the cavity to the surface is h The major and minor axis of the cavity are ˆ denoted as a and...
- 129
- 265
- 0
Intellectual Property Rights in a Networked World: Theory and Practice doc
... domain name “candyland.” It turned out that the first applicant for the candyland.com domain name was not Hasbro, the toy manufacturer who marketed the Candyland game, but instead was the operator ... registering of Internet domain names A domain name is an alphanumeric string of characters that identifies a unique address on the Web The domain name is included in the address of a Universal Resource ... ways that are inappropriate and potentially damaging to the market place A recent example that tends to support such a concern can be found in a case involving America On-Line (AOL), a major Internet...
- 303
- 1,106
- 1
Intellectual Property Rights In A Networked World: Theory And Practice doc
... domain name “candyland.” It turned out that the first applicant for the candyland.com domain name was not Hasbro, the toy manufacturer who marketed the Candyland game, but instead was the operator ... registering of Internet domain names A domain name is an alphanumeric string of characters that identifies a unique address on the Web The domain name is included in the address of a Universal Resource ... ways that are inappropriate and potentially damaging to the market place A recent example that tends to support such a concern can be found in a case involving America On-Line (AOL), a major Internet...
- 303
- 511
- 0
Báo cáo y học: "Community-based assessment of human rights in a complex humanitarian emergency: the Emergency Assistance Teams-Burma and Cyclone Nargis" pot
... and design, acquisition of data, and interpretation of data, was involved in drafting the manuscript, and revising it critically for important intellectual content All authors have read and approved ... data; was involved in drafting the manuscript and revising it critically for important intellectual content NM contributed to the acquisition of data and interpretation of data and was involved in ... international humanitarian assistance, particularly information gathering and travel for international staff, were a reality for aid organizations[60,61] Community-led monitoring of human rights violations...
- 14
- 338
- 0
def (digestive organ expansion factor) is a crucial gene for the development of endoderm derived organs in zebrafish (danio rerio
... which are normal in the mammalian small intestine Moreover, only one intestine is present in zebrafish, unlike the cecum, small and large intestines in mammalian and chicks The intestine in the adult ... somatostatine and pancreatic polypeptide play a negative role in pancreatic endocrine and exocrine secretions Ghrelin cells may play a paracrine role in regulating insulin secretion (Prado et al., ... regulation through the function of two distinct tissues: the exocrine pancreas and endocrine pancreas The exocrine pancreas has two components: acinar cells and ductal epithelial Acinar cells can...
- 199
- 296
- 0
Intellectual Property Rights in CAFTADR and Pharmaceuticals in Costa Rica
... the medications needed to treat the major causes of death and mortality affecting the population, and ensures that the medicines are available in the quantities and at the time that they are needed ... 93 Intellectual Property Rights in CAFTA-DR and Pharmaceuticals in Costa Rica Data Protection, New Chemical Entities, and Patent Linkages after CAFTA-DR One way to illustrate the impact of the ... 90 Intellectual Property Rights in CAFTA-DR and Pharmaceuticals in Costa Rica Intellectual Property Regulations for Pharmaceuticals in International Trade Treaties Costa Rica’s regulatory framework...
- 14
- 594
- 0
Báo cáo y học: "Genetic polymorphisms in the nucleotide excision repair pathway and lung cancer risk: A meta-analysis"
... Publication bias may be always a possible limitation of combining data from various sources as in a meta-analysis The idea of adjusting the results of meta-analyses for publication bias and imputing "fictional" ... Tanaka K, Miura N, Satokata I, et al Analysis of a human DNA excision repair gene involved in group A xeroderma pigmentosum and containing a zinc-finger domain Nature 1990; 348: 73-6 65 Sarasin ... bind damaged DNA, and because RPA and XPA directly interact in the absence of DNA, the RPA-XPA complex has been implicated as a key component in the earliest stage of damage recognition [41] There...
- 13
- 711
- 0
Tài liệu Open Hearing: Adolescent Sexual and Reproductive Health and Rights in the Pacific pdf
... priorities of the New Zealand Aid Programme is sexual and reproductive health Further, due to the financial crisis, a range of international donors active in the Pacific and which support SRHR, have announced ... existing demand for family planning services Best available data suggests that between 11% and as much as 46% of this demand is currently unmet Family planning plays an important role in human and ... diseases Sexual and reproductive health care includes preventing and treating sexually transmitted infections, including HIV and AIDS In addition, reproductive health care can bring patients into...
- 5
- 492
- 0
Tài liệu Socio-Economic Rights in the South African Constitution pptx
... process of gathering the data in this regard does not and cannot warrant the authenticity and accuracy of the data This does not necessarily mean that the data are therefore inauthentic and inaccurate ... poverty hearings were held at the behest of the SAHRC, CGE and SANGOCO, we not know who conducted these hearings and what training they had From the standpoint of the reliability of the research instrument ... And then the Declaration states in Article 5: All human rights are universal, indivisible and interdependent and interrelated The international community must treat human rights globally in a...
- 102
- 451
- 0
Báo cáo khoa học: A study of microRNAs in silico and in vivo: bioimaging of microRNA biogenesis and regulation doc
... regulatory networks during developmental stages and the changes of these networks in disease and after application of a variety of therapeutic strategies Critically, 2172 the noninvasive imaging approach ... monitoring the therapeutic potential of miRNAs in cancer Bioimaging of microRNA biogenesis The molecular mechanisms involved in miRNA generation are complex, and at least several processing steps in ... by the miRNA function, mRNA destabilization (F) Reporter-gene frame imaging of miRNA targets The 3¢-UTR of an miRNA target containing the seed region of miRNA can be isolated and transferred into...
- 10
- 463
- 0
Báo cáo khoa học: A L225A substitution in the human tumour suppressor HIC1 abolishes its interaction with the corepressor CtBP docx
... mutagenesis (mCtBP2 .A5 8E.F, GACCTGGCCACTGTGGAATTCTGTGATGCACAG; mCtBP2 .A5 8E.R, CTGTGCATCACAGAATTCCACAGT GGCCAGGTC; mCtBP2.V72R.F, GAAATCCATGAGA AGCGGTTGAATGAAGCTGTG; and mCtBP2.V72R.R, CACAGCTTCATTCAACCGCTTCTCATGGATTTC) ... mice carrying a Val-to-Gly point mutation in the GATA2 N-terminal zinc finger that ablates the interaction with cofactors of the Friend of GATA (FOG) family have been generated These mutant mice ... cleft in the CtBP N-terminal region Point mutation of the only invariant residue in the CtBP-interacting domain is sufficient to abolish the HIC1–CtBP interaction Having established that the interaction...
- 12
- 326
- 0
In this issue: Fair value measurement of financial assets and financial liabilities pdf
... has immediate access (a Level fair value measurement) is the best indicator of the fair value of a financial asset or financial liability and, if one is available, is used Therefore, determining ... a quoted price in an active market for an identical asset or a liability that the entity can access at the measurement date The standard refers to a ‘valuation approach’ as a broad category of ... When the outcome of the valuation model is a range of estimates, the probabilities of the estimates within the range are determined and applied to arrive at a single estimate of fair value In our...
- 33
- 498
- 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... spectra (inset in D) corresponding to the 7-DHP standard (inset in D and inset in C) The product was at the limits of detectability in the control sample with the reaction stopped at time (A) and in ... was isolated at the Albany Medical College and stored at )80 °C The skin and internal organs were harvested from female C57BL/6 mice aged weeks at telogen and anagen stages of the hair cycle as...
- 11
- 475
- 0
Ele ctricity Use d by Office Equipment and Netw ork Equipment in the U.S.: Detailed Report and A ppendices ppt
... origin of the data We did not separately estimate uncertainty in commercial input data and industrial input data Tables A- 27 and A- 28 show our estimates of the range of uncertainty in commercial/industrial ... of their rated capacity) Most analyses of imaging energy and paper use begin with the total amount of paper used and then allocate this total based on professional judgment and anecdotal data ... management enabled rate (SPM) of displays Stock of inkjet printers and faxes Active power of servers and faxes Low power requirement of mainframes and laser printers Usage of inkjet printers and...
- 50
- 454
- 0
Báo cáo Y học: Arginine 121 is a crucial residue for the specific cytotoxic activity of the ribotoxin a-sarcin potx
... residues acting as the general acid and base on the catalysis by a- sarcin [19,20], rendered proteins with no detectable activity against ApA [20] Cleavage of ApA by a- sarcin is a low-specificity reaction ... a- sarcin against ribosomes might differ in some details from that against dinucleotides [18,19] The behaviour of a- sarcin against ApA as a function of pH, altogether with the characterization of ... plays an important role in the rRNA catalytic cleavage by a- sarcin, which would not be simply related to the bearing positive charge Both mutant variants of a- sarcin cleave ApA, with slight variation...
- 7
- 434
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25