0

please give an example of when you have dealt with a difficult situation and what was the outcome

Báo cáo khoa học:

Báo cáo khoa học: " Protection of chickens from Newcastle disease with a recombinant baculovirus subunit vaccine expressing the fusion and hemagglutinin- neuraminidase proteins" pdf

Báo cáo khoa học

... 5' TCCAGGTGCAAGATGGGCTCC 3' 5' AGGGAAACCTTCGTTCCTCAT 3' 5' TCAATCATGGACCGCGCCGTT 3' 5' CGCAGAAGATAGGTGATACAA 3' 5' ACATTCAGGACACAATATGGG 3' 5' CACAGGCTGCTGTTGGGTAT 3' 5' ACAAGAGTCAATCATGGACCG ... (Clontech, USA) The F gene of the La Sota strain was excised by digestion with Xho I and BamH I, and the HN gene of the La Sota strain was excised by digestion with Not I and BamH I The excised fragments ... expressing the Newcastle disease virus fusion protein Avian Dis 1992, 36, 858-870 19 Mori H, Tawara H, Nakazawa H, Sumida M, Matsubara F, Aoyama S, Iritani Y, Hayashi Y, Kamogawa K Expression of the...
  • 8
  • 315
  • 0
Báo cáo y học:

Báo cáo y học: "Daily rhythm of circulating fat soluble vitamin concentration (A, D, E and K) in the horse" pdf

Báo cáo khoa học

... represents mean ± SD Φ indicates the acrophases Black and white bars at the bottom of the figure indicate the duration of the dark and light phases of the natural light-dark cycle Page of (page number ... One-way repeated measures analysis of variance (ANOVA) was used to determine significant differences p values < 0.05 were considered statistically significant Data were analyzed using the software ... 7:403-411 Lapenna D, De Gioia S, Mezzetti A, Porreca E, Ciofani G, Marzio L, Capani F, Di Ilio C, Cuccurullo F: Circadian variations in antioxidant defences and lipid peroxidation in the rat heart Free...
  • 4
  • 294
  • 0
An example of table content

An example of table content

Tư liệu khác

... 6 Reference…………………………………………… Appendix: Questionnaire………………………… ...
  • 2
  • 347
  • 0
Tài liệu An Example of Using the Get* Methods phần 1 pdf

Tài liệu An Example of Using the Get* Methods phần 1 pdf

Kỹ thuật lập trình

... earlier You can get the database type for a column using the GetDataTypeName() method of your DataReader object For example: Console.WriteLine("ProductID database type = " + productsSqlDataReader.GetDataTypeName(productIDColPos)); ... discontinued); } As you can see, five variables of the appropriate type are created in this while loop, each of which is used to store the result from the Get* method For example, the productID variable ... Visual Studio NET's Server Explorer For example, Figure 9.1 shows the details of the ProductID column of the Products table As you can see, ProductID is an int Figure 9.1: Obtaining the type of a...
  • 6
  • 594
  • 0
Tài liệu An Example of Using the Get* Methods phần 2 docx

Tài liệu An Example of Using the Get* Methods phần 2 docx

Kỹ thuật lập trình

... that you already have a SqlDataReader object named productsSqlDataReader and it may be used to read the columns from the Products table The following while loop uses the GetSql* methods and returned ... to use some of the methods shown in Table 9.7 An Example of Using the GetSql* Methods Let's take a look at an example that reads the ProductID, ProductName, UnitPrice, UnitsInStock, and Discontinued ... column is a SQL Server int, and looking up that type in Table 9.7, you can see you use the GetSqlInt32() method to obtain the column value as a C# SqlInt32 Table 9.8 summarizes the column names,...
  • 6
  • 471
  • 0
Tài liệu An Example of Communal Currency pdf

Tài liệu An Example of Communal Currency pdf

Quản trị kinh doanh

... year after defraying the expenses of roads and embankments and unforeseen contingencies And that the States of the said Island not exceed in any case the amount of their annual income without the ... seems to have been flooded with paper money, and an awkward situation had arisen The Commercial Bank claimed an equal right with the Old Bank and even with the States to issue notes The Finance Committee, ... at the disposal of the States." Notwithstanding the pathetic appeal already recorded, the proposal of the Committee to enlarge and to cover the Market was lost by a majority of one The advocates...
  • 37
  • 485
  • 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCTTCTGAGCTGACTCAGGACCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCCTATGTGCTGACTCAGCCACC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTC...
  • 11
  • 679
  • 0
Báo cáo khoa học: Inhibitory activity of double-sequence analogues of trypsin inhibitor SFTI-1 from sunflower seeds: an example of peptide splicing docx

Báo cáo khoa học: Inhibitory activity of double-sequence analogues of trypsin inhibitor SFTI-1 from sunflower seeds: an example of peptide splicing docx

Báo cáo khoa học

... chymotrypsin with a stoichiometry of : (analogues of and 7), whereas the two remaining analogues would inhibit both trypsin and chymotrypsin simultaneously and independently Jaulent and Leatherbarrow ... suggesting that behaved as a substrate rather than an inhibitor At the same time, this shows that the peptide bond between Lys19 and Ser20 (the reactive site) and the Arg16Abu17 bond are both rapidly ... llÆmin)1 The potential between the spray needle and the orifice was set at 4.5 kV Capillary temperature was 200 °C, and N2 was used as a nebulizing gas All peptides were synthesized manually by the...
  • 9
  • 307
  • 0
Heinrich event 1: an example of dynamical ice-sheet reaction to oceanic changes ppt

Heinrich event 1: an example of dynamical ice-sheet reaction to oceanic changes ppt

Tổ chức sự kiện

... (implying an oceanic subsurface warming) after one thousand years at 17 ka BP The star and circle indicate the location of the Hudson Strait ice stream mouth and source, respectively the annual mean ... 2006), that the early deglaciation of the Fennoscandian ice sheet resulted in enhanced freshwater fluxes to the North Atlantic, forcing the ocean into a state with weak Atlantic overturning and NADW ... for the standard simulation without accounting for oceanic circulation changes (black) The gray rectangle indicates the duration of the oceanic subsurface warming Within this rectangle, (A) shows...
  • 10
  • 566
  • 0
báo cáo hóa học:

báo cáo hóa học: " Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" pptx

Hóa học - Dầu khí

... statistical analysis and drafted the manuscript; MPF participated in the study design, statistical analysis and helped to draft the manuscript; CMT participated in the study design and data collection; ... draft the manuscript and took part in the theoretical discussion; MJP participated in the study design, statistical analysis and helped to draft the manuscript All authors read and approved the ... item and subscale correlations and internal reliability No missing values were found in any of the 44 items in the Brazilian sample The analysis of the pooled international data indicated the...
  • 10
  • 871
  • 0
báo cáo hóa học:

báo cáo hóa học:" Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" docx

Hóa học - Dầu khí

... statistical analysis and drafted the manuscript; MPF participated in the study design, statistical analysis and helped to draft the manuscript; CMT participated in the study design and data collection; ... draft the manuscript and took part in the theoretical discussion; MJP participated in the study design, statistical analysis and helped to draft the manuscript All authors read and approved the ... item and subscale correlations and internal reliability No missing values were found in any of the 44 items in the Brazilian sample The analysis of the pooled international data indicated the...
  • 10
  • 737
  • 0
báo cáo hóa học:

báo cáo hóa học:" Reliability of 95% confidence interval revealed by expected quality-of-life scores: an example of nasopharyngeal carcinoma patients after radiotherapy using EORTC QLQ-C 30" pdf

Hóa học - Dầu khí

... the statistical analysis and wrote the manuscript TW, SJ,WW and LF contributed to the development of the study design and advised on the performance of the statistical analysis The analysis and ... 2Department of Hospital and Health Care Administration, Chia-Nan University of Pharmacy and Science, Tainan, Taiwan, 3School of Pharmacy, Kaohsiung Medical University, Kaohsiung, Taiwan, 4Assessment ... using a Rasch analysis rather than sample and item dependent classical test models For the reason of space limitation for this manuscript, we have not explored the dimensionality and invariance of...
  • 8
  • 318
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " REP-LECOTOX: an example of FP 6 INCO project to strengthen ecotoxicological research in WBC (Western Balkan countries)" ppt

Hóa học - Dầu khí

... networking and scientific exchange Besides its scientific and educational goals, the upgraded and strengthened LECOTOX will have an important task in the future, as well as the capability and capacity ... several aquatic and terrestrial acute and chronic toxicity tests using Vibrio fischeri, Pseudokirchneriella subcapitata, Caenorhabditis elegans, Lactuca sativa, Folsomia candida and Enchytraeus albidus ... Each fraction contains different types of contaminants depending on their polarity, planarity and the of aromatic system, and the most active ones have been prioritised for further analysis aimed...
  • 9
  • 374
  • 0
Project Gutenberg''''s An Example of Communal Currency, by J. Theodore Harris doc

Project Gutenberg''''s An Example of Communal Currency, by J. Theodore Harris doc

Quản trị kinh doanh

... House was built without a loan and without the payment of interest It does not follow, however, that it was any more built without the aid of capital, than was St Paul's Cathedral or the Manchester ... may well have taken the place of the hypothetical inflow of gold, so far as the island currency was concerned It may even have averted a fall in prices that would otherwise have taken place, the ... Librarian of the Guille-Allés Library every facility was granted to the writer and his wife to carry out their research The politeness and kindness of these officials and other inhabitants of Guernsey...
  • 213
  • 522
  • 0
Báo cáo y học:

Báo cáo y học: "Ragweed as an Example of Worldwide Allergen Expansion" doc

Báo cáo khoa học

... Oswalt and Marshall, Ragweed as an Example of Worldwide Allergen Expansion tricolporate, with a spiny, granular surface.13 It tends to grow in large numbers, and a single plant can release about ... above 10 grains/m3 for 80 to 90% of the time.4 A study by Stach and colleagues calculated the amount of Ambrosia pollen in the Poznan area of Poland between 1995 and 2005.5 It was shown by back-trajectory ... agricultural practices can influence the types of plants that are able to survive and proliferate in an area The expansion of ragweed has been attributed to changes in agricultural practice In their...
  • 6
  • 350
  • 0
báo cáo khoa học:

báo cáo khoa học: " Improving eye care for veterans with diabetes: An example of using the QUERI steps to move from evidence to implementation: QUERI Series" ppsx

Báo cáo khoa học

... contributions SLK participated in the conduct of the implementation project, data acquisition and analysis, and she wrote the manuscript SJB participated in the design and conduct of the implementation project ... this article are those of the authors and not necessarily reflect the position or policy of the Department of Veterans Affairs The authors wish to thank Matt Shevrin for assisting with data management ... quality gaps and implementation projects, data acquisition, and writing the manuscript CLG participated in the conduct of the implementation project and writing the manuscript BW participated in the...
  • 11
  • 443
  • 0
Báo cáo y học:

Báo cáo y học: "Is obesity a risk factor for low back pain? An example of using the evidence to answer a clinical question" ppsx

Báo cáo khoa học

... O: The relation of spinal x-ray to low back pain and physical activity among 60 year old men and women Spine 1985, 10:445-451 Lean ME, Han TS, Seidell JC: Impairment of health and quality of ... basic research appeared to conclude what was already intuitively thought about low back pain and increased weight Body mass index Before an in-depth discussion of low back pain and obesity can ... isolated and can be read Step four involves collating the evidence to answer the question In searches one may find answers that were not known to exist, and information that may challenge an already...
  • 6
  • 402
  • 0
an example of the rsa algorithm

an example of the rsa algorithm

Chứng chỉ quốc tế

... 15756920979851832104115596935784883366531595132734467524394087576977 file:///C|/Documents%2 0and% 20Settings/mwood/Deskto aphy /An% 2 0Example% 2 0of% 2 0the% 20RSA%20Algorithm.htm (2 of 4)8/1/2006 1:53:25 AM An Example of RSA Encryption 78908490126915322842080949630792972471304422194243906590308142893930 ... 51941619318479919134924388152822038464729269446084915299958818598855 file:///C|/Documents%2 0and% 20Settings/mwood/Deskto aphy /An% 2 0Example% 2 0of% 2 0the% 20RSA%20Algorithm.htm (3 of 4)8/1/2006 1:53:25 AM An Example of RSA Encryption 19514906630731177723813226751694588259363878610724302565980914901032 ... 305946326827861270203356980346143245697021484375 mod 3233 = 123 file:///C|/Documents%2 0and% 20Settings/mwood/Deskto aphy /An% 2 0Example% 2 0of% 2 0the% 20RSA%20Algorithm.htm (4 of 4)8/1/2006 1:53:25 AM ...
  • 4
  • 400
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose