example of how you dealt with a difficult situation

PUBLIC PERCEPTIONS OF URBAN AIR POLLUTION WITH A FOCUS ON DEVELOPING COUNTRIES potx

PUBLIC PERCEPTIONS OF URBAN AIR POLLUTION WITH A FOCUS ON DEVELOPING COUNTRIES potx

Ngày tải lên : 06/03/2014, 16:20
... Saksena Sumeet Saksena is a Fellow in the Research Program at the East-West Center He is also Affiliate Faculty at the Department of Urban And Regional Planning, University of Hawai`i at Manoa ... physical data for a variety of air pollutants and weather indicators and, more importantly, for a variety of averaging times and tested the correlation with indicators of perceived and desired air ... that environmental quality is no longer seen as a post-materialist value and that environmental degradation is increasingly recognized as a direct threat to human health and welfare (Dunlap, Gallup...
  • 32
  • 381
  • 0
Detection of an uncharged steroid with a silicon nanowire field effect transistor

Detection of an uncharged steroid with a silicon nanowire field effect transistor

Ngày tải lên : 16/03/2014, 15:23
... are not shown] Upon addition of 19-NA at various concentrations, the conductance of Art KSI/mA51-labeled SiNW-FET rapidly increased to a constant value [Fig 5(b)] 19-NA at a greater concentration ... surface modification at varied stages, such as a treatment with APTES and also with BS3 and protein as shown in Fig Fig also presents SEM images of AuNP on derivatized surfaces As AuNPs were synthesized ... Chang et al / Sensors and Actuators B 138 (2009) 148–153 149 with HF solution After defining the contact pad patterns, a stack of Ti (10 nm) and Au (100 nm) was then evaporated with a thermal...
  • 6
  • 492
  • 1
Báo cáo khoa học: Enhancement of intracellular concentration and biological activity of PNA after conjugation with a cell-penetrating synthetic model peptide docx

Báo cáo khoa học: Enhancement of intracellular concentration and biological activity of PNA after conjugation with a cell-penetrating synthetic model peptide docx

Ngày tải lên : 23/03/2014, 13:20
... Oehlke et al (Eur J Biochem 271) Table Sequences of the PNA derivatives studied Compound Sequence MAP I KLALKLALKALKAALKLA-NH2 Fluos-GGAGCAGGAAAG-Lys (antisense) Fluos-GGAGCAGGAAAG-MAP (antisense) ... bioavailability of PNA after conjugation with natural CPPs [3–8], an almost one order of magnitude higher intracellular PNA concentration was achieved after exposing cells to the MAP–PNA conjugate ... structural requirements in the present work we evaluated the suitability of a conjugate of the synthetic CPP MAP (KLALKLALKALKAALKLANH2) [9,10] with a 12-mer peptide nucleic acid (5¢-GGAGCAGGAAAG-3¢)...
  • 7
  • 325
  • 0
Báo cáo khoa học: The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit ppt

Báo cáo khoa học: The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit ppt

Ngày tải lên : 23/03/2014, 20:22
... )124 of c-jun and stimulates transcription Materials and methods Reagents and animals All chemicals were of reagent grade and were from Sigma Chemical Co unless stated otherwise Healthy female ... inbred rats of Wistar strain weighing 150–170 g were procured from the Animal Facility, Jawaharlal Nehru University, New Delhi, India Animals were fed water and standard rat chow ad libitum Plasmid ... reaction mixture was placed on ice and UV irradiated (254 nm) for 15 [25] Following irradiation, the mixture was separated by SDS/PAGE (15% acrylamide) and analysed by autoradiography changes of...
  • 9
  • 449
  • 0
Báo cáo khoa học: Crystal structure of the second PDZ domain of SAP97 in complex with a GluR-A C-terminal peptide ppt

Báo cáo khoa học: Crystal structure of the second PDZ domain of SAP97 in complex with a GluR-A C-terminal peptide ppt

Ngày tải lên : 30/03/2014, 10:20
... GluR -A and AMPA receptor mediated synaptic currents [16] SAP97 may also play a role in the endocytosis of GluR -A AMPA receptors, based on identification of a ternary complex between SAP97, GluR -A and ... topology with six b-strands (bA to bF) and two a- helices (aA and aB) (Fig 4) The structure of the C378G variant of SAP97PDZ2 was practically identical to that of C378S variant, except for the mutated ... et al Table Data collection and processing statistics Data set Space group Unit cell parameters a b c a b c ˚ Wavelength (A) ˚ Resolution (A) a Completeness (% )a Redundancya Rmergea,b I ⁄ SAP97PDZ2...
  • 11
  • 458
  • 0
Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc

Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc

Ngày tải lên : 31/03/2014, 15:20
... G *A* GCTGCACGCTGCCG*T*C GGCGGATCGGGTGTGTCAGC CCACTGGCTTCTGTCATAGT GAAGTCCAGGCCCAGTTTGA TCAATTAAGTAGGGCAGATT TCTCCAAAACGTCCACACGA ACAAAGCATGATGAGCTGCA GAGTAGAGCTTCATCTTCTC ACTGGTCAAGAATGTCATAA CAGGTTTGGGAAGGCGTCCA ... CCATGCCTATGATACTGGGAT-3¢ GSTM1-revA 5¢- CTAAAGATGAGACAGGCCTGG-3¢ GSTM1-revB 5¢-GATCCTAAAGATGAGACAGGCCTGG-3¢ GSTM2-forA 5¢-AATTCGATGCCTATGACACTGGGTTAC-3¢ GSTM2-forB 5¢- CGATGCCTATGACACTGGGTTAC-3¢ ... ACTGGTCAAGAATGTCATAA CAGGTTTGGGAAGGCGTCCA CAGGCCCTCAAACCGAGCCA GTCTGGACTTTGTGGTGCTA GGCATGACTGGGGTGAGGTT AAAATCAGTGAGGGAAGGGT TCTAATCTCTCAGGCCAGGC GCAGCTCCCCCACCAGGAAC Unrelated GFP–CDS CDS CDS CDS...
  • 10
  • 432
  • 0
what can you do with a major in biology real people, real jobs, real rewards (what can you do with a major in...)

what can you do with a major in biology real people, real jobs, real rewards (what can you do with a major in...)

Ngày tải lên : 01/06/2014, 10:54
... Essentially, that means you are 12 What Can You Do with a Major in Biology? choosing one primary area of study as well as a secondary specialty This will appear on your transcript when you graduate ... Social Studies years years years years Math* years years years years Lab Science** years years years years Foreign Language years years years years Academic Electives years years years years ... personal essay allows each applicant to help admission officers read the map more accurately In addition to speaking of your goals, dreams, and expectations, you can explain any gaps or changes...
  • 142
  • 375
  • 0
báo cáo hóa học: " The reliability and validity of the SF-8 with a conflict-affected population in northern Uganda" doc

báo cáo hóa học: " The reliability and validity of the SF-8 with a conflict-affected population in northern Uganda" doc

Ngày tải lên : 18/06/2014, 19:20
... systematic and critical review of the process of translation and adaptation of generic healthrelated quality of life measures in Africa, Asia, Eastern Europe, the Middle East, South America Soc ... Quality of Life [http:// acqol.deakin.edu.au/index.htm] Harvard Programme for Refugee Trauma [http://www.hprtcambridge.org/Layer3.asp?page_id=32] Ichikawa M, Nakahara S, Wakai S: Cross-cultural ... 292(5):575-584 Lopes Cardozo B, Vergara A, Agani F, Gotway CA: Mental health, social functioning, and attitudes of Kosovar Albanians following the war in Kosovo JAMA 2000, 284(5):569-577 Ware J, Kosinski...
  • 10
  • 647
  • 0
Báo cáo sinh học: "Membranous expression of Her3 is associated with a decreased survival in head and neck squamous cell carcinoma" pot

Báo cáo sinh học: "Membranous expression of Her3 is associated with a decreased survival in head and neck squamous cell carcinoma" pot

Ngày tải lên : 18/06/2014, 22:20
... Tissue Array Research Program, Laboratory of Pathology, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892, USA 2Applied Molecular Pathology Laboratory, Laboratory of Pathology, ... Virginia Health System and office of Human Subjects Research at the NIH Information on post-operative radiation and/or chemotherapy, and performance status of patients was unavailable for analysis ... human breast and ovarian cancer Science 1989, 244:707-712 Takehana T, Kunitomo K, Kono K, Kitahara F, Iizuka H, Matsumoto Y, Fujino MA, Ooi A: Status of c-erbB-2 in gastric adenocarcinoma: a comparative...
  • 10
  • 490
  • 0
báo cáo hóa học:" Membranous expression of Her3 is associated with a decreased survival in head and neck squamous cell carcinoma" doc

báo cáo hóa học:" Membranous expression of Her3 is associated with a decreased survival in head and neck squamous cell carcinoma" doc

Ngày tải lên : 20/06/2014, 04:20
... Tissue Array Research Program, Laboratory of Pathology, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892, USA 2Applied Molecular Pathology Laboratory, Laboratory of Pathology, ... Virginia Health System and office of Human Subjects Research at the NIH Information on post-operative radiation and/or chemotherapy, and performance status of patients was unavailable for analysis ... human breast and ovarian cancer Science 1989, 244:707-712 Takehana T, Kunitomo K, Kono K, Kitahara F, Iizuka H, Matsumoto Y, Fujino MA, Ooi A: Status of c-erbB-2 in gastric adenocarcinoma: a comparative...
  • 10
  • 479
  • 0
Báo cáo hóa học: " Hydrothermal synthesis of MnO2/CNT nanocomposite with a CNT core/porous MnO2 sheath hierarchy architecture for supercapacitors" potx

Báo cáo hóa học: " Hydrothermal synthesis of MnO2/CNT nanocomposite with a CNT core/porous MnO2 sheath hierarchy architecture for supercapacitors" potx

Ngày tải lên : 20/06/2014, 23:20
... electrode maintain the rectangular shape even at a high scan rate of 100 mV/s with a high specific capacitance of 188 F/g This is a significantly improved rate capability compared to that for the ... Han BX, Wang Y, Du JM, Xie ZL, Han GJ: Fabrication of ruthenium-carbon nanotube nanocomposites in supercritical water Adv Mater 2005, 17:928 40 Ogata A, Komaba S, Baddour-Hadjean R, Pereira-Ramos ... specific capacitance of 144 F/g at a scan rate of 20 mV/s The MnO2/CNT nanocomposite electrode prepared by Xie et al [36] was able to deliver a specific capacitance of 205 F/g at a scan rate of mV/s,...
  • 20
  • 470
  • 1
Báo cáo hóa học: " Research Article Inclusion Properties for Certain Classes of Meromorphic Functions Associated with a Family of Linear Operators" pptx

Báo cáo hóa học: " Research Article Inclusion Properties for Certain Classes of Meromorphic Functions Associated with a Family of Linear Operators" pptx

Ngày tải lên : 21/06/2014, 20:20
... functions associated with the Choi-Saigo-Srivastava operator,” Journal of Mathematical Analysis and Applications, vol 320, no 2, pp 779–786, 2006 17 R W Barnard and Ch Kellogg, “Applications of convolution ... Liu and Srivastava Further, we remark in passing that this Journal of Inequalities and Applications operator L a, c is closely related to the Carlson-Shaffer operator defined on the space of analytic ... strongly starlike functions,” Annales Universitatis Mariae Curie-Skłodowska Sectio A, vol 45, pp 89–97, 1991 J.-L Liu and H M Srivastava, A linear operator and associated families of meromorphically...
  • 12
  • 290
  • 0
Báo cáo hóa học: "Research Article Epileptic Seizure Prediction by a System of Particle Filter Associated with a Neural Network" doc

Báo cáo hóa học: "Research Article Epileptic Seizure Prediction by a System of Particle Filter Associated with a Neural Network" doc

Ngày tải lên : 21/06/2014, 20:20
... is a nonlinear model with Gaussian state space A local linearization technique is applied to nonlinear equations and an approximate linear equation is obtained in (16) A series of values of hidden ... The mean value and variance can be calculated for 15–30 minutes before the peak; peak amplitude can be detected by the real peak value, and the width of peak can also be obtained at the same time ... probability to raise an alarm in a period of duration can be calculated as [10] This is the probability of predicting at least k out of K seizures by means of at least one of d independent features...
  • 10
  • 348
  • 0
Báo cáo hóa học: " Research Article Some Subclasses of Meromorphic Functions Associated with a Family of Integral Operators" pptx

Báo cáo hóa học: " Research Article Some Subclasses of Meromorphic Functions Associated with a Family of Integral Operators" pptx

Ngày tải lên : 22/06/2014, 02:20
... Y C Kim, and H M Srivastava, “The Hardy space of analytic functions associated with certain one-parameter families of integral operators,” Journal of Mathematical Analysis and Applications, vol ... functions associated with a family of multiplier transformations,” Journal of Mathematical Analysis and Applications, vol 300, no 2, pp 505–520, 2004 R M El-Ashwah and M K Aouf, “Hadamard product of ... Mathematical Analysis and Applications, vol 3, no 1, article 8, 11 pages, 2006 25 T N Shanmugam, S Sivasubramanian, B A Frasin, and S Kavitha, “On sandwich theorems for certain subclasses of analytic...
  • 18
  • 308
  • 0
Báo cáo toán học: "The Fraction of Subspaces of GF(q)n with a Specified Number of Minimal Weight Vectors is Asymptotically Poisson" pot

Báo cáo toán học: "The Fraction of Subspaces of GF(q)n with a Specified Number of Minimal Weight Vectors is Asymptotically Poisson" pot

Ngày tải lên : 07/08/2014, 06:20
... journal of combinatorics (1997), #R3 Introduction Almost all the familiar concepts of linear algebra, such as dimension and linear independence, are valid without regard to the characteristic of ... problems associated with fundamental concepts of linear algebra; for example, how many subspaces of dimension k are there in the vector space GF(q)n ? The answer is often denoted n q , and we have ... relation of P to two adjacent ranks be regular in the graph theoretic sense.) For example, both the subsets of a set and the subspaces of a vector space, ordered by inclusion, are regular A downset...
  • 8
  • 421
  • 0
Báo cáo khoa học: "Water relations of spruce seedlings sprayed with a surfactant" pot

Báo cáo khoa học: "Water relations of spruce seedlings sprayed with a surfactant" pot

Ngày tải lên : 08/08/2014, 23:22
... degradation of the so-called structural waxes into a more amorphous and less porous material lings (Rinallo and Raddi, 1989b) ABS was also demonstrated to have a role as water and air pollutant and ... of treatments on plant water relations, it is worth noting that the variation of transpiration rate and stomatal conductance, as a function of the plant water status, was the same in ABS-treated ... potential was measured at dawn and the transpiration rate was assessed on a daily basis Stomatal conductance was measured at irregular intervals, when photosynthetic active radiation was > 1000 μmolm...
  • 9
  • 177
  • 0
Báo cáo y học: "Direct electrochemical analyses of human cytochromes b5 with a mutated heme pocket showed a good correlation between their midpoint and half wave potentials" doc

Báo cáo y học: "Direct electrochemical analyses of human cytochromes b5 with a mutated heme pocket showed a good correlation between their midpoint and half wave potentials" doc

Ngày tải lên : 10/08/2014, 05:21
... (5’-GGTGGGGAAGAAGTTATCAGGGAACAAGCTGG-3’); for L51T, L51T-R (5’-CCAGCTT GTTCCCTTGTAACTTCTTCCCCACC-3’) and L51T-F (5’-GGTGGGGAAGAAGTTACAAGGGAACAAGCT GG-3’); for A5 9V, A5 9V-R (5’-CCTCAAAGTTCTCAGTAACGTCACCTCCAGCTTG-3’) ... (5’-CCTCAAAGTTCTCAGTAACGTCACCTCCAGCTTG-3’) and A5 9V-F (5’-CAA GCTGGAGGTGACGTTACTGAGAACTTTGAGG-3’); for A5 9 S, A5 9S-R (5’-CAAGCTGGAGGTGACTCTACTGAGAACTTTGAGG-3’) and A5 9S-F (5’-CA AGCTGGAGGTGACTCTACTGAGAACTTTGAGG3’); for G6 7A, ... G6 7A- R(5’-GGCATCTGTAGAGTGCGCGACATCCTCAAAGTTC-3’) and G6 7A- F (5’-GAAC TTTGAGGATGTCGCGCACTCTACAGATGCC-3’); and for G67 S, G67S-R (5’-GGCATCTGTAGAGTGCGAGACATCCTCAAAGTTC-3’) and G67S-F (5’-GAA CTTTGAGGATGTCTCGCACTCTACAGATGCC-3’)...
  • 15
  • 477
  • 0
Báo cáo y học: "Long term follow up after surgery in congenitally corrected transposition of the great arteries with a right ventricle in the systemic circulation" pot

Báo cáo y học: "Long term follow up after surgery in congenitally corrected transposition of the great arteries with a right ventricle in the systemic circulation" pot

Ngày tải lên : 10/08/2014, 09:22
... patient also had a dextrocardia, with additionally mitral and aorta regurgitation, resulting in cardiac failure, finally leading to cardiac transplantation The third patient had a pacemaker implantation ... patients had an intact atrial and ventricular septum and an adequate subpulmonary outflow One patient had a dextrocardia and a long history of cardiac failure before transplantation The second patient ... incomplete, a word of caution may be relevant with regard to an increased incidence of abnormal anatomy of the proximal coronary arteries Page of Limitations of this study In general, CCTGA has a low...
  • 7
  • 387
  • 0