0

pass null as a parameter value to sqlparameter

Vcd as a stimulating factor to increase the young learners’ time-on-task

Vcd as a stimulating factor to increase the young learners’ time-on-task

Thạc sĩ - Cao học

... he also makes a distinction between task-based teaching and task-supported teaching. The task-based teaching occurs when the teaching is based exclusively on meaning-focus tasks, and the task-supported ... The classroom English language teaching has a fixed place and adequate time and relatively stable attendance of students. These factors facilitate teachers’ organizing interactive learning activities ... past few decades. So many approaches and methods such as Audiolingual Method, Total Physical Response, Content-based language teaching, Theme-based language teaching have been advanced, but...
  • 45
  • 516
  • 0
Báo cáo khoa học: Post-ischemic brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue to stroke treatment pptx

Báo cáo khoa học: Post-ischemic brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue to stroke treatment pptx

Báo cáo khoa học

... mediators is probably a result of the fact thatinflammatory transcription factors such as nuclearfactor-kappaB, activator protein-1 and nuclear factorof activated T-cells are positively regulated ... (TNF -a) [43]. Takentogether, these findings point to basal PARP-1 activity as central to homeostatic regulation of endothelialfunction, whereas its hyperactivation appears causal to BBB damage and ... from NADPH oxidase and mitochondria, sus-tained increase of the cytosolic Ca2+concentrationand finally nuclear translocation of mitogen-activatedprotein kinase kinase ⁄ extracellular regulated...
  • 10
  • 417
  • 0
Báo cáo y học:

Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"

Y học thưởng thức

... an intestinal virus change to that of a respiratory airborne-virus that is adapted to the mammalian lung? Second, the viruses must adapt to environmental changes, able to withstand temperate, ... Journals of the American Medical Association. Influenza was not a reportable disease: the only evidence of the early occurrence was the registration of deaths reported as uncomplicated cases ... mammalian hosts. These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans. Pigs can be infected with both avian and human influenza A...
  • 4
  • 520
  • 0
USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY

USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY

Quản trị kinh doanh

... understand more how a company builds and manages its brand to get the full benefit from that, a study into the case of LiOA brand at Nhat Linh Co. Ltd., an auto voltage stabilizer (AVS)manufacturer ... communicated to the target audience and that demonstrates an advantage over competing brands.The four salient characteristics of a brand position as reflected by the phrases “part,” “target audience,” ... checks. As part of its determination, the Company has also registered for ISO 9002 standards for its electric wires and cables.Weakness• The top-down management approach can also be a weakness as...
  • 67
  • 974
  • 0
Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

Báo cáo khoa học

... Crassos-trea gigas (Mollusca, Bivalvia). Sequence data were depos-ited in GenBank (Table S1).Searches in databasesUsing the putative C-terminal domain of C. fluminea as a query, sequence databases ... sequence databases were searched by blastp andtblastn for the occurrence of domains similar to theP. haloplanktis C-terminal domain. URLs of the relevantgenome databases are given in Table S1. ... species, but mainly innonvertebrate animals, and invariably connected via a linker to an animal-type a- amylase (listed in Table S1), as shown in Fig. 1. More specifically, the primarystructure...
  • 8
  • 624
  • 0
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

Báo cáo khoa học

... S, Asano N & Suzuki Y (1999) Acceler-ated transport and maturation of lysosomal alpha-galac-tosidase A in Fabry lymphoblasts by an enzymeinhibitor. Nat Med 5, 112–115.20 Fan J-Q & ... cardiac function in the cardiac variantof Fabry’s disease with galactose-infusion therapy. NEngl J Med 345, 25–32.18 Asano N, Ishii S, Kizu H, Ikeda K, Yasuda K, Kato A, Martin OR & Fan ... mechanisms.Proc Natl Acad Sci USA 103, 13813–13818.29 Yu L, Ikeda K, Kato A, Adachi I, Godin G, CompainP, Martin O & Asano N (2006) alpha-1-C-octyl-1-de-oxynojirimycin as a pharmacological chaperone...
  • 7
  • 507
  • 0
Tài liệu Adding value to traditional products of regional origin - A guide to creating a quality consortium pptx

Tài liệu Adding value to traditional products of regional origin - A guide to creating a quality consortium pptx

Tiếp thị - Bán hàng

... obtains protection, in the best-case scenario, as a trademark. Meanwhile, in coun-tries such as Thailand, Malaysia or Indonesia, for example, handicraft and industrial products can aspire to a ... origin and quality on the packag-ing of certified products such as Italian Parmigiano-Reggiano, Colombian Coffee and Greek Feta, serve as a legal safeguard against fraudulent imitations and also as ... producers and companies whose aim is to add value to a traditional product of regional origin and act as a platform for the fair and balanced coordination of interests and efforts in the same value...
  • 79
  • 438
  • 0
Tài liệu Using Proven Sales Techniques for Selling WorkKeys as a Solution to Business doc

Tài liệu Using Proven Sales Techniques for Selling WorkKeys as a Solution to Business doc

Tiếp thị - Bán hàng

... because you get your work done quickly. You like to sugarcoat unpleasant experiences and rationalize bad situations into good ones. You have a propensity towards narcotic addiction. Twisted Apart, ... indomitable Southern belle loves and loses and loves again a slyly dashing war profiteer as she struggles to protect her family and beloved plantation. •  A pig raised by sheepdogs, learns to herd ... Eat Them: Stay away from small furry animals and seek professional medical help immediately. I Don’t Have A Favorite Way; I Don’t Like Oreo Cookies: You probably come from a rich family, and...
  • 48
  • 482
  • 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Báo cáo khoa học

... L. lactis ald gene as follows. A PCR fragment was generated using primer CP-pyk(5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTTGACANNNNNNNNNNNNNNTGRTATAATNNNNAAGTAATAAAATATTCGGAGGAATTTTGAAATGAATAAACGTGTAAAAATCG-3¢)(N¼ ... (5¢-GGAAGGATCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4(5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) wereamplified. The PCR products were digested with XhoI ⁄BamHI and BamHI ⁄ XbaI, respectively, and cloned ... DNA ligase(Fermentas) and shrimp alkaline phosphatase (Fermentas)were carried out as prescribed by the manufacturers. DNAfragments were purified from agarose gels using GFXPCR DNA and Gel Band...
  • 12
  • 616
  • 0
Tài liệu The Value of the Case Study as a Research Strategy doc

Tài liệu The Value of the Case Study as a Research Strategy doc

Cao đẳng - Đại học

... Yin are especially adamant that a case database be created and maintained to \allow repetition and re-evaluation of cases. Reliability is most important during the data collection phase, and ... Administrative Science Quarterly article titled 'Qualitative data as an attractive nuisance' that research based upon case study was unlikely to transcend story-telling. Is case study a ... (b) Qualitative research as preparation - As mentioned above, qualitative research has a long standing history as an exploratory strategy. Comments of researchers that qualitative research is...
  • 15
  • 587
  • 0
Tài liệu Supporting Children Learning English as a Second Language in the Early Years (birth to six years) docx

Tài liệu Supporting Children Learning English as a Second Language in the Early Years (birth to six years) docx

Kỹ năng viết tiếng Anh

... different path-ways to achieving these outcomes.Who are learners of English as a second language? Standard Australian English is the national language of Australia and it is essential that all ... Kindergarten Association Multicultural Resource Centre, Richmond, Victoria, Australia.Milne, R 1997, Marketing Play, Free Kindergarten Association, Richmond, Victoria, Australia.Nyakatawa, S and ... important to ascertain how much language they are using at home. If necessary use a bilingual worker to talk with the family and establish what language the child speaks at home, ask the family...
  • 31
  • 1,043
  • 2
Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc

Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc

Sức khỏe phụ nữ

... controls. Sham-treated animalsunderwent all preparations for ultrasound treatment as treated animals: anesthesia was administered and main-tained at 2 - 2.5% isoflurane/oxygen, scrotal fur wasshaved, ... apparatus A Plexiglas cylinder was used as the ultrasound chamber(70 mm diameter, 25 mm tall). The bottom of this cham-ber was a single layer of acoustically transparent latex. A single layer of acoustically ... ofultrasound energy. An ultrasound-transparent, nylon mesh was attached to the bottom of the ring to maintain a minimum distance of 1 cmbetween the bottom of the ultrasound chamber and the proximal...
  • 15
  • 967
  • 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Báo cáo khoa học

... CGGAAACGCCTTAAGTCCAG GCCACAATCCAGTCATTCCA 83MT 2A AATAAGCTTCCGACTCTAGCCGC GATAAGCTTGTGGAAGTCGCGT 259CD237904 AGCTGGTGCAGGAGGAAGTA TCTCACTGGCCCTAAACTGG 92AL707095 CCGAGAACCGAACTTACCAA CTGATAGGGGTTGGGTGATG ... (5¢ -to3 ¢)Size(bp)MDR1 GAAGAAGGGCCAGACGC CTCCTGGGACACGATGC 178MRP1 CCTTCGCTGAGTTCCTGC CTGCGGTGCTGTTGTGG 246BCRP ACATCAGCGGATACTACAGAG CACCATCATAAGGGTAAACAT 173CA9 TTTGAATGGGCGAGTGATTG ACAGCAAAAAGGAGGCCAAA 138BMP2 ... CTGATAGGGGTTGGGTGATG 128AK095731 AGGAAGCACCCAGCAATACCA GCATTTCCATTTCCCTAAGCAC 109DKK1 CACCTTGGATGGGTATTCCA CAACACAATCCTGAGGCACA 114BC037851 CACAGCTCCCATTCATTCCA TCCCTTTGCCTCCTGTTGTT 107b-Actin TCCTCCCTGGAGAAGAGCTA...
  • 13
  • 563
  • 0

Xem thêm

Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25