... the efficiency of patient care can be improved Secondary objectives are to determine the sustainability ofthe intervention, to further evaluate the accuracy ofthe rule, and to conduct an economic ... Community Matched Pairing 2T 2T 2T 2C 2C 2C Randomization Control Sites TC TC TI TC TI CC CC TI CI CC CI CI Intervention Sites Figure Matched-Pair Design Allocation Scheme for "After" Period Matched-Pair ... http://www.implementationscience.com/content/2/1/4 Objectives The principal objectives of phase II (1999–2002) were to prospectively assess the accuracy, reliability, and clinical sensibility ofthe Canadian C- Spine Rule and the United...
... restrictions on access to bureaucratic decision-making The Chernobyl accident the following year had channelled much ofthe public disapproval into the environmental area, in particular of activities ... Assessment (OTA), Nuclear Wastes in the Arctic: An Analysis of Arctic and Other Regional Impacts from Soviet Nuclear Contamination (Washington, DC: Office of Technology Assessment, Congress ofthe United ... region,14 but also because of a tendency to allocate scarce docking facilities to the reloading of operative vessels rather than the unloading of laid-up ones Hence, the backbone of radioactive waste...
... guidelines with the goal of achieving best practices that reduce variation and enhance quality of medical care The Quality Management Directorate ofthe Army Medical Command (MEDCOM) contracted with ... takes into account the strength of relevant scientific evidence, which is documented in the practice guideline report The guidelines identify specific practices that are either strongly recommended ... resources that aid the MTFs as they carry out actions to improve clinical practices Such support encourages MTFs to make needed practice changes to move toward consistency in practices across...
... included: • Implementation process evaluation—documented theimplementation activities of participating MTFs, described their suc- Introduction cesses in changing clinical practices, identified successes ... Adoption of a practice guideline based on these measures predicts a number of changes in clinical practice (Table 1.2) Table 1.2 Changes in Clinical Practices Predicted by Practice Guideline Implementation ... clearly change the degree of compliance with practitioner-controlled criteria (such as choice of antibiotic), determining the dominant influence on practice is difficult (Evans et al., 1998) Basic Implementation...
... public version ofthe report i Office ofthe Inspector General Audit Approach The Office ofthe Inspector General (OIG) performed this audit to assess the status oftheimplementationofthe IWN ... wireless communications and centrally manage the consolidated wireless account, known as the Law Enforcement Wireless Communications (LEWC) account The LEWC account supports the maintenance, consolidation, ... determined that the classification of costs did not accurately capture total IWN expenditures According to WMO officials, they have changed the classification categories to improve the way they capture...
... eukaryotic c class cytochromes [27]; anions exert a strong influence on the lysine residues of cytochrome c, and significantly affect the structure and the functional properties ofthe protein, as the conserved ... modulates the structure ofthe A state of cytochrome c Biochemistry 39, 12632– 12638 18 Sinibaldi F, Howes BD, Smulevich G, Ciaccio C, Coletta M & Santucci R (2003) Anion concentration modulates conformation ... Fig Fig Absorbance at 695 nm of acid-denatured cytochrome c in the presence of increasing sulfate (s) and selenate (d) concentrations The optical absorbance of native cytochrome c (—) at pH 7.0...
... and (c) inactivation of EIIGlc is accelerated in the presence of Glc (see below) Although the dominant reactivity of Cys421 compromised the labelling of other active-site residues, the glucose ... II-BGlc, a glucose receptor ofthe bacterial phosphotransferase system: molecular cloning of ptsG and purification ofthe receptor from an overproducing strain of Escherichia coli Proc Natl Acad Sci ... biphasic to a monophasic shape are Table Rates of inactivation of IICBGlc Incubation of purified IICBGlc with the indicated concentration (mM) ofthe analogues 1a)3d was carried out at 30 C Rate constants...
... amplified from the cDNA #911 using the following pair of primers: 5¢-CTGGATCCCT ATGTCGTGTCCCAGGAGCATCGAG-3¢ and 5¢-GTC TGCAGTTAAAAATTCGGGACATTCCTTAGCCA GG-3¢ BamHI–PstI digested PCR product was cloned ... following pair of primers: 5¢-CAGAATTCA TGACACTTCCTAGTGCGGCTCGC-3¢ and 5¢-CTG GATCCTTATTGCTGATTATTGGGATTCATTTGA CCA-3¢ EcoRI–BamHI digested PCR product was cloned as a fusion with the GAL4 activation ... using the following pair of primers: 5¢-GACTGCAGTGAAGG GCATCGAGTCCTCGGG-3¢ and 5¢-GAGGATCCGG GACATTCCTTAGCCAGGAGGG-3¢ To make the b-galactosidase expressing construct, a 173-bp PCR fragment of the...
... responses to the DESD The most crucial element to the Decade’s success is the scope ofthe human resources brought together, including these enthusiastic volunteers and others who have much to offer, ... to an education was reinforced by the Convention on the Right ofthe Child (CRC) in 1989, which declares that primary education should be compulsory and available free to all The CRC further states ... perspective, another may be concerned with sustainable economic growth and yet another with sociocultural perspectives The added value ofthe Decade is that it recognizes that these perspectives...
... the open cleft conformation The cleavage within the D-loop enhances the nucleotide exchange [17] and increases accessibility ofthe cleft to limited proteolysis [5], which characterizes the cleft ... stabilizing the filament by closing the cleft in actin subunits [49,50] Hence, the increase in the thermal stability of ECP-cleaved F-actin and the disappearance ofthe shoulder on the DSC profile can ... exceed ±10% G-actin Results Effects ofthe D-loop cleavage on the thermal unfolding of G-actin The excess heat capacity curves obtained for intact, ECP-cleaved, and subtilisin-cleaved ATP-Ca-G-actins...
... requirements to comply with mandatory collection and recycling objectives The modalities ofthe logistics and the organisation ofthe take-back schemes are left to the choice of Member States Before the ... summary Factors that impact the operation of compliance schemes There are a number of factors that will have, depending on the characteristics of each country, varying impact on the operation of compliance ... the Nordic schemes use a more complex system of up to 50 product categories, each with their own price allocations This kind of system provides a better reflection ofthe costs of recycling the...
... basis of openness and accountability The 1996 Electronic Freedom of Information Act (e-FOIA) Amendments extended these principles to include electronic access to information Under the act, the ... right of access to government records and information, on the basis ofthe principles of openness and accountability in government Before the act, an individual seeking access faced the burden of ... instructions to staff that affect a member ofthe public; • copies of records that have been released to any person through FOIA and which, because ofthe nature of their subject matter, the agency...
... which associates objects and the functions they represent A Semantic Definition ofthe CPU As mentioned earlier, the bare CPU consists essentially ofthe semantic definition of an FP-type application ... at least subject to change and redefinition at short notice In other words, we want to be able to construct compilers which can compile code for a class of machines, so as to concentrate attention ... strings ofthe language define just those sequences of PS applications which are allowed The user supplies a control 'grammar', which, in a concise and perspicuous way, specifies the class of allowable...
... MPLS core cannot endanger the security ofthe customer’s network • Integrity ofthe traf c Packets cannot be changed on their way through the core without the change being noticed Bogus packets cannot ... this could be an obvious choice If the SP controls the CEs as part ofthe service, the customer has to decide whether to trust the SP to configure IPSec for him/her on the CE routers, or whether ... incoming packets), according to the previous steps, then the security of this device can be treated as the security of a PE router in the cases above If the remote-access server is not a PE, the...
... mathematics teaching associations, the CCSSO, the National Governors Association, PARCC, and Smarter Balanced This coalition’s website provides CCSS-aligned curricular resources for mathematics ... set of standards that a large body of states would agree to embrace Coordinated by the National Governors Association Center for Best Practices and the Council of Chief State School Officers (CCSSO), ... assurance review by Laura Hamilton and Paco Martorell vii Abbreviations CCSS Common Core State Standards CCSSO Council of Chief State School Officers CSP Community Strategic Plan DDESS Department of...
... Journal of Science, Mathematics - Physics 24 (2008) 239-244 243 The development ofthe amplitude and the phase shift according to the noise level Noise (V) Fig The dependence ofthe output dc-voltage ... Fig.8 The Fig shows the constancy ofthe output dc-voltage (Vs = 0.495 V) when the amplitude of noise reaches 5V Similarly, we record the dependence ofthe phase shift on the amplitude of noise ... signal lies in the range ofthe providing ADC The digital signal from ADC is divided into multiplying circuits At the circuit (5) the signal is multiplying with the reference signal ofthe form sin(ωrt...
... CIS Collective Investment Scheme CESR Committee of European Securities Regulators COBS Conduct of Business sourcebook ofthe FSA Handbook COLL Collective Investment Schemes sourcebook ofthe FSA ... including the COLL, SYSC and COBS sourcebooks 4.2 The Directive aims to strike a balance between a level of consistency with the UCITS and MiFID regimes, while taking account ofthe diversity of ... their territory, as contemplated in articles 36 and 42 ofthe Directive).48 ESMA’s opinion must include advice to the Commission on the efficacy ofthe EU AIFM passport and the viability of creating...
... TGCACCACCAACTGCTTAG GCCATTCACAGGGCACATTC CCTCCTGATGGTGATGTATCGA TAACCACCGTAGTCCGGGTACT AGCGACTGTAGTGAAACTCCTTCTC AGCATCACCCATTTGATGT TCCACGACATACTCAGCAC GACGCAGGGATGATGTTC CCGGTTCCTCTTGGTGTTCA 2756 FEBS Journal ... Human CDX2 Rat GAPDH Mouse GAPDH Human GAPDH Rat proglucagon AAACCAGGACGAAAGACAAATACC GGACGTGAGCATGTATCCTAGCT CCTCGGCAGCCAAGTGAA TGATTCTACCCACGGCAAGT AACGACCCCTTCATTGAC TGCACCACCAACTGCTTAG GCCATTCACAGGGCACATTC ... HT-29 cell line by real time RT-PCR The nonendocrine colon cancer cell line HT-29 (A), or the endocrine cell line GLUTag (B), or the primary cell culture FRIC (C, D) were treated with either the control...
... the efficacy of drug response To further characterize this, dose–response curves were constructed for two of these and it was found that the Ki was not significantly affected once the differences ... on the images represents lm Ó FEBS 2002 Role ofthe cytoplasmic C- terminus of SUR1 (Eur J Biochem 269) 5311 Fig Analysis ofthe effect of coexpression of SUR1del249myc on Kir6.2 trafficking The ... trafficking assay It can be observed that coexpressing of channel subunits significantly changes the percentage of membrane associated fluorescence corresponding to both Kir6.2 and SUR1 The scale...