mpi program to carry out a trapezoid rule integration in parallel using a simple loop splitting algorithm with cyclic distribution of iterations and a reduction
báo cáo khoa học: " How to develop a program to increase influenza vaccine uptake among workers in health care settings?" potx
... locations, and names according to the individual situation of nursing homes Step five: planning of program adoption and implementation To assure program adoption, implementation, and sustainability, ... attention for avian influenza HCWs understand what avian influenza is and how - Explain avian influenza on website it relates to annual human influenza All HCWs should get vaccinated HCWs understand the ... actively requesting HCWs to get vaccinated, and informing HCWs about influenza vaccination were all associated with a significantly higher uptake of influenza vaccination among HCWs [12] Mean differences...
- 9
- 353
- 0
Báo cáo khoa học: "Robust Approach to Abbreviating Terms: A Discriminative Latent Variable Model with Global Information" docx
... The evaluation metrics used in the abbreviation generation are exact-match accuracy (hereinafter accuracy), including top-1 accuracy, top-2 accuracy, and top-3 accuracy The top-N accuracy represents ... generation problem Eytan Adar 2004 SaRAD: A simple and robust abbreviation dictionary Bioinformatics, 20(4):527– 533 Hiroko Ao and Toshihisa Takagi 2005 ALICE: An algorithm to extract abbreviations ... of IJCAI’03, pages 421–426 Slav Petrov and Dan Klein 2008 Discriminative loglinear grammars with latent variables Proceedings of NIPS’08 Ariel S Schwartz and Marti A Hearst 2003 A simple algorithm...
- 9
- 389
- 0
Báo cáo hóa học: " Letter to the Editor A Further Result about “On the Channel Capacity of Multiantenna Systems with Nakagami Fading”" potx
... example, Maple and Mathematica REFERENCES [1] F Zheng and T Kaiser, “On the channel capacity of multiantenna systems with Nakagami fading,” EURASIP Journal on Applied Signal Processing, vol 2006, Article ... could be useful with respect to channel capacity modeling of multiantenna systems with Nakagami fading The given expressions involve the digamma, exponential integral, imaginary error, and the hypergeometric ... books and has over 300 papers published or accepted He has held positions in Florida, California, and Nebraska Samuel Kotz is a distinguished Professor of statistics in the Department of Engineering...
- 2
- 271
- 0
The Path to Financial Freedom: A simple and easy guide to assist you in reducing or eliminating pdf
... designed to reduce principal liability The program works as follows: A certified financial counselor will work out a payback plan that you can comfortably handle and will have you debt-free in to years ... personal interest bearing account until payouts become due Your total savings with this program at a $20,000 debt level is $10,000 in principal and over $100,000 in potential interest This public outreach ... say you owe a total of $20,000 or more We will negotiate with your creditors to accept a 50% reduction The remaining debt will be paid back over to years at 0% interest The payments are held in...
- 2
- 325
- 0
Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx
... X52869) was amplified from pZEOSV (Invitrogen, Carlsbad, CA, USA) by PCR using sense primer 5¢-ATCAAAACAACCAAAA TGGCCAAGTTGACCAGTGC-3¢ and antisense primer 5¢-GAATGCGGCCGCTCAGTCCTGCTCCTCGGCCAC-3¢, ... Biosciences, Columbia, MD, USA) with sense primer SOE-3 (5¢-AAAAATCA ACGCTGAACAATGGTGAGCAAAGGGCGAG-3¢) and antisense primer SOE-4 (5¢-GAATGCGGCCGCTTACT TGTAACAGCTCGTCCATG-3¢), which introduced a NotI site ... 5¢-GAATGCGGCCGCGA ATGTGTGCAAATTGAAGAAC-3¢ and antisense primer 5¢-TTCGAGCTCCGGGGAAACGGTGCCAACTT-3¢, which introduced a NotI site (underlined) and a SacI site (bold) The resulting 592-bp DNA fragment...
- 11
- 668
- 0
Báo cáo khoa học: " A simple pattern-matching algorithm for recovering empty nodes and their antecedents∗" pot
... Figure accuracy of transitivity labelling was not systematically evaluated here 2.2 Patterns and matchings Informally, patterns are minimal connected tree fragments containing an empty node and all ... Proceedings of the 35th Annual Meeting of the Association for Computational Linguistics, San Francisco Morgan Kaufmann Michael Collins 2000 Discriminative reranking for natural language parsing In ... performance averaged over all empty node types was approximately the same as the pattern-matching algorithm As a comparison of tables and shows, the pattern-matching algorithm s biggest weakness...
- 8
- 346
- 0
Báo cáo khoa học: "Improving Grammaticality in Statistical Sentence Generation: Introducing a Dependency Spanning Tree Algorithm with an Argument Satisfaction Model" pptx
... Proceedings of the first international conference on Natural language generation, Morristown, NJ, USA Colin Bannard and Chris Callison-Burch 2005 Paraphrasing with bilingual parallel corpora In Proceedings ... for statistical machine translation In Proceedings of the 43rd Annual Meeting on Association for Computational Linguistics, Morristown, NJ, USA Sebastian Pad´ and Mirella Lapata 2006 Optimal o ... dependency parsing using spanning tree algorithms In Proceedings of the conference on Human Language Technology and Empirical Methods in Natural Language Processing, Morristown, NJ, USA Y J Chu and T...
- 9
- 305
- 0
A History of Writing one of the earliest examples of writing, a 4th millennium tablet from Uruk, lists sacks of grain and heads of cattle ppt
... foremost of the west, that he may give a good burial to the god’s father of Amun-Re, king of gods, Pawiaenadja, true of voice The arrow points to an apparent “scribo” The Rosetta Stone was carved around ... character segment in red was adapted to form the katakana on the left Today, Japanese uses four different writing systems: romaji, Roman letters representing Japanese sounds hiragana, ordinary ... The earliest Japanese writing, dating from the 8th c., and perhaps as early as the 6th c., is called manyogana and uses Chinese characters (right column) to represent Japanese phonetic values...
- 32
- 505
- 0
báo cáo hóa học:" A MIF haplotype is associated with the outcome of patients with severe sepsis: a case control study" pdf
... 183 patients after abdominal surgery without post-operative signs of infection or inflammation, without ICU admission and without case of death within the first postoperative 28 days served as ... 0.052 Data are presented as mean and range of values death due to severe sepsis compared to patients without allele CATT7 The concomitance of the -173 allele C and the -794 allele CATT7 as a haplotype ... analyzed separately as well as analyzed as a haplotype Especially in the sub group of patients ≤60 years old and in patients with non-abdominal and non-pulmonary sepsis focus the association with...
- 8
- 554
- 0
Báo cáo hóa học: "Research Article A Decision-Tree-Based Algorithm for Speech/Music Classification and Segmentation" pot
... speech databases, also containing a total of 60 minutes Both high and low bitrate signals were used 2.2 General Algorithm A block diagram of the main algorithm of the learning phase is depicted in ... studies and suggests that the algorithm is robust and applicable in various testing conditions The algorithm was tested against standard approaches such as SVM and LDA, and showed comparable, often ... Conclusion In this paper we presented an algorithm for speech/music classification and segmentation, based on a multistage statistical approach The algorithm consists of a training stage with an automatic...
- 14
- 272
- 0
Báo cáo hóa học: " Research Article A Simple Technique for Fast Digital Background Calibration of A/D Converters" potx
... mismatch, so that larger stages would have to be used, with an increase in area and power consumption with respect to a simple ADC This issue has been addressed in [14] by using a gain and offset correction ... obtained, and that is a linearized version of Do K is a gain factor which sets the bandwidth of the filter, determining the tradeoff between speed and accuracy 3.1 DIGITAL BACKGROUND CALIBRATION ... have been obtained using L = Calibration has been applied to the first four stages Figure 10 shows the spectrum of the output signal without calibration and when calibrated with the standard and...
- 11
- 398
- 0
Báo cáo toán học: " THE DISTRIBUTION OF DESCENTS AND LENGTH IN A COXETER GROUP" pps
... and a ne Weyl groups This section (and the remainder of the paper) is devoted to specializing Theorem to compute generating functions for descents and length in all of the classical finite and a ne ... q-Eulerian polynomial W (t, q) of a general Coxeter system (W, S) In Section III, we apply this to compute a generating function analogous to equation (1) for a general class of in nite families of ... q) Remarks The specialization of equation (2) to q = appears as [Ste, Proposition 2.2(b)], and the special case of (2) in which W is of type An appears in slightly different form as [DF, equation...
- 20
- 352
- 0
Báo cáo toán học: "A Simple Method for Constructing Small Cubic Graphs of Girths 14, 15, and 16" pptx
... A Final Note For a given n and t, it is fairly easy to an exhaustive search through all graphs of this type discussed above So we were able to verify that these are the smallest such graphs with ... vj,k be an isomorphism, for all i and j In this case we can obtain a simple generalization of the Petersen graph by choosing r positive integers h1 hr , hi < n/2, and joining vertex vi,k to vi+hi ... consisting of four pairs of tree edges (each pair joining two endvertices at distance 2) and four chords Specifically, let vi,x and vi,y be endvertices adjacent to vi,z in Ti Then the following vertices...
- 3
- 374
- 0
báo cáo khoa học: " Analysis of a c0t-1 library enables the targeted identification of minisatellite and satellite families in Beta vulgaris" ppt
... ED022281 ATAATCATACCTCTATGCCTATTCCAAGTTCTAATGGCTAATGCAAGTCCT AAAATACTCATTTAAACTTTCTACTACATGGTTGTAAGATTCTAAGCAAGT TTAATACACTTAGCCAATTAAAATGAGAAAAACTAAGCCATTTCGAGCCGT TTTTTGGGTTTCATGTTCCT HinfI-satellite ... TGTGACTTGTAACATTGCGCGGGTGCTTGGCACCATTTGCGTTACCTCAAA AAGCCTTTGAACACCCCAATTATTCATTTCTCGCGAAATCCAAAATTGCCT CGAAATGAACGTAAAGGCATCCACATATTTGTTCCAAGCCACATGACTCCT TTACATTGACCTCCTATGTCCCTAGGAGGCATCCCGTGCCATTTGGAGCTC ... BvMSat08 GAAAAAATAAGTTCAGATCAGATCAGATCA 32 48 77 - 100 DX107266 GGGTCGGAATAAATCGGCTTTCGAAATGACTT BvMSat09 32-39 24 46 - 100 FN424406 AGAAGTATACAAGAACATTAATCAAAATATATAAACAAA BvMSat03 BvMSat10 40 51...
- 14
- 270
- 0
Báo cáo y học: "A simple intravenous glucose tolerance test for assessment of insulin sensitivity" pptx
... hospital’s routine laboratory Plasma insulin and C-peptide were measured using ELISA kits (Mercodia AB, Uppsala, Sweden) Calculations The pharmacokinetics of the glucose load was analysed using a ... /CL) The AUC for plasma insulin was calculated by using the linear trapezoid method The glucose and insulin data were also analyzed by applying the “minimal model” (MINMOD) of Bergman et al [6,7] ... AM A superficial dorsal hand vein was cannulated in retrograde direction with a small three-way needle and kept patent by repeated flushing with saline solution The hand and lower arm were warmed...
- 10
- 266
- 0
A uniformly sampled genetic algorithm with gradient search for system identification
... aircraft wings using 11 inputs of strain responses and 11 outputs of concentrated load in each pattern and a total of 13 patterns were included (Cao et al., 1998) Damage was identified by an iterative ... than simulated annealing and basic PSO in damage identification using frequency domain data (Begambre and Laier, 2009) The differential evolution strategy was investigated for identifying physical ... staff in the Structural and Concrete Laboratory, especially Mdm Annie Tan, Mr Koh Yian Kheng, Mr Kamsan Bin Rasman Their patience and invaluable assistance contributed a lot to the success of...
- 298
- 234
- 0
How to get out of the friendzone: turn your friendship into a relationship
... she’d heard he was dating someone and wanted to know all about it After hearing about Cara, Katie badmouthed her, even going so far as implying that Sam should break up with her because Cara wasn’t ... started dating and things were going well At a party soon after Sam and Cara started seeing each other, Sam ran into Katie, who threw her arms around him and whispered that they needed to talk; ... Tiana responds with a video of a Maltipoo in a teacup P.M Tiana’s cubicle mate, Laura, asks her if James is single Tiana responds in the affirmative Laura asks if she’d mind if she went out with...
- 240
- 1,057
- 1
Additional Measures Needed to Assess 7(a) Loan Program’s Performance potx
... reports) and SBA data on outstanding 7 (a) loans In analyzing data from call reports, SBA defines a small business loan as a commercial and industrial loan for which the original amount was less than ... of Columbia, Virginia, West Virginia, North Carolina, South Carolina, Georgia, and Florida); (8) West North Central (Minnesota, Iowa, Missouri, North Dakota, South Dakota, Nebraska, and Kansas); ... lender at the time of loan Page GAO-07-769 SBA's 7 (a) Loan Program a) application or within 90 days of the loan being approved, and is based on the guaranteed portion of the loan amount approved and...
- 72
- 294
- 0
Báo cáo sinh học: " A critical assessment for the value of markers to gate-out undesired events in HLA-peptide multimer staining protocols" pot
... all labs to use their own protocol for thawing, staining, gating, and data analysis Each laboratory performed two parallel assays, one with and one without the inclusion of dump channel markers ... Data generated by individual laboratories were evaluated in ways Initial analysis was performed in a non-censored manner using the numerical data generated and provided by individual laboratories ... pre-testing experiments in his lab CMB was the proficiency panel leader and mainly involved at all stages of the project, including organizational and scientific aspects, data analysis and interpretation...
- 13
- 752
- 0
o cáo hóa học:" A critical assessment for the value of markers to gate-out undesired events in HLA-peptide multimer staining protocols" pot
... all labs to use their own protocol for thawing, staining, gating, and data analysis Each laboratory performed two parallel assays, one with and one without the inclusion of dump channel markers ... Data generated by individual laboratories were evaluated in ways Initial analysis was performed in a non-censored manner using the numerical data generated and provided by individual laboratories ... pre-testing experiments in his lab CMB was the proficiency panel leader and mainly involved at all stages of the project, including organizational and scientific aspects, data analysis and interpretation...
- 13
- 579
- 0
- how to work out a project plan
- how to go to work to lay out a system of drains
- consequently group 9 which was proposed in the 1990 general accounting plan for internal accounting purposes should now be used for the new accounting entries companies opting to carry out cost accounting may use group 0
- actions to carry out the plan
- choice of a field in which to carry out the experiment
- carry out a preliminary assessment of the external environment
- carry out a swot strengths weaknesses opportunities and threats analysis
- § 721 3 what categories of activities are preapproved as incidental powers necessary or requisite to carry on a credit union s business
- sequential program to carry out a trapezoid rule integration to compute
- mpi program to carry out a trapezoid rule integration in parallel using a simple loop splitting algorithm with cyclic distribution of iterations and a reduction
- openmp program to carry out a trapezoid rule integration in parallel using the same spmd algorithm used in fig 5 5
- pseudocode for a parallelized loop to carry out the population shuffle in the genetic algorithm program gafort this version of the loop uses a separate lock for each chromosome and runs effectively in parallel
- 2 ability to carry out the project in a cost effective manner as evidenced by 1 the qualifications of the pi other key staff subcontractors and consultants if any and the level of adequacy of equipment and facilities 2 the soundness and lev
- involves a loan contract and a source of funds to carry out that contract in order to hedge transaction exposure
- questionnaire used to carry out a census of all the land use units in the village
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25