krishnamurti 1991 the landfall and structure of a tropical cyclone the sensitivity of model predictions to soil moisture parameterizations boundary layer meteorolory 55 345 380
báo cáo khoa học: " Responses of photosynthetic capacity to soil moisture gradient in perennial rhizome grass and perennial bunchgrass" docx
... mean annual precipitation (MAP) at both spatial and temporal scales Regarding the relationship between relative biomass and MAP, they [9] indicated that a unimodal relationship appeared between the ... and water availability on a large spatial scale However, within a wide range of high precipitation (1800-3500 mm year-1) in lowland Panamanian forest, leaf photosynthesis decreases rather than ... photosynthesis, stomatal conductance, and PSII functionality In a larger regional geographic transect, the results of Jiang and Dong [45] indicated that net photosynthetic rate (A) appears to have high...
- 11
- 406
- 0
the meaning and structure of a narrative a systemic functional analysis
... for the syntactic structure of language, it prefers placing the function of language as central (what language does and how language does it) rather than placing the elements of language and their ... made to explore the meaning and structure of Torquay? But I said Turkey! as a text The analysis is based on the framework of Hallidays (1994)An Introduction to Functional Grammar, Halliday and ... Re-examine some of the most important issues related to the experiential aspect of functional grammar Analyze the meaning and structure of a narrative based on the systemic functional analysis...
- 39
- 826
- 2
Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc
... relational was III Senser mental see Existent relational were Actor material descended Actor material landed Actor material put on Goal Actor material opened Goal Actor material climbed 10 Actor material ... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative ... Sayer verbal said 27 Senser mental understand 28 Actor material working 29 Actor materialswitched on 30 Actor material work 31 Sayer verbal said 32 Goal material are stuck 33 Actor material take...
- 18
- 712
- 4
the meaning and structure of an american short story a systemic functional analysis = cấu trúc và ngữ nghĩa của một truyện ngắn mỹ
... VIETNAM NATIONAL UNIVERSITY, HA NOI UNIVERSITY OF LANGUAGES AND INTERNATIONAL STUDIES FACULTY OF POST-GRADUATE STUDIES NGUYỄN THỊ MẾN THE MEANING AND STRUCTURE OF AN AMERICAN SHORT STORY: A SYSTEMIC ... transitivity pattern, the mood pattern, the theme-rheme pattern, the grammatical and lexical cohesion; to a summary of the context of situation of the text in terms of the three contextual parameters: field, ... of Halliday’s (1994) An Introduction to Functional Grammar The analysis of the text will proceed from the topic of the chosen text; clauses and clause complex analysis; the transitivity pattern,...
- 6
- 538
- 4
the meaning and structure of an american short story a systemic functional analysis = cấu trúc và ngữ nghĩa của một truyện ngắn mỹ
... that such adjustments are reasonable and satisfactory 1.3 Methods of the Study The study is undertaken with a view to analyzing the meaning and grammar of a short story The descriptive and analytical ... mental and material processes That is, the meanings they realized are midway between materials on the one hand and mental on the other They are in part about action, but it is action that has to ... in the structure of the CLAUSE AS AN EXCHANGE A clause has meaning as an exchange, a transaction between speaker and listener; the Subject is the warranty of the exchange It is the element the...
- 92
- 790
- 4
a study on the meaning and structure of an english fairy-tale a systemic functional analysis = nghiên cứu về ngữ nghĩa và cấu trúc của một câu truyện cổ tiếng anh theo quan điểm của ngữ pháp chức năng hệ thống
... what part the language is playing, what it is that the participants are expecting the language to for them in that situation: the symbolic organization of the text, the status that it has, and ... with each other all day, 25 and by the time the carriage drove away to the king’s palace, with all the family in it, Cinderella was glad to have some peace But as she sat on her stool by the fire ... typical features of this fairy tale text This fairy tale is often read or told for children and as other fairy tales it often has three parts: the beginning, the main, and the end of the story The...
- 88
- 1,059
- 6
a study on the meaning and structure of a geography text a systemic functional analysis = nghiên cứu về nghĩa và cấu trúc của một văn bản địa lý phân tích trên cơ sở lý thuyết chức năng hệ thống
... many and Halliday and Hasan (1997) name them as additive, adversative, causal and temporal Additive: adds more information to what is already there The study used a small sample only and was strongly ... lexical density and parataxis and high grammatical intricacy 43 PART III: CONCLUSION Recapitulations In this thesis, the meaning and structure of a geography text have already been analyzed based ... entity The „doer‟ of this type of action is called the Actor Any material process has an Actor, even though the actor may not actually be mentioned in the clause In many cases, the action may be...
- 52
- 911
- 0
a study on the meaning and structure of a geography text a systemic functional analysis = nghiên cứu về nghĩa và cấu trúc của một văn bản địa lý phân tích trên cơ sở lý thuyết chức năng hệ thống
... VIET NAM NATIONAL UNIVERSITY, HA NOI UNIVERSITY OF LANGUAGE & INTERNATIONAL STUDIES FACULTY OF POST – GRADUATE STUDIES ***************** DƯƠNG THỊ THẢO A STUDY ON THE MEANING AND STRUCTURE OF A GEOGRAPHY ... 2.3 The Context of the Chosen Text ……………………………………… 16 2.4 Clause and Clause Complex Analysis ………………………………… 17 2.5 The Analysis of the Text in Terms of Transitivity, Mood and Theme 19 2.5.1 The ... ………………………………………………………………… 14 Chapter 2: THE MEANING AND STRUCTURE OF THE TEXT 15 “ACID PRECIPITATION – A HUMAN IMPACT ON THE EARTH SYSTEM” 2.1 Introduction ……………………………………………………………… 15 2.2 The Text …………………………………………………………………...
- 4
- 503
- 0
a systemic funtional perspective on the meaning and structure of the story the selfish giant by oscar wilde = bình diện ngữ pháp chức năng hệ thống về cấu trúc và ngữ nghĩa của truyện ngắn gã khổng lồ ích kỷ
... meaning and structure of the story The selfish Giant” by Oscar Wilde as a text The analysis is based on the framework of Halliday‟s (1994) An introduction to functional grammar, Halliday and ... have unmarked theme and 47 have marked theme The third personal pronouns are used as theme in most unmarked type and in these cases, themes are the main characters of the story, namely the Giant, ... perspectives on the meaning and structure of the story The selfish Giant‟ by Oscar Wilde” as the topic of my thesis, using Halliday‟s functional grammar as the theoretical framework Aims of the study...
- 137
- 1,065
- 4
an investigation into the meaning and structure of a pictorial story - a systemic functional analysis = nghiên cứu cấu trúc và ngữ nghĩa của một truyện tranh phân tích theo quan điểm chức năng
... one of the typical features of a narrative 3.3.3 The Thematic Pattern of the Text Most of the themes in the text are topical theme Of 35 clauses analysed for theme, 28 have unmarked theme and have ... functional and semantic rather than formal and syntactic in orientation It takes the text rather than the sentence as its object, and defines its scope by reference to usage rather than grammaticality ... clauses of the text are personal (animals live and act like human beings) They are the pirate Modi, his mother, his father, the doctor and the crab wizard The finite elements in the narrative portion...
- 44
- 718
- 1
The meaning and structure of the inaugural address by John F. Kennedy in 1961 A systemic functional analysis = Cấu trúc và ngữ nghĩa bài diễn văn nhậm chức của
... Description and analysis are two main methods to analyze the meaning and structure of the speech The former deals with the illustration of the crucial areas of functional grammar and the latter is concerned ... presidential inauguration speeches in American history The main theme of the address is to emphasize optimism and idealism in a time of constant panic and anxiety of American people since the start of ... and low grammatical intricacy 2.4 Clause and clause complex analysis As can be seen from the detailed analysis of the text into clauses and clause complexes provided in Appendix at page IV, the...
- 103
- 563
- 0
A Study on the Meaning and structure of an Default fairy-tale a systemic functional analysis
... functional analysis” for my thesis, using Halliday’s functional grammar as the theoretical framework 1.2 Aims of the study This thesis attempts to study the meaning and the structure of an English fairy ... data from authentic texts The two approaches are clearly different from each other: the former approach refers to grammatical analysis and it is often called formal while the later one is called ... with the description of main areas of functional grammar and analytic method is concerned with the analysis of the text 1.5 Design of the study This thesis is divided into chapters: - Chapter...
- 4
- 441
- 1
The meaning and structure of an american short story a systemic functional analysis
... text: a systemic functional analysis by Ho Thi Mai (2008); The meaning and structure of a fairy tale story: a systemic functional analysis by Pham Thi Thuy and a research on The meaning and Structure ... writers to make any exchange meanings Rather than insisting on a clear distinction between grammatical and ungrammatical forms, the focus is usually on the appropriateness of a form for a particular ... original writing of the thesis was based on the format and methods employed in the previous M .A Theses in the same file supervised by Prof Dr Hoang Van Van such as: The meaning and Structure of a...
- 5
- 661
- 12
Tài liệu Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA pptx
... nucleotides, GAAATTTTAAAGCCGAATAAAACTTG) ends nucleotides before the 3Â-end of the intron The temperature program was 30 cycles of 94 C, 65 C, and 72 C (1 each) Transcription of PCR23S.5DGb and purication ... respectively Plasmid pGEM23S.5 contains a shortened intron (380 bp), 26 bp of the 5Â exon, and 25 bp of the 3Â exon Oligo 104 (45 nucleotides, TAATACGACTC ACTATAGGGATCGAATTCTGGGTTCAAAACGTAA) contains, ... Mn2+, Ca2+, Sr2+, and Ba2+) [14], and even monovalent cations [15], are able to promote the formation of a native, or native-like, structure With divalent and monovalent salts as the only aids to...
- 14
- 480
- 0
Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf
... substrates The data for the PA catalysed hydrolysis of PhAc-Asp and PhAc-Glu [13] and our data for PhAc-pAB, PhAc-mAB and PhAcoAB (Table 2) imply that the COOH group has to be positioned as in NIPAB ... selection of PA active site fragments places NIPAB somewhat closer to ArgB263 than to ArgA145 The distances between the polar CO2– and O(NO) and positively charged guanidinium fragments of ArgA145 and ... around ArgB263 It consists of O atoms of the main chain CO groups of LeuB387 and TrpB240, Od1 atom of AsnB241 and Oc atom of SerB386 and is expected to stabilize the positive charge of ArgB263 The...
- 8
- 438
- 0
Báo cáo khoa học: Common mode of DNA binding to cold shock domains Crystal structure of hexathymidine bound to the domain-swapped form of a major cold shock protein from Bacillus caldolyticus pot
... Although the CSPÆdT6 crystal structures contain an single-strand DNA ligand, they support the assumption that single-strand RNA ligands bind the same way, because the exposed sugar 2¢OH groups and the ... to a hydrogen bond between Arg56 and the O2 of the nucleobase However, after evaluating both crystal structures we conclude that the alternative orientation of the base and sugar–phosphate backbone ... Shielding of Val26, Val28 and Tyr15 also may contribute to ligand binding, because the solvent-exposed location of these side chains in the absence of a ligand is expected to be thermodynamically unfavourable...
- 15
- 333
- 0
Báo cáo hóa học: " Research Article The Methods of Hilbert Spaces and Structure of the Fixed-Point Set of Lipschitzian Mapping" docx
... Dom´nguez-Benavides and P Lorenzo Ram´rez, Structure of the fixed point set and common fixed ı ı points of asymptotically nonexpansive mappings,” Proceedings of the American Mathematical Society, ... pp 345 350, 2007 J Gornicki, “Remarks on the structure of the fixed-point sets of uniformly Lipschitzian mappings in ´ uniformly convex Banach spaces,” Journal of Mathematical Analysis and Applications, ... Theory and Applications R E Bruck, “Asymptotic behavior of nonexpansive mappings,” in Fixed Points and Nonexpansive Mappings, R C Sine, Ed., vol 18 of Contemp Math., pp 1–47, American Mathematical...
- 12
- 393
- 0
Báo cáo y học: "A cross-sectional study of the number and frequency of terms used to refer to knowledge translation in a body of health literature in 2006: a Tower of Babel?" pps
... population up to 60 years of age, the general population over 60 years of age, and the relatives of patients who died after euthanasia or assisted suicide Their article is a KT article and also categorized ... chose to look at only the titles and abstracts of these articles for two reasons First, titles and abstracts are the tools that authors provide and the indexers of bibliographic databases (such as ... substantial amounts of KT material, although the number and proportion varies by journal title and the features of the literature emphasized by the journal Being able to readily and accurately...
- 11
- 598
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25