join each of the sentences in column a with a related sentence in column b 2 5

THE STRUCTURES OF THE SENTENCES IN ENGLISH 9.doc

... explain st to sb/ agree with sb/ be in a hurry/ be helpful in/ be strict with/ be famous for be coved with/ be bored with/ be fed up with/ be tired of/ be necessary for/ be afraid of/ be similar ... at / be amused at/ be delighted at/ be interested in/ take part in/ Take care of = look after be bored with/ be fed up with/ be tired of/ tell sb about st/ get rid of/ give up/ depend on/ be different ... be similar with/ be pleased with/ be angry with/ be in trouble/ be satisfied with/ be surprised at/ be worried about Worry about/ call for/ write to sb/ belong to/ be married to sb/ take over/queue...

– QUESTIONS – Set 32 (Answers begin on page 136.) Each of the questions in this set contains doc

Danh mục: Kỹ năng nói tiếng Anh

... have an of cial language e Canada has two of cial languages 486 Which of the following best expresses the main point of the passage? a Only veterans care about the ﬂag-burning issue b Flag burning ... than the previous number 75 b This is an alternating addition and subtraction series Roman numbers alternate with Arabic numbers In the Roman numeral pattern, each number decreases by In the Arabic ... series, beginning with 16, 10 is added to each number to arrive at the next In the alternating series, beginning with 56 , 12 is added to each number to arrive at the next 53 a This is an alternating...

THE STRUCTURES OF THE SENTENCES IN ENGLISH ppsx

Danh mục: Kỹ năng nói tiếng Anh

... afraid of/ be similar with/ be pleased with/ be angry with/ be in trouble/ be satisfied with/ be surprised at/ be worried about Worry about/ call for/ write to sb/ belong to/ be married to sb/ ... preposition be amazed at / be amused at/ be delighted at/ be interested in/ take part in/ Take care of = look after be bored with/ be fed up with/ be tired of/ tell sb about st/ get rid of/ give ... on/ be different from/ explain st to sb/ agree with sb/ be in a hurry/ be helpful in/ be strict with/ be famous for be coved with/ be bored with/ be fed up with/ be tired of/ be necessary for/ be...

Tài liệu Engineering Mechanics - StaticsChapter 1Problem 1-1 Represent each of the following combinations of units in the correct SI form using an appropriate prefix: (a) m/ms (b) μkm (c) ks/mg (d) km⋅ μN Units Used: μN = 10−6N kmμkm = 109−6Gs = 10 s pptx

Danh mục: Kĩ thuật Viễn thông

... in writing from the publisher Engineering Mechanics - Statics Chapter Problem 2- 27 The beam is to be hoisted using two chains Determine the magnitudes of forces FA and FB acting on each chain ... Problem 2- 18 If the tension in the cable is F1, determine the magnitude and direction of the resultant force acting on the pulley This angle defines the same angle θ of line AB on the tailboard ... - Statics Chapter Given: a1 = 0.631 Mm b1 = 8.60 kg a2 = 35 mm b2 = 48 kg Solution: ( a) a1 b1 ( b) 2 = 8 .5 32 km kg 3 a2 b2 = 1 35. 48 kg ⋅ m 12 © 20 07 R C Hibbeler Published by Pearson Education,...

1,119
1,071
2

Mark the letter a, b, c, or d on your answer sheet to indicate the word that differs from the rest in the position of the main stress in each of the following questions

Danh mục: Báo cáo khoa học

... 40 C B D C B A D D D A C B A B B C B B A C 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 12 C A B A B A D B B A A B A A B A B D C B D Igloos 61 62 63 64 65 66 67 68 69 70 71 72 73 ... discuss? A The architecture of early America Indian buildings B The movement of American Indians across North America C Ceremonies and rituals of American Indians D The way of life of American Indian ... dwelling place of early North America? A Log cabins 10 11 12 13 14 15 16 17 18 19 20 B Adobe houses C Tepees C B B C C A D B C C D D D A D C C B A D 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37...

13
3,561
0

Mark the letter a b c or d on your answer sheet to indicate the word that differs from the rest in the position of the main stress in each of the following questions

Danh mục: Báo cáo khoa học

... because the weather was so bad C The bad weather was the reason that made our excursion to London have been fallen over D Our plans for an excursion have fallen away because the weather was bad ... there in five minutes A comfortable B near C available D convenient Question 30 : The boy has chosen to MBA programme in Australia A the B Þ C an D a Mark the letter A B C or D on your answer ... B heart B primary B appear C focus C first C happen D halfway D early D become 12 Question 71 : A a B in the Question 72 : A various C in a B particular D the C rare D special Question 73 : A...

15
4,212
0

A study of conditional sentences in the novel jane eyre by charlotte bronte and their vietnamese equivalents

Danh mục: Kinh tế - Quản lý

... first, but the order of the clauses is usually not important Thus, these two sentences have basically the same meaning The main clause can be at the end, or at the beginning of the sentence In case ... “Jane Eyre” by Charlotte Bronte The main data are conditional sentences in the novel To support the main data, the research is supported by other data taken from internet and grammar books about ... them into the standard of the levels 3.3 Summary of the chapter The research was qualitative and quantitative research The source of the data was the novel Jane Eyre by Charlotte Bronte The main...

Tài liệu Why Has The Cost of Navy Ships Risen - A Macroscopic Examination of the Trends in U.S. Naval Ship Costs Over the Past Several Decades doc

Danh mục: Khoa học xã hội

... Corresponding SteadyState Fleet Size Under Varying Levels of Fixed Shipbuilding Budgets 50 20 05 20 10 20 15 20 20 20 25 20 30 20 35 20 40 20 45 RAND MG484-1.1 tion rate) ranges from about 180 ships for an $8 billion ... percent (Clark, 20 05) The speciﬁcs for each ship type are shown in Table 1.1 Based on these values, we have calculated a real, annual growth rate (i.e., the annual increase in costs above in ation) ... by the year 20 35 rather than the nearly 29 0 it now has (CBO, 20 05) To better understand the magnitude of ship cost escalation and its implications, the Oﬃce of the Chief of Naval Operations asked...

Tài liệu Why Has the Cost of Fixed-Wing Aircraft Risen - A Macroscopic Examination of the Trends in U.S. Military Aircraft Costs over the Past Several Decades pptx

Danh mục: Khoa học xã hội

... measures of in ation Even the rate of increase for electronic warfare aircraft, with the lowest rate of increase of the types listed above, was above that of other in ation indices The ordering ... lower rates of cost increase, that are not in the HAPCA data Data and Price Trends 13 Table 2. 2 Average Annual Escalation Rate for Unit Procurement and Flyaway Costs for Various Navy Aircraft, ... for each aircraft We base the weighting on the proportion of each material in the ﬁnal weight of a typical airframe.8 We recognize that the materials composition of ﬁxed-wing aircraft has dramatically...

Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization ﬁeld pptx

Danh mục: Báo cáo khoa học

... Pereira-Mouries et al (Eur J Biochem 26 9) Table Glycosaminoglycan analysis and calcium measurements of the water-soluble matrix, the EDTA-soluble matrix and the EDTA-insoluble matrix of Pinctada maxima ... transform infrared spectroscopy (FTIR) and X-ray diﬀraction analyses of mineral and organic matrix during heating of mother of pearl 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 (nacre) ... new matrix protein family related to the nacreous layer formation of Pinctada fucata FEBS Lett 4 62, 22 5 22 9 Mann, S., Webb, J & Williams, R.J.P (1989) Biomineralization: Chemical and Biochemical...

Tài liệu The Agrarian Crusade, A Chronicle of the Farmer in Politics doc

Danh mục: Khoa học xã hội

... president of the state Alliance as its standard bearer, was unable to defeat the Republican candidates for state offices but obtained the balance of power in the legislature In Indiana, Michigan, and ... possibly have been hoped The lessons of the campaign may have been hard, but they had been learned, and, withal, a stinging barb had been thrust into the side of the Republican party, the organization ... organizations as a means of eliminating the one and controlling the other As in the parallel case of the railroads, the farmers' animosity, though it was probably greater than the provocation warranted,...

Tài liệu Count Ulrich of Lindburg A Tale of the Reformation in Germany pptx

Danh mục: Khoa học xã hội

... earnestly labouring among the surrounding peasantry, and the minds of the poor people had been awakened by Albert's sermons with great success; Dame Margaret and Laneta continued wavering; and Father ... Munzer, pastor of Alstadt, in Thuringia; another was John Muller, of Bulgenbach, in the Black Forest, the inhabitants of which he rallied round him, and raised the standard of rebellion Here the insurrection ... retainers, and others to bring in provisions The drawbridge was raised, the gates secured Dame Margaret and Laneta were greatly alarmed Father Nicholas, who had arrived with all the ornaments of...

Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc

Danh mục: Sức khỏe phụ nữ

... 3 .20 0 2, 700 2, 690 2, 600 2, 50 0 2, 350 1,300 900 20 05 Epidural rate (%) 20 93 60 90 55 24 45 70 54 63 65 35 60 22 40 35 40 60 22 20 68 50 10 70 Cesarean OAAI rate (%) 18 12. 92 27 23 .79 12 14 .20 25 ... obstetric anesthesia workload and that a typical epidural takes about half the time of a typical cesarean Accordingly, the OAAI for each hospital was calculated as ((0. 75 * number of epidurals per year) ... epidural labor analgesia and cesarean delivery The OAAI is a formula composite comprising data taken from the annual numbers of epidurals and cesareans in each institution In this study, these data...

A Review of Approaches to Mobility Telemonitoring of the Elderly in Their Living Environment potx

Danh mục: Sức khỏe người cao tuổi

... systems have the advantage of being able to monitor the subject regardless of their location The disadvantage of data logging systems is that the subject’s mobility patterns cannot be analyzed between ... reproduced with permission) FIGURE The VTAMN shirt, an example of a wearable system integrated into clothing (Noury et al., c 20 04 IEEE) Data Forwarding Wearables Data forwarding systems5, 12, 22, 23 , 25 ,46 ,59 ... systems5, 12, 22, 23 , 25 ,46 ,59 are used when the weight of the wearable system is a key factor, as a data storage or a data processing unit can be replaced by a miniature transmitter However data forwarding wearables,...

Inside the Structure of Defined Contribution/401(k) Plan Fees: A Study Assessing the Mechanics of the ‘All-In’ Fee pot

Danh mục: Quỹ đầu tư

... significant explanatory power .27 25 See Michael P Battaglia, David Izrael, David C Hoaglin, and Martin R Frankel, “Tips and Tricks for Raking Survey Data (a. k .a Sample Balancing),” American Association ... percentile was in a plan with an ‘all -in fee of 1.38% (Exhibit 29 ) 1.60% Plan asset size is again a primary driver in explaining the total plan ‘all -in fee as a percentage of assets Plans with higher ... divided by the total plan assets to arrive at the ‘all -in fee as a percentage of plan assets Also, each plan’s total dollar fee amount was divided by total participants in the plan to arrive at the...

Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

Danh mục: Báo cáo khoa học

... GCCACTAGTGGATCTG-3¢ and disSUT2rev 5 -TAT TAATATTCCTATATTTTACATAGGAGGAAATTA CATGCATGAAACCTACAGCTGAAGCTTCGTAC GC-3¢, respectively The plasmid pFL38-RAS2 was constructed by ligating the kb HindIII/EcoRI-RAS2 fragment ... and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢ YEp 351 -SUT2 was constructed to contain SUT2 as the only open reading frame present in the plasmid in order ... 5 -GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5 -AACAATTTCACACACA GGAAACAGCTATGACCATGATTACGCTATAGG GCGAATTGGGTA-3¢, respectively YEp 351 -SUT2 was linearized with...

modeling of the conduction in a wo3 thin film as ozone sensor

Danh mục: Vật lý

... The combined action of the two mixed gases is ﬁnally studied at the end of this article In each case, the interaction between the semiconductor material and the gases is approached by means of ... the electrical properties of the material but the perturbation created by the adsorbate induces surface state Ess in the band gap This surface state acts as a trap for the electrons The second ... located on the conduction band (quasi-total ionization) The grains are 20 nm radius, this size is comparable with the granularity of the layers carried out in the laboratory and moreover the...

Gynecological Malignancies: Epidemiological Characteristics of the Patients in a Tertiary Care Hospital in India doc

Danh mục: Sức khỏe phụ nữ

... 849 -54 Nigam PK, Jain A, Goyal P, Chitra R (20 05) Role of heat stable fraction of alkaline phosphatase as an adjunct to CA 1 25 in monitoring patients of epithelial ovarian carcinoma Indian J Clin ... cervical carcinoma was 52 . 0 years while that for ovarian carcinoma 46.4 years and endometrial carcinoma 56 .0 years A study done in Larkana, Pakistan (Siyal et al., 1999) had reported that the average ... Community Affairs Sankaranarayanan R, Ferlay J (20 06) Worldwide burden of gynaecological cancer: The size of the problem Best Pract Res Clin Obstet Gynaecol, 20 , 20 7 - 25 Sharma R, Maheshwari V, Aftab...

Báo cáo khoa học: A proﬁle of the residues in the second extracellular loop that are critical for ligand recognition of human prostacyclin receptor pdf

Danh mục: Báo cáo khoa học

... that the G 15 9A, Q16 2A and C16 5A mutants lost [3H]iloprost-binding activity (Fig 4) Very little binding activity was observed for each of the three mutants in the assay, even when increasing amounts ... (Fig 2Ab) These data indicated that the expression level of recombinant IP is approximately six-fold higher in HEK293 cells than in COS-7 cells (Fig 2Ab) A similar result was obtained in the western ... towards obtaining reliable data using the microplate-based binding assay The expression efﬁciencies of recombinant IP in HEK293 and COS-7 cells cultured in 24 -well plate were compared With 3.1...

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008

join each of the sentences in column a with a related sentence in column b 2 5 pts