if f ¼ ð 2 2 1 þ and g ¼ ð 2 1 2 þ then f ð 1 þ ¼ 2 ¼ g ð 1 þ but
Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc
... separated from mix stage of C elegans as a template with the following primers: M2-goa1-s, 5¢-CATTATAAGA ACATAGGCGCTACAAGGATGGGTTGTACCATGTC ACAGGAAG-3¢; M2-goa1-PstI-as, 5¢-CCAATGCATTGG TTCTGCAGTTAATACAAGCCGCATCCACGAAGA-3¢ ... antagonizing GqalphaDAG signaling in Caenorhabditis elegans Proc Natl Acad Sci USA 10 3, 11 12 11 17 20 Miller KG, Emerson MD & Rand JB (19 99) Goa and diacylglycerol kinase negatively regulate the Gqa ... multicellular organisms [ 12 ] In the genome of C elegans, 21 Ga have been found [13 ,14 ] Although some Ga appear to be unique in nematodes, orthologs of mammalian Gas, Gaq, Ga 12 and Gai ⁄ o have also...
- 9
- 400
- 0
Tài liệu I MMIGRANT S MALL B USINESS OWNERS: A S IGNIFICANT AND G ROWING PART OF THE E CONOMY pdf
... 2% 1% 2% 1% 2% 3% 2% 1% 2% 1% 1% 0.3% 1% 1% 1% 0.4% 1% 2% 1% 2% 1% 1% 1% 1% 1% 2% 1% 1% 1% 0.3% 1% 0.4% 1% 1% 1% 1% 1% 1% 1% 1% 1% 0.4% 1% 0.4% 1% 1% 1% 0.3% 1% 2% 1% 0.3% 1% 0.3% 1% 1% 1% 1% 1% ... 10 ,9 12 9, 411 4,335 3,087 2, 295 42, 006 16 ,22 7 6,803 329 ,5 62 10 9,8 41 71, 7 01 20 ,24 0 25 , 12 8 21 ,4 12 21, 454 20 ,085 7 ,28 2 9, 615 1, 984 1, 627 9 ,26 6 11 ,24 2 6,586 11 , 0 21 4 ,23 0,749 1, 457 8,043 12 9 11 ,15 0 865,799 ... 22 ,9 61 13,869 10 ,17 8 15 ,495 18 ,8 51 12 , 6 72 2,959 15 ,6 31 24 ,950 2, 933 27 ,883 10 , 613 5, 620 5 ,18 4 2, 255 2, 019 1, 995 12 , 868 7,639 7 ,17 9 26 % 14 % 41% 9% 12 % 14 % 27 % 10 % 12 % 20 % 24 % 24 % 32% 44% 24 % 19 %...
- 37
- 436
- 0
Green Functors and G-sets~ pdf
... 22 3 22 7 23 1 23 4 24 2 25 0 25 5 26 4 26 4 26 4 26 6 27 5 27 5 27 5 27 8 28 2 28 2 28 9 29 1 29 5 12 C e n t r e s 12 . 1 T h e c e n t r e of a G r e e n f u n c t o r 12 . 2 T h e f u ... 11 T h e 11 .1 11 .2 11 .3 11 .4 VII 20 7 20 9 21 5 21 5 21 7 21 7 22 3 simple modules Generalities Classification of t h e ... g e n e r a t o r s 5.5 .1 Finitely generated modules 5.5 .2 Idempotents and progenerators 99 99 10 0 10 3 10 3 10 7 10 9 1 12 11 4 11 4 11 5 Construction of Green functors...
- 342
- 354
- 0
Báo cáo khoa học: Effect of monovalent cations and G-quadruplex structures on the outcome of intramolecular homologous recombination doc
... NaCl 19 559 ⁄ 29 17 360 ⁄ 27 16 26 1 ⁄ 21 p80 .1 20 mM NH4Cl 811 4 ⁄ 23 8555 ⁄ 25 79 62 ⁄ 22 1. 087 1. 116 1 .23 2 1. 145 1. 0 21 1. 116 1. 078 1. 0 72 0.470 0.5 12 0.448 0.476 0. 413 0.380 0.458 0. 417 0 .14 8 0 .15 6 ... ª 20 09 FEBS 29 85 p80 .1 7 10 11 ** * * D M p80 .1 * * C 10 11 12 13 14 15 * * P Barros et al * * * * * B 8 p80 .1 A p73 .1 Effect of cations and G- quartets on recombination 12 13 14 15 16 17 18 19 ... Recombination frequency (%) 0. 414 0. 5 21 0.468 0.468 0.447 0.459 0. 422 0.4 42 0 .28 9 0.305 0 .29 3 0 .29 6 0 .26 5 0 .28 3 0. 322 0 .29 0 0 .11 8 0. 12 1 0.098 0 .1 12 0 .22 2 0 .24 5 0. 314 0 .26 0 26 24 31 0.673 0.595 0.764 0.677...
- 11
- 472
- 0
If You''''re Clueless About Accounting and Finance and Want to Know More pot
... Company's Finances 19 3 Glossary 21 1 Resources 22 1 Index 22 5 < previous page page_v next page > < previous page page _1 next page > Page Chapter One Getting a Clue about Accounting and Finance We ... previous page page_9 next page > < previous page page _10 next page > Page 10 The Cycle of Finance as a Triangle < previous page page _10 next page > page _11 < previous page next page > Page 11 CEO ... page _20 next page > page _ 21 < previous page next page > Page 21 Key Differences: Managerial vs Financial Accounting Managerial Accounting Financial Accounting Does not have to conform to GAAP Conforms...
- 268
- 1,094
- 0
Báo cáo hóa học: " Quantitative expression analysis of HHV-6 cell receptor CD46 on cells of human cord blood, peripheral blood and G-CSF mobilised leukapheresis cells" docx
... 7 ,14 1 (range, 4,975 10 ,730), 2, 19 5 (range, 13 95–4058) and 2, 16 9 (range, 1, 945–3,665) and the number per CD33+ cell was 4, 828 (range, 3,3 32 8455), 2, 760 (range, 1, 12 8 –4,3 92) and 2, 913 (range, 1, 5 52 ... The median number of CD46 molecules per CD34+ cell in CB, LP and CB after MACS separation was 6 ,23 2 (range, 5 , 21 9–7,956), 1, 715 (range, 1, 494 2, 822 ) and 2, 074 (range, 1, 418 –3, 6 21 ), the number per ... detected on CD 22+ B-cells, the median number of molecules per CD 22+ cell in CB, PB and LP was 11 ,650 (range, 10 ,7 02 14 ,15 8), 17 ,490 (range, 13 ,7 72 19 ,997) and 9, 618 (range, 4,339– 10 ,774), respectively...
- 4
- 272
- 0
TRICHOTOMY, STABILITY, AND OSCILLATION OF A FUZZY DIFFERENCE EQUATION G. STEFANIDOU AND G. pdf
... s 1 j =s λ= µ= − C, k ¯ b2 j +2 z + j =0 k s=0 e2s +1 , k s=0 h2s +2 e2 j +1 z 2 j +1+ 2s j =s +1 s 1 a2 j +1 y 2 j+2s − − B, k ¯ e2 j +1 z+ j =0 k ¯ a2 j +1 y + j =0 h2 j +2 y 2 j +1+ 2s j =s +1 h2 j +2 y 2 ... = 1, s = µ h2s +2 e2s +1 2, s = b2s +2 λ ¯ z ¯ y ¯ z ¯ µy s 1 k b2 j +2 z 2 j +2+ 2s − ¯ b2 j +2 z+ j =0 ¯ y ¯ λz 1 s ¯ y ¯ z k s=0 a2s +1 y−2s 1 , k s=0 b2s +2 z−2s ∆= j =s +1 s 1 j =0 e2 j +1 z 2 j+2s ... j +2+ 2s − j =s +1 − B, k ¯ h2 j +2 y + j =0 ¯ h2 j +2 y + s 1 a2 j +1 y 2 j +1+ 2s j =s +1 s 1 k ¯ e2 j +1 z + j =0 k ¯ a2 j +1 y + b2 j +2 z 2 j +1+ 2s − C, j =s +1 k s=0 a2s +1 k s=0 b2s +2 (3.93) Proof Suppose...
- 21
- 273
- 0
ON THE RECURSIVE SEQUENCE E. CAMOUZIS, R. DEVAULT, AND G. PAPASCHINOPOULOS Received 12 January 2004 ppt
... +m < 1, m = 2, 0 (3 .10 ) for all i and S = l1 (3 .11 ) It follows that S,l 1 ∈ [1, ∞), I,l 2 ,l0 ∈ (0 ,1] (3. 12 ) From (3 .1) , we have l 1 + l 2 S + I ≤ l0 + l 2 2I (3 .13 ) 2SI ≤ S + I S= (3 .14 ) and ... and also I = m2 (3 .17 ) Hence, S,m 1 ,m1 ∈ [1, ∞), I,m 2 ,m0 ∈ (0 ,1] (3 .18 ) If m0 < m 2 and m1 > m 1 , then in view of (3 .2) we have I > m0 , which is a contradiction If m0 < m 2 and m1 ≤ m 1 ... m 1 , from (3 .1) we have I= m0 + m 1 m0 + m 1 I + S ≥ ≥ m1 + m 1 2m 1 2S (3 .19 ) If m0 ≥ m 2 , using (3 .1) we have I= m0 + m 1 m0 + m 2 (I + S)2I ≥ S + I + 2IS m 1 + m 2 + m 1 m0 + m 2 (3 .20 )...
- 10
- 155
- 0
BEHAVIOR OF THE POSITIVE SOLUTIONS OF FUZZY MAX-DIFFERENCE EQUATIONS G. STEFANIDOU AND G. pptx
... zm 1 C (A . 21 ) Moreover, if (A1) is true then from (A .13 ), we get that zm /zm 1 = zm ym / ym zm 1 ≤ D/C and so if (A1) or (A2) is satisfied, then from (5 .1) , (5.3), (A .16 ), and (A . 21 ) we take ... = 1 ,2, 3, a ∈ (0 ,1] − E Then from (5 .14 ) and (5 .17 ) there exists an r ∈ {1 ,2, } such that, for a ∈ (0 ,1] − E, A1,l,a A1,r,a A2 r ≤ A0 − A0 2r ≤ K2 A0 − ≤ uwa ,a A1,l,a A1,r,a ≤ A1,l,a A2 (5 .19 ) ... B/zn 1 ,B/zn 2 , ,B/zn−k 1 (4 .27 ) where λ = C/B, from (4 .24 ) we get zn +1 = max λmin zn 1 ,zn 2 , ,zn−k 1 , C C , , yn 1 yn−k (4 .28 ) n = 1 ,2, (4 .29 ) and clearly zn +1 ≥ λmin zn 1 ,zn 2 , ,zn−k 1 ,...
- 20
- 269
- 0
analysis of fwm penalties in dwdm systems base on g.652, g.653, and g.655 optical fiber
... 2 n2 2 Aeff A F (z) (f p ) (f r MATHEMATICAL MODEL n i F A p (z)A q (z)A* (z)exp i p r cA eff q r F z A F ( L) i )L = p + q - r - (fq ) L e( (f r ) i )L i (f F ) f ) (f p f ) (f q f r ) (f q f ... (f q f ) (f r f r ) (f q f r )[ (f p SNR (dB) 10 log10 f ) (f q f )] c2 f0 ) 2D 2 D c dD (4) d Psignal P FWM (5) i For the calculation of the SNR, it is then necessary to identify all the FWM products ... a FWM signal along the length of a monomode fiber is described by [4]-[7]: d A F (z) dz f r f p fq f F fq f p A F ( L) F F 654 International Journal of Electrical and Computer Engineering 4 :10 ...
- 7
- 284
- 0
Báo cáo toán học: "On the function “sandwiched” between α(G) and χ(G) V. Y" ppt
... B (G) } < χ (G) Let V (G) = 2{ 1 ,2, 3,4,5,6} and u − v iff ≤ |(u \ v) ∪ (v \ u)| ≤ for all u, v ∈ V (G) Then [5] − χ (G) = 32 and rank(A (G) ) = 29 where A (G) is the adjacency matrix of G Then χ (G) = 32 ... journal of combinatorics (19 97), #R19 Theorem For all graphs G α (G) = min{ rank(B) |B ∈ B (G) } implies α (G) = χ (G) Proof Let S = {v1 , v2 , , vα (G) } be the stable set of G, S = V (G) \ S and B ... Sankt-Peterburgskogo Universiteta, Ser .1, Issue 2, Vol .15 (19 95), 12 0 – 12 2 N.Alon, P.D.Seymour “A counterexample to the rank-coloring conjecture”, Journal of Graph Theory 13 (19 89), 523 – 525 ...
- 3
- 264
- 0
Báo cáo khoa học: "B6C3F1 mice exposed to ozone with 4-(N-methyl-Nnitrosamino)-1-(3-pyridyl)-1-butanone and/or dibutyl phthalate showed toxicities through alterations of NF-κB, AP-1, Nrf2, and osteopontin" pdf
... family, comprising p45-Nfe2, Nrf1, Nrf2, Nrf3, Bach1, and Bach2 [9] Among the members, p45-Nfe2, Nrf1, and Nrf2 were first cloned during the search for proteins that bind to the NFE2-AP1 motif, ... Technology References Angel P, Karin M The role of Jun, Fos and the AP -1 complex in cell proliferation and transformation Biochem Biophys Acta 19 91, 10 72, 12 9 -15 7 O’Regan AW, Nau GJ, Chupp GL, Berman ... Acad Sci USA, 20 01, 98, 4 611 -4 616 12 Denhardt DT, Guo X Osteopontin: a protein with diverse functions FASEB J 19 93, 7, 14 75 -14 82 13 Dhar A, Young MR, Colburn NH The role of AP -1, NFκB and ROS/NOS...
- 7
- 301
- 0
Báo cáo khoa học: "Molecular analysis of hprt mutation in B6C3F1 mice exposed to ozone alone and combined treatment of 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone and/or dibutyl phthalate for 32 and 52 weeks" ppsx
... (9) (6) ( 12 ) (18 ) ( 21 ) ( 12 ) Insertions (6) (13 ) (10 ) (15 ) (14 ) ( 12 ) (9) Deletions ( 12 ) (8) (10 ) (8) (17 ) (16 ) (15 ) Total Clones 17 (10 0) 24 (10 0) 21 (10 0) 26 (10 0) 35 (10 0) 25 (10 0) 34 (10 0) *unadjusted ... GC to AT TA CG AT to GC CG TA ( 12 ) (0) ( 12 ) (18 ) (0) ( 41) (17 ) (13 ) (25 ) (4) (13 ) (8) (5) (14 ) (0) (14 ) (24 ) (24 ) (4) (27 ) ( 12 ) (19 ) ( 12 ) (4) (6 ) (17 ) (11 ) (9) (9) (17 ) (20 ) (16 ) (24 ) (8) (0) ... (5) (14 ) (18 ) (30) (0) (11 ) (0) (22 ) (17 ) (23 ) (8) (4) (15 ) (19 ) (4) (15 ) ( 12 ) (15 ) (15 ) (8) ( 12 ) (6) (9) (9) ( 21 ) (9) (15 ) Insertions (7) (10 ) (14 ) (17 ) (15 ) ( 12 ) (15 ) Deletions (7) (5) (14 )...
- 7
- 396
- 0
báo cáo khoa học: " Structure, expression differentiation and evolution of duplicated fiber developmental genes in Gossypium barbadense and G. hirsutum" ppsx
... At A 12 FLl, Dt D 12 e FS ;FL At A5 - Dt D5 FFi;FUi;FLj;FEg Pel At A3 FE ManA2 Dt At A13 - Dt D13 FLb ,g, h; FEh; FSd ,g; FFd;FUd At A8 FSh;FEh Dt D8 FFg,j;FSj;FEj At A5 FEh;FLd,i,j;FFd ,g, i,j;FSd CAP ... FEh;FLd, i i, j ;FFd, i j g, i, j ;FSd g Dt At D5 A13 FF ;FU ;FL ;FE - Dt D13 FLb, g; FSg At - - Dt D6 FLd, At - - Dt D7 FSf BG At A13 - POD2 Dt At D13 A3 FEb, j; FFb; FSb, h; FLh Dt D2 FEj At A 12 ... 0.00 61/ 0. 0 21 8/ 0 .27 98 POD2 0. 011 9/0. 0 21 8/ 0.5457 CIPK1 0.0076/0.0308/ 0 .24 60 RacA 0. 011 7/0.0 417 / 0 .28 11 0.0 024 /0. 020 4/ 0 .11 98 0.00 41/ 0. 013 7/ 0 .29 60 0.0075/0.0069/ 1. 08 12 0.0 026 /0. 013 0/ 0 .20 40...
- 15
- 355
- 0
Báo cáo y học: " Cross-talk between cd1d-restricted nkt cells and gδ cells in t regulatory cell response" ppt
... 99 10 0 10 1 1 02 10 3 10 4 10 5 10 6 10 7 10 8 10 9 11 0 11 1 type II NKT cells in regulating tumor immunity: a new immunoregulatory axis J Immunol 20 07, 17 9:5 12 6 - 513 6 Spada FM, Grant EP, Peters PJ, Sugita ... http://www.virologyj.com/content/8 /1/ 32 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 Eckart RE, Scoville SL, Campbell CL, Shry EA, Stajduhar KC, Potter RN, Pearse LA, Virmani R: Sudden death in young adults: a 25 -year ... Immunology 20 09, 12 7 :16 3 -17 0 Odyniec AN, Barral DC, Garg S, Tatituri RV, Besra GS, Brenner MB: Regulation of CD1 antigen-presenting complex stability J Biol Chem 20 10 , 28 5 :11 937 -11 947 Page of 27 Brutkiewicz...
- 9
- 323
- 0
beginning excel what if data analysis tools phần 1 pps
... daughters xiii 59 12 _ FM_final.qxd 10 /27 /05 10 :15 PM Page xiv 59 12 _ FM_final.qxd 10 /27 /05 10 :15 PM Page xv About the Technical Reviewer ■ANDY POPE is a computer programmer living in Essex, England ... support and understanding of his partner Jackie and especially their two children, Hannah and Joshua xv 59 12 _ FM_final.qxd 10 /27 /05 10 :15 PM Page xvi 59 12 _ FM_final.qxd 10 /27 /05 10 :15 PM Page xvii ... 59 12 _ FM_final.qxd 10 /27 /05 10 :15 PM Page i Beginning Excel What -If Data Analysis Tools Getting Started with Goal Seek, Data Tables, Scenarios, and Solver Paul Cornell 59 12 _ FM_final.qxd 10 /27 /05...
- 20
- 191
- 0
Local and remote management of HDSL and g SHDSL circuits
... Reporting Development Guide Optional Allows user to adapt northbound SNMP alarm reporting interface SG-WDSL7.0 SGMEDIA7.0 12 4 26 62 12 4 2 418 SGDOCST7.0 12 4 2387 ETSIDOCSET70 12 4 229 7 SGTMNSEVENT7.0 12 4 2 424 ... 450MHz/higher 2GB RAM 20 GB disk, 2GB swap Web Site: www.adc.com From North America, Call Toll Free: 1- 800-366-38 91 • Outside of North America: +1- 9 52- 938-8080 Fax: +1- 9 52- 917 - 323 7 For a listing of ADC's ... 440MHz/higher 512 MB RAM 2GB disk, 1GB swap Display: 1 024 x768 Small Network Server (10 nodes, with or without Client): Sun Ultra 60, 450MHz/higher 1GB RAM 10 GB disk, 2GB swap Large Network Server (20 0...
- 8
- 331
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25