example of resume curriculum vitae cv for application to a university
A methodology for validation of integrated systems models with an application to coastal-zone management in south-west sulawesi
... blasts, the total capacity of urban wastewater treatment plants, and the total capacity of treatment plants for industrial wastewater. Examples of empirical parameters in RaMCo are the price of shrimps ... river basin management and/or ecosystem-based river basin management (Nakamura, 2003). Embedded in these approaches are the concepts of participatory management and adaptive management (Miser and ... namely, empirical tests and rational tests with and without field data (Fig. 2.1). Rational tests can also be used to validate a model when the data for validation are available only to a limited...
- 139
- 492
- 0
A METHODOLOGY FOR VALIDATION OF INTEGRATED SYSTEMS MODELS WITH AN APPLICATION TO COASTAL-ZONE MANAGEMENT IN SOUTH-WEST SULAWESI " docx
... criterion. A performance criterion defines what aspect of the model we want to examine and what references are used for this examination. For example, a certain performance criterion was drafted as ... integrated approach towards the planning and management of natural resources and environment are considered as promising approaches to achieve the sustainable development of a region, of a country, ... hilly and mountainous area, horticulture such as maize, potatoes and cassava are cultivated. Forest gardens that house the industrial tree such as coffee and cacao can be found. Though agriculture...
- 140
- 219
- 0
Báo cáo khoa học: Modular metabolic control analysis of large responses in branched systems – application to aspartate metabolism potx
... responses inbranched systems – application to aspartate metabolismFernando Ortega1and Luis Acerenza21 Computational Biology, Advanced Science and Technology Laboratory, AstraZeneca, Macclesfield, ... state value), is a tenta-tive range estimated from information available for Arabidopsis mutants. In a mutant of Arabidopsis inwhich inhibition of AK by Lys was abolished, a six-fold increase ... which parameter or combination of param-eters of the module is changed. So, if we want to change a variable, it is necessary to change a parame-ter or set of parameters in a module with a controlcoefficient...
- 14
- 400
- 0
SCHEME OF EXAMINATION & SYLLABI of BBA (TOUR & TRAVEL MANAGEMENT) for First to Sixth Semester (w.e.f. 2005 – 2006 Academic Session) pptx
... Data, Instruction and Information, Characteristics of computers, Various fields of application of computers, Various fields of computer (Hardware, Software, Human ware and Firmware), Advantages ... Joint Stock Company, Cooperative Organization; Types of Companies, Choice of form of organization; Promotion of a company – stages in formation; documentation (MOA, AOA). Unit III No. of Hrs.:-10 ... Getting Familiar with Access Objects: Tables, Queries, Forms, Reports, and Modules. 2. Creating Database: Creating database using wizards, documenting the database, creating own databases. ...
- 103
- 255
- 0
báo cáo hóa học:" Gene Expression and Pathway Analysis of Ovarian Cancer Cells Selected for Resistance to Cisplatin, Paclitaxel, or Doxorubicin" docx
... Overrepresentation analysis was also performed using the Reactome database [15]. Ingenuity Pathway Analysis software (Ingenuity Systems) was used to identify and draw networks relevant to the pathways ... Garcia-Sanz JA: Degradation of cellular mRNA is a general early apoptosis-induced event. FASEB J 2002, 16:2003-2005. 33. Chandra J, Samali A, Orrenius S: Triggering and modulation of apoptosis ... Rembiszewska A, Felisiak A, Ziolkowska-Seta I, Murawska M, Moes J, Timorek A, Dansonka-Mieszkowska A, Kupryjanczyk J: PIK3CA amplification associates with resistance to chemotherapy in ovarian cancer...
- 28
- 384
- 0
Báo cáo hóa học: "Qualitative and quantitative analysis for solutions to a class of Volterra-Fredholm type difference equation" docx
... and their applications. J Comupt Appl Math. 202,339–351 (2007). doi:10.1016/j.cam.2006.02.03612. Pang, PYH, Agarwal, RP: On an integral inequality and discrete analogue. J Math Anal Appl. 194, ... 2011:30http://www.advancesindifferenceequations.com/content/2011/1/30Page 16 of 16 RESEARCH Open AccessQualitative and quantitative analysis for solutions to a class of Volterra-Fredholm type ... difference equations can be considered as the discrete analog of classical Volterra-Fredholm type integral equations, which arise in the theory of parabolic boundary value problems , the mathematical modeling...
- 16
- 323
- 0
Báo cáo khoa học: "Analysis and simulation of the architecture of a growing root system: application to a comparative study of several tree seedlings" ppsx
... Analysis and simulation of the architecture of a growing root system: application to a comparativestudy of several tree seedlingsM. Colin-Belgrand1L. Pages2E. ... the same way, effects of water stress on lateral root initiation andelongation have been reported (Jupp andNewman, 1987). An analogous effect of waterlogging can be observed ... architectural approach to the comparative ecology of plant root systems.New Phytol. 106 (suppl.), 61-77Gerwitz A. & Page R. (1973) An empiricalmathematical model to describe...
- 6
- 362
- 0
The chart below shows the sleep patterns of people in five different occupations according to a Canadian study
... wake at 6 a. m., but nap for two hours or so in the early afternoon. Thus the influence on one's sleep pattern is worthy of consideration when choosing an occupation. ...
- 2
- 1,418
- 3
Báo cáo khoa học: Overexpression of human histone methylase MLL1 upon exposure to a food contaminant mycotoxin, deoxynivalenol docx
... CGATTTTCTGGGACTCGRbbp5 GCATCCATTTCCAGTGGAGT TGGTGACATCCACTTCCTCAAsh2 CCTGAAGCAGACTCCCCATA AGCCCATGTCACTCATAGGGHoxA7 TTCCACTTCAACCGCTACCT TTCATACATCGTCCTCCTCGTSp1 TCATACCAGGTGCAAACCAA GCTGGGAGTCAAGGTAGCTGMLL1 ... experiments.Primers Forward primer (5Â -to3 Â ) Reverse primer (5Â -to3 Â)b-actin AGAGCTACGAGCTGCCTGAC GTACTTGCGCTCAGGAGGAGMLL1 GAGGACCCCGGATTAAACAT GGAGCAAGAGGTTCAGCATCSet1 CTGACGAGATGGTCATCGAA CGATTTTCTGGGACTCGRbbp5 ... (R1) CAGAGCTGGTTAGGCAGGTT CCCCGTGAAGTGAAGCAGMLL1 (R2) TCGGGCTAACCCATCTTGTA GGGAGAGCAGCTTCCAGTATSp1 antisense CTGAATATTAGGCATCACTCCAGG a aPhosphorothioate antisense oligonucleotide.K. I. Ansari...
- 9
- 359
- 0
An analysis of key changes under ucp 600 compared to ucp 500 and recommendations for better ucp 600 application.doc
... undertaking and pay at maturity if the credit is available by deferred payment”; or to accept a Bill of exchange (draft) drawn by the Beneficiary and paying at maturity if the credit is available ... credit. Each type of credit has advantages and disadvantages for the buyer Step 7. When all the parties agree to the amendment, they are incorporated into the terms of the L/C and advised to the ... choose to take advantage of the full five-day period.2.2.5. Changes in addresses of of beneficiaries and applicantsThe UCP 600 under Article 14(j) states when addresses of beneficiaries and applicants...
- 89
- 965
- 2
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008