... state may bemaintained mainly by key amino acids. In this study, two point-mutatedproteins each with a single base substitution [alanine for tryptophan(W14 0A) and alanine for lysine (K13 3A) ] and ... tryptophan at position140 plays an important rolein maintaining protein ter-tiary integrity. Figure 4A shows how tryptophan (loop 1) may interact with loop 2 and loop 3. These inter-actions ... Hueih-Min Chen11 Institute of BioAgricultural Sciences, Academia Sinica, Taipei, Taiwan, ROC2 Institute of Physics, Academia Sinica, Taipei, Taiwan, ROC3 Department of Biochemistry, University of...
... 2002Exploring theroleofa glycine cluster in cold adaptation of an alkaline phosphataseKonstantinos Mavromatis1,*, Iason Tsigos2,*, Maria Tzanodaskalaki2, Michael Kokkinidis1,3and Vassilis ... the aromatic ring of Tyr269, and theseunfavorable interactions could lead to a decrease of localflexibility and an increased E a value. The validity ofthe above interpretation was furtherreinforced ... exhibits an E a almost the same as inthe caseofthenativeenzyme(Table1).Thermal inactivation of mutant and wild-type enzymes In order to investigate the effects of mutations on the stability of psychrophilic...
... semantic The Roleof Lexico-Semantic Feedbackin Open-Domain TextualQuestion-AnsweringSanda Harabagiu, Dan MoldovanMarius Pas¸ca, Rada Mihalcea, Mihai Surdeanu,R˘azvan Bunescu, Roxana Gˆırju, ... lists the quantitative analysis ofthefeedback loops. Loop 1 was generated more often than any other loop. However, the small overall average number of feedback loops that have been carried out in- dicate ... if (a) a vol-cano IS -A mountain; (b) lava IS-PART of vol-cano, and moreover it is a part coming from the inside; and (c) fragments of lava have all the prop-erties of lava, the following question...
... aninternational transaction. Unless parties are assured that the coverage is available in the amount designated, the failure ofa party to obtain insurance coverage shouldnot be grounds for termination of ... is a certain moment of time wherein the ownership ofthe goods by the seller ceases and passes to the others and that of the buyer begins; that is called the transfer of title. Ina certain aspect, ... between the involved parties. It can be seen as an obvious offer ofthe Seller to the Company in case of any goods damage arising out ofthe Company’s obligations such as damageduring shipment, damage...
... consumed in place of saturated fattyacids. It is possible to increase the content of vitamin E, a natural antioxidant,and to insert the capability of producing plant-based omega-3 fatty acidsinto ... can be used to elevate levels of vitamins A, C,and D and folate; increase antioxidants; and enhance iron bioavailability in vegetables, fruits, and grains. It is also possible to increase the ... thousands of years since the domestication of plants and animals began. Classicalbreeding and selection, as well as techniques such as radiation breeding,embryo rescue, and transposon mutagenesis,...
... mitochon-drial respiratory chain, the assistance of specificchaperone proteins is also required. The available dataindicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature ... were of analytical grade.Yeast strains and growth media The genotypes and sources ofthe S. cerevisiae strains aredescribed in Table 2. The ISP deletion strain wasprepared in accordance with the ... seen inthe molecular mass ofthe bc1complex in these two deletion strains, thus leading to the hypothesisthat the addition of ISP may play a pivotal rolein the structural rearrangement of the...
... [6,8,27] or toany other sequences available in FASTA and BLASTdatabase programs at the DNA Data Bank of Jap an.Recently, we reported the cloning and s equencing of the gene encoding 4-amino-3-hydroxybenzoate ... and2-aminomuconic acid inthe modified meta-cleavage path-way (Fig. 1B). The 2-aminomuconate deaminase from s trainAP-3 and that from strain JS45 have been purified andcharacterized in detail [5,6]. The nucleotide ... not have anabsorbance peak at 300 nm [5]. A cofactor is not requiredfor t he enzyme activity. In contrast, the deaminase fromstrain 10d contained an FAD-like cofactor, similar toD-amino acid...
... best candidate for t he binding of the a- carboxylate group ofthe s ubstrate, when the external aldimine is formed. The anchoring of a- carboxylateand a- amino group inthe external aldimine definesautomatically ... definesautomatically the positions ofthe a- proton and the sidechain of any bound amino ac id. The lability ofthe a- protonobserved for a large number of amino acids [5] under the action of TPL ... groups of amino acid inhibitors mentioned above. The interaction of L-phenylalanine,L-methionine, andtheir a- deuterated analogs with TPL in D2O was charac-terized by the appearance of quinonoid...
... of labor, cheaper costs of transport to market, or other natural advantages. Ifanother region is able to capture the firm away from its optimal locationby offering lucrative financial incentives, ... dilute the risk of any one project ina diversified portfolio. There are several other advantages to innovation at large firmsbeyond financing and managing R&D. Large firms tend to have estab-lished ... SECOND QUARTER 2007 87IV. SMALL BUSINESS AND INNOVATIONJoseph Schumpeter, the renowned analyst and advocate of capital-ism, asserted that the hallmark of capitalism is innovation: The sweeping...
... obtained indicated that the clus-ter plays a crucial roleinthe stabilization ofthe quaternary, native assem-bly ofthe enzyme, although it is not located at the subunit interface. The analysis ... [6]. The central feature of the N-terminal, larger domain is a seven-stranded b-sheet. In some instances, the N-terminal tail does not partici-pate as a part ofthe large domain but comprises a separate ... (for a fraction ‡ 90%), the apo-L8 5A isapproximately 75% dimeric, whereas the apo-L27 6A and the apo-L8 5A ⁄ L8 5A mutants are inthe mono-meric state. The association state ofthe holoenzymescan...
... comparisons statistical analysis was performedusing one-way analysis of variance (ANOVA) followed by a Newman–Keuls post-test. Data analysis was performedusingGRAPHPAD PRISMsoftware and ... Kono-Sugita, E., Sekihara, H.,Aizawa, S., Cushman, S.W., Akanuma, Y., Yazaki, Y. &Kadowaki, T. (1997) Roleof insulin receptor substrate-1 and pp60 in the regulation of insulin-induced glucose ... establish the importance of GSK3 in the acute regulation of glucose transport in terms of itsregulatory control of GS in muscle and fat cells we haveinvestigated the effects of Li and the anilinomaleimide,...
... head nods, hand-armAyano Sueyoshi and Debra M. Hardison, Department of Linguistics andGermanic, Slavic, Asian and African Languages.Ayano Sueyoshi is now affiliated with Okinawa International ... communicationbetween Japanese and Americans—Focusing on the use ofthe eyes.Japan Association of Language Teachers Journal, 8, 109–118.Kagawa, H. (2001). Ambiguous Japanese. Tokyo: Koudansha InternationalPublisher.Kellerman, ... (1981)examined the interaction of available visual cues ina story-retelling task with native speakers of English. A story was toldto participants in four conditions, all with audio but varying in visual...
... feature of savings banks across the world is the fact that they maintain large branch networks, often in areas that commercial banks no longer serve. In many countries, savings banks are the ... organisations that have sprung out of the savings banks movement, have done a Bringing the Hidden Giants to the Footlight: theRoleof Savings and Retail Banks in Increasing the Level of ... essential to collect the often small amounts of savings, and maintain them at the disposal ofthe client on a permanent basis. It requires skilled staff, good treasury management and adequate...
... Action]AFP Australian Federal PoliceAG Attorney-GeneralAIC Australian intelligence communityANAO Australian National Audit OfficeAQMI Al-Qaida pour le Maghreb Islamique [al Qaeda for the Islamic ... Islamic Maghreb]ASALA Armenian Secret Army for the Liberation of ArmeniaASIO Australian Security Intelligence OrganisationASIS Australian Secret Intelligence ServiceAUSTRAC Australian Transaction ... and Canada, ASIO derives much of this information from human sources. A certain amount of data emanates from well-placed informants and individuals who submit plea bargains during trials for...
... According to the sequenceobtained, the b-subunit contains 535 amino acids with a calculated average molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated averagemolecular ... ofthe xdhA gene(ggcaggaattgaatgcag) or the known 3¢ end ofthe xdhB gene(gcccagtacctacaagattc). Localization of xdhAB genes on the C. acidovorans plasmid was established using the AlkPhosDirect ... using stepdown PCR [27] mediated by the forward primerxb101+ (5¢-gccgcccatatgcaccaccaccaccaccacagcaccagtcagaactct), the reverse primer xa100– (5¢-gtggtgaattcagccagtgtgcccttg), and pNIall2 as...