... to Bob. In a similar manner, theInternet has anAPI that the program sending data must follow to have theInternet deliver the data to the program that will receive the data. The postal service, ... picture frames that download and display digital pictures, washing machines, refrigerators, and even a toasterthat downloads meteorological information and burns an image of the day’s fore-cast (e.g., ... upstream rates are different, the access issaid to be asymmetric. The actual downstream and upstream transmission ratesachieved may be less than the rates noted above, as the DSL provider may purpose-fully...
... SSL and TCP/IP Application TCP IP Normal Application Application SSL TCP IP Application with SSL • SSL provides application programming interface (API) to applications • C and Java ... Java SSL libraries/classes readily available 80 Real SSL: Handshake (1) Purpose 1. Server authentication 2. Negotiation: agree on crypto algorithms 3. Establish keys 4. Client authentication ... information digital signature (encrypt) CA private key K CA - K B + certificate for Bob’s public key, signed by CA There are bad guys (and girls) out there! Q: What can a “bad guy”...
... learners can model their own work in this area of academic writing. The Internet The Internet has made many opportunities available to both learners and educators that were not feasible in the ... features of academic essays (topic sentences, paragraphs, conclusions), but rather the differences, namely connectors and organization, which set compare/contrast essays apart from other academic ... a few. And, at our very fingertips are assorted, authenticmaterials whose access are not limited to either temporal or spatial constraints, for the Internet is easily accessed 24 hours a day...
... CCCCATGTCGCCTTTAGTOMCB-KO-R TCGCTAGAACACATTGACOMCA-F ATGATGAAACGGTTCAATOMCA-R TTAGTTACCGTGTGCTTCOMCB-F CTGCTGCTCGCAGCAAGTOMCB-R GTGTGATCTGCAACTGTTOMCA-PBAD-F CACCGAGGAATAATAAATGATGAAACGGTTCAATTTCOMCA-PBAD-R ... CACCGAGGAATAATAAATGATGAAACGGTTCAATTTCOMCA-PBAD-R TTAGTTACCGTGTGCTTCOMCB-PBAD-F CACCGAGGAATAATAAATGATGAACGCACAAAAATCAOMCB-PBAD-R TTACATTTTCACTTTAGTShewanella oneidensis MR-1 OmcA and OmcB kinetics J. Borloo et al.3736 ... used as a positive control to display omcA(lane 1) and omcB (lane 6). DNA standards are indicated at the leftand right of the agarose gels. (B) Visualization and separation ofhigh molecular mass...
... of the morphological and syntactic parsers on a more complicated example: Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) ... Vowel-Harmony The first rule indicates that a word consists of an optional prefix followed by a Vowel- Harmony-Domain; the second claims that a Vowel-Harmony-Domain is a string analyzable as a ... namely prosody and the non- isomorphism of syntactic and phonological structure. We maintain that these are are central to the task of a morphological analyzer and, hence, have incorporated...
... Tirana, Albania; e-mail: kadareja@yahoo.comWorking PaPer SerieSno 1150 / January 2010Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro areaby ... motif taken from the €500 banknote.DO BANK LOANS AND CREDIT STANDARDS HAVE AN EFFECT ON OUTPUT? A PANEL APPROACH FOR THE EURO AREA 1by Lorenzo Cappiello 2, Arjan Kadareja 3, Christoffer ... intermediation through the impact it mayhave on the pricing, management and perception of risk by …nancial intermediaries.6All in all, the fact that monetary policy can a ect the balance sheets...
... was a good idea. That watershed event caused a ripple effect. With others finally interested in Etext, a "Mass Marketing Approach, " and such it was, was finally appropriate, and the ... other Shakespeare professors believe that the way a person should act to be a great Shakespeare professor is to teach as many people as possible about Shakespeare in as complete a manner as ... knowledge in the hands of the few and away from the minds of the many. I predict that in the not-too-distant-future that all materials will either be circulating on the Internet, or that they will...
... Italian), pastarant (pasta + restaurant)and peatza (pizza + eat). These three suggestions areamusing and have a nice ring to them. As a matterof fact, it turns out that the name Eatalian is actuallyused ... eating), pizza and pasta(which are found AtLocation restaurant) to generatean appropriate name. The three “palatable” neolo-gisms generated are eatalian (from the combinationof eat and Italian), ... moderneatalian italian, eat dusta pasta, dustpastarant restaurant, pasta hometess hostess, homepeatza pizza, eatshampoosmooth bright soft volumizinghydrating qualityfragrinse fragrance,...
... Ideally, we would like to lookat TroFi as a first step towards an unsupervised,scalable, widely applicable approach to nonliterallanguage processing that works on real-world datafrom any domain ... for each target word. It also provides the feedback set sizes for each target word. The to-tals across all words are given at the bottom of the table.absorb assault di e drag drownLit Target ... for av-erage recall. For overall performance, we take the f-score of average precision and average recall.We calculated two baselines for each word. T hefirst was a simple majority-rules baseline....
... of the parents in Bulgaria (7%) and Lithuania (8%), and one-tenth of the parents in Greece and Latvia (both 11%) answered that their child was not allowed to download or play music, films and ... authorities929088888778787775757473727070676665646363615857565151490255075100PTMTIEELCYUKESSIPLLTSEBEFRFIEU27LUROHUBGITDEEENLSKLVATCZDK The previous charts showed that in almost all Member States – similar to the results obtained for the EU27 overall – a large majority of the parents each time agreed that the measure ... Germany, France and Sweden, parents were more likely to have rules against downloading and playing music, films and games than against visiting certain websites (and, for Sweden, against the...
... traditional ASR applications (e.g. dictation, database access), but also embraces multilingual speech input, medical (speech therapy) and teaching (computer- assisted language learning) applications. ... (non-spontaneous voicing) and N (nasality), and the resonance elements A (low), I (palatal), U (labial) and R (coronal). These elements are phonologically active - they can spread to neighbouring ... has been detected in both the initial fricative and the final plosive at Stage 2. Again, it may be possible to identify a unique word candidate at the end of Stage 2, but if several candidates...
... Generally, we have tried tomake chapters run from easy material at the start to more arcane matters at the end. Each chapter has brief notes at the end, containing historical material andassorted ... by the focal lengthalone but also depends on the effective area of the retina (e.g., the area of film thatcan be exposed in a photographic camera, or the area of the sensor in a digitalcamera; ... 191.2.5 Weak-PerspectiveProjectionMatrices 201.3 GeometricCameraCalibration 221.3.1 A Linear Approach to Camera Calibration . . . . . . . . . . . 231.3.2 A Nonlinear Approach to Camera Calibration...
... use of sacrificial imagery ‘implies a replacement of ritual sacrifice and indicates an assumption that the death of Jesus hadbeen a final sacrifice to end all sacrifices’ (Romans 9 16 (Dallas, Tex.: ... recalls what Paul hassaid about baptism as participating in the death and resurrection ofChrist (Rom. 6: 1–14). In particular, talk of a ‘living sacrifice’ echoes the earlier call to be ‘dead ... bringing about a new covenant (2, 5, and 6)? What does the language of sacrifice mean and how can it be justified andmaintained (4)? What more did New Testament Christians andtheir successors maintain,...