c responsibilities of the audit committee in relation to the internal audit function
Consultative document The internal audit function in banks pptx
... governance of the bank including the functioning of the audit committee 90 The audit committee and board of directors should not conclude that the internal audit function is functioning well ... experience of each internal auditor and of internal auditors collectively, is essential to the effectiveness of the bank’s internal audit function Principle 4: Internal auditors should act with integrity ... out in section A of this guidance This includes: The basic features of the internal audit function; The existence and content of the internal audit charter; The scope of the internal audit...
- 27
- 460
- 0
The internal audit function in banks docx
... bank including the functioning of the audit committee 91 The audit committee and board of directors should not conclude that the internal audit function is functioning well solely because the supervisory ... Professional competence, including the knowledge and experience of each internal auditor and of internal auditors collectively, is essential to the effectiveness of the bank’s internal audit function ... within the internal audit function In addition, a bank may rotate staff from other functional areas of the bank to the internal audit function or from the internal audit function to other functional...
- 29
- 539
- 0
Báo cáo " Characteristics of Quaternary sedimentary facies in relation to water bearing capacity of aquifers and aquicludes in the Red River Delta, Vietnam " ppt
... silty clay of lagoonal facies in the central part passing into silty clay of flood plain, oxbow, coastal swamp and peat facies in the direction from the plain to the modern coastline. ... alluvial and proluvial facies (formed in the first stage of each cycle), while the aquicludes are fine sediments of deltaic, coastal swamp and marine facies (formed in the final stage of each cycle). ... coastline. The fourth sequence consists of swamp clay, lagoonal clay and peat. In the direction towards the center of the plain, each of these sequences appears more and more particular facies ...
- 7
- 671
- 0
Báo cáo y học: "Variety of transversus thoracis muscle in relation to the internal thoracic artery: an autopsy study of 120 subjects" docx
... was gathered in the course of fresh cadaver autopsies carried out in the Department of Forensic Medicine at the Medical University of Sofia, Bulgaria The medico-legal office and local Ethic Committee ... D.Sc (Department of Anatomy, 1st Faculty of Medicine, Charles University in Prague, Czech Republic) for locating the work of Loth (1931) The kind help of Dr Tsvetomir Badov in proofreading of the ... reaches the level of third rib and intercostal space Conclusions The data from the present study adds some basic information concerning the surgical anatomy of the anterior thoracic wall It describes...
- 6
- 491
- 0
Báo cáo y học: " In vivo imaging of the airway wall in asthma: fibered confocal fluorescence microscopy in relation to histology and lung function" potx
... Next, the Alveoflex miniprobe of the FCFM system (Cellvizio, Mauna Kea Technologies, France [20]) was inserted through the working channel of the bronchoscope and placed on the main carina of the ... recording of FCFM images and collection of endobronchial biopsy specimens Asthmatic subjects had controlled disease according to GINA guidelines [1] Furthermore, they met all of the following criteria: ... histology and FCFM Second, FCFM images during bronchoscopy were captured by placing the miniprobe perpendicularly to the surface of the airway main carina followed by a biopsy from the same location...
- 9
- 406
- 0
LEGENDS OF BABYLON AND EGYPT IN RELATION TO HEBREW TRADITION doc
... played in moulding the civilization of the smaller nations with whom they came in contact To such influence the races of Syria were, by geographical position, peculiarly subject The country has often ... that an account of the origin of divination is included in his description of the descendents of Noah by the writer of the Biblical Antiquities of Philo, a product of the same school as the Fourth ... this correspondence may be seen in the fact that the new Sumerian Version of the Deluge Story, which I propose to discuss in the second lecture, gives us a connected account of the world's history...
- 181
- 297
- 0
báo cáo hóa học: " Incidence of Raynaud''''s phenomenon in relation to hand-arm vibration exposure among male workers at an engineering plant a cohort study" doc
... machinery The date of enumeration of the source population was 31st of December 1986 according to the plants payroll roster There was staggered recruitment into the study, the baseline being ... analysis of exposureresponse in the same cohort The objective of the present study was to assess the incidence of Raynaud's phenomenon in relation to hand-arm vibration exposure in a cohort consisting ... designs [6-8] The longitudinal studies have mostly been retrospective asking the worker whether finger blanching occurs and the date of the first occurrence [7,8] The repeated cross-sectional studies...
- 6
- 340
- 0
Báo cáo y học: "Assessment of sperm quality traits in relation to fertility in boar semen" ppt
... samples Percentage of viable spermatozoa was calculated based on the ratio of fluorescence output of intact and of killed subsamples, corrected in relation to background fluorescence (blank) ... the fluorescence intensity of the sperm nuclei in artificially membrane-ruptured spermatozoa In contrast, membrane-permeant H342 was used to measure fluorescence intensities of intact spermatozoa ... fluorescent cytological analyses of DNA [9,10] Many techniques employing above-mentioned and plethora of other fluorescent dyes are to be combined with microscopic or flow cytometric assessment techniques...
- 6
- 431
- 0
Tài liệu Rubber plantation performance in the Northeast and East of Thailand in relation to environmental conditions docx
... ha, of which 45 420 (2.3 %) were in the Northeast and North of Thailand The eastern provinces including Chachoengsao accounted for 12.3 % of the plantation area (RRIT 1996 cited in RFD 2000) According ... America The commercial and large-scale exploitation of the tree did not begin until in the last quarter of the 19th century With the arrival of cars, discovery of the pneumatic tyre and following ... importantly the branching pattern, is a critical characteristic Breeding of more suitable clones could lead to better rubber wood productivity and increased income in the long term, but meanwhile clonal...
- 70
- 815
- 0
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx
... 5¢-ATAAGCTTGCTTT AAAATCCACCCCACG-3¢ and 5¢-TCGGATCCC AGTGCCCACTTATTCGAAAAG-3¢ HindIII–BamHI digested PCR product was cloned into the pBlueScript SKvector and then recloned by KpnI–BamHI into the pTZ19R ... PCRamplified from the DNA of the cosmid clone #9 [18] using the following pair of primers: 5¢-GACTGCAGTGAAGG GCATCGAGTCCTCGGG-3¢ and 5¢-GAGGATCCGG GACATTCCTTAGCCAGGAGGG-3¢ To make the b-galactosidase ... 5¢-CAGGATCCCTATGAGCAGC TCCGAGGAAGTCTCCT-3¢ and 5¢-CTGTCGACTTA GTTTTTCGCTCGTAGTGGCATTTTAAAATTGGCT GC-3¢ BamHI–SalI digested PCR fragment was cloned into BamHI–SalI digested pAS2-1 vector, or into...
- 10
- 464
- 0
Báo cáo khoa học: Nucleosome positioning in relation to nucleosome spacing and DNA sequence-specific binding of a protein doc
... salt concentrations, denoting an increase in the linking number of the DNA As chloroquin introduces positive supercoils into the DNA, this shift confirms that with increasing salt concentration, there ... Pusarla et al chromatin-modifying mechanisms Thus, cells use nucleosome positioning as a mechanism to include or exclude the binding sites of trans-acting factors from accessible chromatin regions ... in uenced by the ionic strength of the medium in vitro [16,17] Folding of the chromatin into higher-order structures involves interparticle interactions of the nucleosome cores Several charge-neutralizing...
- 15
- 299
- 0
Báo cáo khoa học: "A CONSIDERATION ON THE CONCEPTS STRUCTURE AND LANGUAGE IN RELATION TO SELECTIONS OF TRANSLATION EQUIVALENTS OF VERBS IN MACHINE TRANSLATION SYSTEMS" doc
... through case relation to each translation equivalent verb thus obtained by consulting word usage dictionary Then check all the nouns belonging to nearby categories in the given concepts structure ... can generally be said that the more the noun's relation to human becomes closer and the more the level of abstract of the noun becomes lower the numbers of verbs that are closely related to them ... of the structure of the categories as in Fig.l, and then find appropriate translation equivalents in detail at the lower level categories (2) To each verb found in the process of the association,...
- 3
- 394
- 0
báo cáo hóa học: " The assessment of health-related quality of life in relation to the body mass index value in the urban population of Belgrade" potx
... adequate intervention [15,16] Accordingly, evaluation of the quality of life has become a focus of interest not only in population studies, but also in clinical medicine [17], particularly in patients ... subjective perception of physical and mental health [21] Subjects We carried out a cross-sectional analysis of the quality of life in the urban population of central Belgrade which, according to ... significant difference in smoking habits Table presents values of the odds ratio of the quality of life scores in relation to nourishment status in men Physical functioning was considerably lower in...
- 10
- 535
- 0
báo cáo hóa học: " Self-reported work ability of Norwegian women in relation to physical and mental health, and to the work environment" ppt
... statistical analysis of the data, IS collected the data, BL contributed to the concept and interpretation of the data, DB contributed to the concept, design, statistical analysis and interpretation of ... status was dichotomized according to whether the woman was married/cohabitating or not Place of residence variable was categorized according to urban (Oslo), rural (Lofoten), or other (moved elsewhere) ... (WA) were missing for 12 cases (2,01%) problems However, all data collection was conducted in the presence of a trained investigator, which may have assisted in overcoming shortcomings The question...
- 9
- 428
- 0
báo cáo hóa học:"The role of disclosure in relation to assent to participate in HIV-related research among HIV-infected youth: a formative study" docx
... treatment in Kinshasa, the Democratic Republic of the Congo (DRC), the first of its kind in the country The aim of this operational research was to develop a context-appropriate model of comprehensive ... will stop participating In contrast, three health professionals felt that children should be told at the beginning of the research Their reasons focused on reducing the children being taken aback ... included as a part of the assent process prior to research participation, a component of research participation, or not incorporated in any aspect of the child's involvement in the research We also explored...
- 10
- 372
- 0
báo cáo hóa học:" Prevalence of visual impairment in relation to the number of ophthalmologists in a given area: a nationwide approach" ppt
... France and the United Kingdom Some econometric surveys confirm the existence of 'physician-induced demand' in the French system of ambulatory care, which causes healthcare expenditure to increase ... allocated appropriately (medical and non-medical), especially when increasing life expectancy is predicted to continue [8] The use of registers to estimate the prevalence of blindness is controversial, ... eye-care activities, such as number of visits/inhabitant, glaucoma diagnosis campaign, etc Inequality of quality of care could also be a factor explaining the prevalence rate differences across the...
- 8
- 445
- 0
báo cáo hóa học:" General anxiety, depression, and physical health in relation to symptoms of heart-focused anxietya cross sectional study among patients living with the risk of serious arrhythmias and sudden cardiac death" doc
... and the editing of the article BR contributed to shaping of the article and the editing of the article GEE contributed to the statistical analyses and the editing of the manuscripts KN participated ... from each other in some characteristics; however in the genetic counseling setting it is interesting to analyze them together since they are very similar with regard to the risk they are living ... predictor, and an outcome in the units of measurement of the predictor It is the change in the outcome associated with a unit change in the predictor, whereas the standardized regression coefficient...
- 10
- 453
- 0
báo cáo hóa học:" The assessment of health-related quality of life in relation to the body mass index value in the urban population of Belgrade" docx
... adequate intervention [15,16] Accordingly, evaluation of the quality of life has become a focus of interest not only in population studies, but also in clinical medicine [17], particularly in patients ... subjective perception of physical and mental health [21] Subjects We carried out a cross-sectional analysis of the quality of life in the urban population of central Belgrade which, according to ... significant difference in smoking habits Table presents values of the odds ratio of the quality of life scores in relation to nourishment status in men Physical functioning was considerably lower in...
- 10
- 416
- 0
Báo cáo lâm nghiệp: "The effect of different stand density on diameter growth response in Scots pine stands in relation to climate situations" potx
... thinning The intensity of thinning was set to account for 15–10% of the basal area during the first half of the rotation period (up to the age of 50 years) and for 10–6% of the basal area in the ... relation to thinning Variability of growth response was determined by the variance of correlation coefficients for variables detected using PCA during the previous steps The effect of thinning on the ... response of diameter increment, carried out in six long-term experimental series with thinning located in the Czech Republic, we conclude: The investigation confirmed the significant negative effect of...
- 13
- 318
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose