alizarin red staining of calcium deposited by cells from the a pemf exposed group and b control group without pemf stimulation
Effects of combined mechanical and pulsed electromagnetic field stimulations on the osteogenesis of bone marrow stem cells
... from < /b> samples in the < /b> PEMF < /b> exposed < /b> group < /b> and < /b> control group < /b> without PEMF < /b> stimulation (#p < 0.05) 75 Figure 3.16: Alizarin < /b> red < /b> staining < /b> of < /b> calcium < /b> deposited < /b> by < /b> cells < /b> from < /b> the < /b> (A)< /b> PEMF < /b> exposed < /b> group < /b> ... long bones and < /b> interstitial spaces of < /b> cancellous bones The < /b> metabolic functions of < /b> bone are storage of < /b> minerals, growth factor and < /b> fat, acid-base balance, detoxification and < /b> as an endocrine organ ... esters e.g PLGA The < /b> advantages and < /b> possible drawbacks of < /b> each material will be described 20 2.3.3.1 Bioceramics Bioceramics are inorganic and < /b> non-metallic materials that can assume a < /b> crystalline structure...
- 209
- 1,817
- 0
Performance analysis of wind turbine systems under different parameters effect
... the < /b> batteries level can be monitored by < /b> using measure and < /b> display blocks from < /b> MATLAB, the < /b> size and < /b> state of < /b> battery charge (SOC), the < /b> terminal voltage or currents absorbed by < /b> consumers One of < /b> the < /b> ... ogy%20Use/KnO-100174_wind_for_electricity_generation.pdf [9] Furat Abdal Rassul Abbas , Mohammed Abdulla Abdulsada." Simulation of < /b> Wind-Turbine Speed Control by < /b> MATLAB", International Journal of < /b> Computer and < /b> Electrical Engineering, ... _Evaluation _of_< /b> parameters_affecting_wind_turbine_power_generation.pdf [5] Balasubramaniam Babypriya, Rajapalan Anita, “Modeling, Simulation and < /b> Analysis of < /b> Doubly Fed Induction Generator for Wind Turbine”,...
- 10
- 545
- 0
Báo cáo khoa học: Selecting cells with different Alzheimer’s disease c-secretase activity using FACS Differential effect of presenilin exon 9 deletion on c- and e-cleavage doc
... (a < /b> gift from < /b> G E O Muscat, University of < /b> Queensland, St Lucia, Australia) with primer 3a < /b> (5¢-GGTGATGCTG AAGAAGAAACAGTACATGAAGCTACTGTCTTC TATCG-3¢) and < /b> primer (5¢-GCTCTAGAGCTTCAC GGATGCATTATCGATGGGCTC-3¢) ... c-secretase assay (Eur J Biochem 270) 497 of < /b> the < /b> Ab-bands was quantitated and < /b> Ab-secretion was calculated relative to the < /b> protein concentration of < /b> the < /b> lysates prepared from < /b> the < /b> cells < /b> in each well, as ... (obtained from < /b> H Clarris, University of < /b> Melbourne, Parkville, Australia) with primer (5¢-TCAGGAGCTAA GGAAGCTAAAATGGTGAGCAAGGGCGAG-3¢) and < /b> primer (5¢-CCGCTCGAGTTACTTGTACAGCTCGT CCATGCC-3¢) The...
- 12
- 471
- 0
Báo cáo khoa học: Casein phosphopeptide promotion of calcium uptake in HT-29 cells ) relationship between biological activity and supramolecular structure ppt
... with the < /b> relationship between calcium < /b> phosphate–CPP aggregation as nanoclusters and < /b> the < /b> capacity to bind and < /b> maintain calcium < /b> in a < /b> bioavailable form The < /b> present investigation addressed the < /b> question ... dimension Therefore, the < /b> availability of < /b> both static and < /b> dynamic laser light scattering measurements enables us to decouple information about the < /b> average mass and < /b> relative concentration of < /b> CPP aggregates ... end of < /b> each experiment a < /b> calibration was performed [17] The < /b> peak of < /b> [Ca2+]i increase was calculated as the < /b> difference between the < /b> [Ca2+]i values recorded after and < /b> before (basal value) FEBS Journal...
- 13
- 468
- 0
Báo cáo khoa học: Membrane distribution of epidermal growth factor receptors in cells expressing different gangliosides doc
... recognizing the < /b> extracellular domain In addition, to ease the < /b> separation between GEM and < /b> other parts of < /b> the < /b> plasma membrane, the < /b> focal plane was mainly adjusted through the < /b> top of < /b> the < /b> cell, allowing the < /b> ... molecular mass of < /b> ErbB2 (185 kDa) is indicated (C) A < /b> quantitative analysis of < /b> Western blots from < /b> Figs 6B and < /b> 2A < /b> (CHOK1 wt and < /b> clone cells)< /b> was carried out to compare EGFr and < /b> ErbB2 gradient distribution ... visualization of < /b> larger plasma membrane areas and < /b> the < /b> identification of < /b> small membrane domains (Fig 5E–H) These data clearly confirmed that EGFr and < /b> GD3 are colocalized, to some extent, on the < /b> plasma...
- 10
- 327
- 0
Báo cáo sinh học: "Structural evolution of GeMn/Ge superlattices grown by molecular beam epitaxy under different growth " pot
... epitaxially grown on both Ge and < /b> GaAs substrates, but for Si substrates, to release the < /b> strain induced by < /b> the < /b> lattice mismatch, the < /b> formation of < /b> stacking faults, voids, or precipitates will be hardly ... disordered GeMn nanodots with a < /b> large amount of < /b> stacking faults, which can be explained by < /b> the < /b> fact that Ge and < /b> Si have a < /b> large lattice mismatch Moreover, by < /b> varying growth conditions, the < /b> GeMn/Ge ... GaAs, and < /b> Si substrates under the < /b> same growth conditions, respectively Ordered GeMn nanodot arrays are observed in Figure 1a,< /b> b, indicating that GeMn nanodot arrays can be formed both on Ge and...
- 11
- 318
- 0
Báo cáo lâm nghiệp: "Natural regeneration of sessile oak under different light conditions" pptx
... Thus, the < /b> area and < /b> time intensity of < /b> accretion cutting will be a < /b> controversial issue Bergmann (2001) recommended both large-area and < /b> small-area (suitable particularly in larger tracts of < /b> oak stand ... to assess the < /b> ratio of < /b> the < /b> sizes of < /b> the < /b> root system of < /b> seedlings and < /b> their aboveground parts, which will undoubtedly show a < /b> substantial effect on the < /b> stability and < /b> quality of < /b> a < /b> subsequent stand ... Galium odoratum, Poa nemoralis, Melica nutans, Luzula luzuloides and < /b> Festuca altissima dominate in the < /b> herb layer in the < /b> actual stand type In each of < /b> the < /b> stands, research polygon (RP) was established...
- 10
- 327
- 0
Báo cáo khoa học: " Variation in the molecular weight of Photobacterium damselae subsp. piscicida antigens when cultured under different conditions in vitro" pot
... naht rehtar aDk 42 ta dnuof erew sdnab ,revewoH aDk 74 ta dnab a < /b> htiw rehtegot ,MRG dna BST no derutluc airetcab no aDk 42 ta detceted saw dnab a < /b> saerehw ,airetcab evil tsniaga desiar ares gnisu ... retal srotagitsevni esehT −RI + BST ni derutluc airetcab no aDk 21 ta dnab a < /b> dna lCaN %2 htiw BST ni nworg airetcab no aDk 5.51 ta dnab a < /b> detceted ]5[ soluopokaB , psbus htiw detcefni ssab aes ... )atarua surapS( maerb aes daeh-tlig rof eniccav tnelavid a < /b> fo ssenevitceffE EA oznaroT ,CM anobelaB ,S ojirA ,B soñiragaM ,M nollirbahC ,LJ edlamoR ,AM ogiñiroM 52 12-21 ,91 ,6991 acittI lotaP...
- 7
- 334
- 0
Báo cáo lâm nghiệp: "Interactive effects of irradiance and water availability on the photosynthetic performance of Picea sitchensis seedlings: implications for seedling establishment under different management practices" ppt
... symbols) and < /b> 50% shade (closed symbols) Symbols represent a < /b> mean and < /b> the < /b> vertical bars the < /b> standard deviation (n = 3) The < /b> arrows in panels (a)< /b> and < /b> (b) indicate when seedlings subjected to a < /b> water ... predawn and < /b> midday Ψs increased to a < /b> level comparable to the < /b> control plants for the < /b> exposed < /b> and < /b> shaded treatments (Figs and < /b> 4) While Amax for the < /b> shaded seedlings showed a < /b> recovery after re-watering, ... and < /b> shaded conditions The < /b> primary aim was to examine the < /b> impact of < /b> interactions between water availability and < /b> irradiance in order to provide a < /b> more comprehensive understanding of < /b> the < /b> constraints...
- 10
- 345
- 0
Báo cáo lâm nghiệp: "The angular distribution of diffuse photosynthetically active radiation under different sky conditions in the open and within deciduous and conifer forest stands of Quebec and British Columbia, Canada" pptx
... than 80%) of < /b> the < /b> desired canopy species There was at least 20 m of < /b> similar habitat on all sides of < /b> the < /b> selected plots, and < /b> adjacent plots within a < /b> stand were separated by < /b> at least 20 m The < /b> separation ... (Mill.) BSP) in Quebec, and < /b> stands of < /b> red < /b> alder (Alnus rubra Bong.) and < /b> Douglas-fir (Pseudotsuga menziesii (Mirb.) Franco) in British Columbia, Canada The < /b> understory PAR distribution is determined by < /b> ... Quebec and < /b> on Vancouver Island in British Columbia, Canada Forest stands at the < /b> Duparquet Lake Research Station (48º 30' N, 79º 20' W) originated from < /b> a < /b> 1923 fire and < /b> were characterised by < /b> mature...
- 11
- 256
- 0
Báo cáo khao học: "High-resolution analysis of radial growth and wood density in Eucalyptus nitens, grown under different irrigation regimes" potx
... time, there is a < /b> common axis with the < /b> measured wood properties The < /b> axis of < /b> the < /b> dendrometer data is therefore rotated in a < /b> way that the < /b> radial distances of < /b> both measures are plotted on the < /b> abscissa ... increments The < /b> basic problem to solve is the < /b> fact that measured wood properties are on a < /b> distance scale, the < /b> growth data on a < /b> time scale If growth rates are assumed to be linear and < /b> constant over the < /b> ... gives an example of < /b> the < /b> association between wood density and < /b> dendrometer data Similar IDL (RSI Inc.) procedures were also written for mapping growth and < /b> weather data from < /b> a < /b> daily to a < /b> distance basis...
- 6
- 341
- 0
Báo cáo khoa học: "Initial mineralization of organic matter in a forest plantation soil following different logging residue management techniques" pps
... microbial population Increased microbial biomass may also be favoured by < /b> mechanical disturbance of < /b> the < /b> soil by < /b> increasing the < /b> availability of < /b> carbon According to Salonius [35], disturbance of < /b> the < /b> ... incorporated can be explained by < /b> high rates of < /b> root respiration due to the < /b> fast growth of < /b> grass in these plots and < /b> by < /b> the < /b> higher microbial activity, as shown by < /b> the < /b> increases in microbial biomass The < /b> ... other forest plantations [6, 15, 34] and < /b> may be a < /b> result of < /b> the < /b> increased supply of < /b> available carbon, and < /b> the < /b> higher temperature and < /b> moisture content, factors that favour a < /b> rapid increase in the...
- 12
- 312
- 0
Báo cáo khoa học: "Performance and morphological response of the hybrid poplar DN-74 (Populus deltoides x nigra) under different spacings on a 4-year rotation" pps
... leaf biomass and < /b> area were about 3, and < /b> Among all the < /b> relative measures of < /b> crown developa significant difference was obtained for crown ratio, and < /b> only between the < /b> 0.5 m spacing and < /b> the < /b> 1.0 and < /b> ... factor of < /b> from < /b> the < /b> 0.5 m to the < /b> 1.0 m spacing, and < /b> by < /b> a < /b> factor of < /b> 1.5 from < /b> the < /b> 1.0 m to the < /b> 1.5 m spacing The < /b> corresponding factors for both leaf biomass and < /b> leaf area were about 4.2 and < /b> 1.7, ... characteristics of < /b> crowns and < /b> foliage: Leaf area ratio (LAR) estimates the < /b> proportion of < /b> photosynthesizing biomass relative to respiring biomass, and < /b> also depends on the < /b> anatomy and < /b> chemical composition of...
- 13
- 230
- 0
Báo cáo khoa học: "Nutrient efficiency and resorption in Quercus pyrenaica oak coppices under different rainfall regimes of the Sierra de Gata mountains (central western Spain)" pps
... El Rebollar district (Sierra de Gata mountains, province of < /b> Salamanca, ern The < /b> climate of < /b> the < /b> Mediterranean, characterised by < /b> wet winters and < /b> hot, dry summers [28], with an average rainfall and < /b> ... nutrients absorbed by < /b> the < /b> leaves at the < /b> where LF is litterfall (referred SG, An estimation of < /b> the < /b> annual, soil nutrient uptake by < /b> made The < /b> tree nutrient uptake from < /b> the < /b> soil plants was calculated according ... in table III The < /b> sum of < /b> return (LF + TF) was previously determined by < /b> Gallardo et al [19] and < /b> the < /b> annual retention in the < /b> trunk and < /b> branch biomass by < /b> Gallego et al [23] Net foliar absorption of...
- 11
- 361
- 0
Báo cáo khoa học: "Performance of young jack pine trees originating from two different branch angle traits under different intensities of competition" ppt
... 0.5 m and < /b> the < /b> means of < /b> the < /b> 0.75, 1.0 and < /b> 1.5 m spacings, and < /b> between the < /b> means of < /b> the < /b> 0.75 and < /b> 1.0 m spacings and < /b> the < /b> means of < /b> the < /b> 1.5 and < /b> 2.0 m spacings The < /b> general trend was an increase in ... the < /b> base of < /b> the < /b> crown W2 and < /b> W1 = diameter at breast height (dbh) or stem height at ages T2 and < /b> T1; D1 and < /b> D2 = dbh at ages T2 and < /b> T1; F2 and < /b> F1 = needle biomass at ages T2 and < /b> T1; N2 and < /b> N1 = ... variation in branch angles within each branch angle type (figure 1) For acute branch angle type, the < /b> majority of < /b> the < /b> trees had branch angles between 50° and < /b> 65° About 12% of < /b> the < /b> trees had branch angles...
- 15
- 234
- 0
Báo cáo khoa học: "Height growth, shoot elongation and branch development of young Quercus petraea grown under different levels of resource availability" pptx
... of < /b> the < /b> natural death of < /b> the < /b> apical bud during the < /b> winter, and < /b> of < /b> experimental decapitation of < /b> the < /b> shoot apex on Q petraea, have clearly shown that loss of < /b> the < /b> apical bud increases lateral branch ... both the < /b> growth and < /b> the < /b> branching of < /b> oak seedlings, and < /b> that there may be a < /b> trade-off between the < /b> two parameters These results, however, are based on a < /b> variety of < /b> oak species and < /b> more information ... stem of < /b> the < /b> tree Half of < /b> the < /b> changes in dominance were associated with the < /b> death of < /b> the < /b> apical bud of < /b> the < /b> dominant axis The < /b> high frequency of < /b> apical bud death (20% of < /b> all apical buds, each year)...
- 17
- 240
- 0
Báo cáo lâm nghiệp: "of stem cuttings of Populus x euramericana under different water potentials" ppt
... decreased initially and < /b> then increased gradually This decrease may be due to decreased water absorption by < /b> the < /b> cuttings until the < /b> functional roots were formed Grange and < /b> Loach (1983) opined that the < /b> ... fol’ lowed the < /b> pattern of < /b> y solute but exaggerated any rise of < /b> potential, due to the < /b> fall in ’P bark ofl:en associated with rises in osmotic potential of < /b> the < /b> expressed sap The < /b> relative conductivity ... decreased initially, presumably due to high initial moisture, and < /b> later increased The < /b> root moisture content increased initially and < /b> then decreased in all the < /b> treatments This is attributed to the...
- 3
- 198
- 0
báo cáo khoa học: "Comparative analysis of root transcriptome profiles of two pairs of drought-tolerant and susceptible rice near-isogenic lines under different drought stress" doc
... play important roles in drought stress tolerance The < /b> functional categories were assembled from < /b> metabolic and < /b> signalling pathways available in different databases and < /b> in the < /b> literature A < /b> detailed ... Total RNA (160ng) was treated with DNase by < /b> the < /b> TURBO DNA-free Kit (Ambion) and < /b> reverse-transcribed by < /b> the < /b> iScriptTM cDNA Synthesis Kit (BIO-RAD) qRT-PCR reaction mixture was consist of < /b> the < /b> KAPA ... 17,091 Table The < /b> number of < /b> up- and < /b> down-regulated genes in roots of < /b> rice genotypes under different drought stress treatments ABI3VP1 Alfin-like AP2-EREBP ARF ARID ARR -B AUX/IAA BBR/BPC BES1 bHLH BSD...
- 50
- 370
- 0
Báo cáo y học: " Validation of an ambulatory cough detection and counting application using voluntary cough under different conditions" potx
... study was facilitated by < /b> the < /b> diligent contribution of < /b> KarmelSonix' Data Archival and < /b> Validation Team:Anat Shkolyar, Diana Goldstein, Yelena Vivat, Janna Tenenbaum-Katan, Shoval Dekel and < /b> Ben Alpert ... collected the < /b> experimental data, HL prepared the < /b> experimental protocol and < /b> assisted in the < /b> statistical data analysis, IK developed the < /b> hardware, SG evaluated the < /b> statistical data analysis and < /b> its ... were attached to the < /b> anterior neck (over the < /b> trachea) and < /b> chest and < /b> a < /b> pneumogram belt was placed at the < /b> xyphoid level Analysis of < /b> data for cough detection and < /b> counting The < /b> data recorded by < /b> the < /b> PulmoTrack®...
- 8
- 303
- 0
- explain the difference between quality assurance and quality control and give two examples of each
- isolation of multipotent mesenchymal stem cells from umbilical cord blood
- chapter 2 provides an overview of developments in the regulation of financial reporting by smes in the uk since the 1980s
- ultimately the changes incorporated into the model are aimed at providing the user of the annual accounts with more detailed information on the directors management of company resources by simply reading the principal accounting statements
- finally the statement of source and application of funds has been eliminated from the notes irrespective of the information on movement of funds required by the standards for the preparation of annual accounts
- the parathyroid glands vitamin d and hormonal control of calcium metabolism
- method for the derivation of induced pluripotent stem cells from human hair follicle keratinocytes
- summary of teacher data continuous variables from the surveys by data collection point and experimental condition
- summary of teacher data categorical variables from the surveys by data collection point and experimental condition
- 5generation of antigen specific t cells from stem cells
- isolation differentiation and characterisation of skeletal stem cells from human bone marrow in vitro and in vivo
- identification isolation and culture of intestinal epithelial stem cells from murine intestine
- isolation of hepatic progenitor cells from the galactosamine treated rat liver
- work in pair work out what feature s the types of the mass media have in common and what main feature s each of them has by filling in the gaps with each type of mass media
- 2014 inhibition of inflammatory injure by polysaccharides from bupleurum chinense through antagonizing p selectin carbohydrate polymers 105 pp 20 25
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25