Eur J Biochem 270, 495–506 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03405.x Selecting cells with different Alzheimer’s disease c-secretase activity using FACS Differential effect of presenilin exon deletion on c- and e-cleavage ` ´ M Fleur Sernee1, Genevieve Evin1, Janetta G Culvenor1, Jose A Villadangos2, Konrad Beyreuther3, Colin L Masters1 and Roberto Cappai1 Department of Pathology, The University of Melbourne and The Mental Health Research Institute, Parkville, Victoria, Australia; 2The Walter and Eliza Hall Institute of Medical Research, Parkville, Victoria, Australia; 3Center for Molecular Biology, ZMBH, University of Heidelberg, Heidelberg, Germany The ultimate step in Alzheimer’s disease Ab generation involves c-secretase, which releases Ab from its membranebound precursor A similar presenilin-dependent proteolytic activity is implicated in the release of the Notch intracellular domain We have developed a novel assay for c-secretase activity based on green fluorescent protein detection This involves cotransfection of a substrate-activator based on the amyloid precursor protein or the Notch sequence and a fluorescent reporter gene Stable fluorescent cell populations were selected by fluorescent activated cell sorting and characterized This assay enabled the identification and sorting of populations, which differ in their levels of c-secretase activity, with high fluorescent cells producing more Ab than low fluorescent cells Specific c-secretase inhibitors, L-685,458 and MW167, reduced cell fluorescence in a dose-dependent manner that paralleled inhibition of Ab secretion Overexpression of presenilin increased the cell fluorescence Cells expressing presenilin with different aspartate mutations (D257A, D385A and D257A/D385A) or exon deletion mutation showed reduced fluorescence The single aspartate mutations showed a concomitant reduction in Ab secretion, whereas the D257A/D385A and DE9 mutations had no effect on Ab secretion b-Amyloid (Ab) is the major constituent of Alzheimer’s disease (AD) amyloid plaques and plays a key role in the pathogenesis of AD The 4.5-kDa Ab peptide, is derived from the type I integral membrane amyloid precursor protein (APP) [1–3] Several groups have identified the b-secretase activity that releases the N-terminus of Ab, as a membrane-anchored aspartyl protease termed b-site-APPcleaving enzyme (BACE) [4] Cleavage of APP by BACE generates a sAPPb ectodomain and a 99 amino acid C-terminal fragment containing Ab (termed bCTF, C99 or A4CT) that remains anchored in the membrane This bCTF is cleaved by c-secretase, to produce Ab and the APP intracellular domain (AICD or eCTF) that is released into the cytosol [5–8] c-Secretase has a loose sequence specificity as it can cleave its substrate at various sites to produce Ab peptides of different lengths [9–11] c-Secretase activity is associated with a high-molecular weight complex that includes presenilin (PS1) or presenilin (PS2), nicastrin and PEN-2 [12–14] APH-1 is also required for c-secretase activity and may be part of the complex [15–17] Cells expressing PS1 with artificial mutations of the aspartate residues, amino acids 257 and 385, within the predicted transmembrane domains and show reduced c-secretase activity [18,19] This has led to the suggestion that PS’s are unusual aspartyl proteases The Notch family of type I membrane proteins are also processed within their transmembrane domains, at site (S3) and site (S4) by a c-secretase-like activity that requires presenilin expression [20–24] Cleavage of Notch transmembrane domain releases the Notch intracellular domain (NICD), which traffics to the nucleus This event is critical for the function of Notch in the regulation of cellular proliferation and differentiation [25], therefore therapeutic approaches based on c-secretase inhibition will have to be selective for APP and should not alter Notch signaling c-Secretase assays have generally been based on the detection of Ab secreted from cell culture media Recently, several groups have developed cell-free assays in which c-secretase activity was measured by detecting Ab with an enzyme-linked immunosorbent assay or by visualizing Ab and the corresponding 7-kDa CTF by immunoblotting In this report, we describe the development of a GFP-based cell fluorescence assay that is specific for c-secretase cleavages of either APP or Notch This assay involves cotransfection of eukaryotic cells with a substrate-activator Correspondence to Dr Roberto Cappai, The University of Melbourne, Parkville, Victoria 3010, Australia Fax: + 61 38344 4004, Tel.: + 61 38344 5882, E-mail: r.cappai@unimelb.edu.au Abbreviations: AD, Alzheimer’s disease; APP, amyloid precursor protein; Ab, amyloid b protein; BACE, b-site-APP-cleaving enzyme; CTF, C-terminal fragment; ECL, enhanced chemiluminescence; FAD, familial Alzheimer’s disease; FACS, fluorescence activated cell sorter; FBS, fetal bovine serum; GFP, green fluorescent protein; IP, immunoprecipitation; NICD, Notch intracellular domain; NP-40, nonidet P-40; PS1, presenilin 1; PS2, presenilin 2; WT, wild type (Received 15 October 2002, accepted 29 November 2002) Keywords: secretase; amyloid precursor protein; Notch; presenilin; fluorescence-assay Ó FEBS 2003 496 M F Sernee et al (Eur J Biochem 270) and a reporter gene The substrate-activator construct mimics c-secretase substrates (based on Notch or APP) fused to a transcription factor Upon proteolytic processing by c-secretase the activator domain is released and promotes expression of a green fluorescent protein (GFP) reporter gene Thus c-secretase activity can be monitored by measuring cell fluorescence We show the application of this assay to the testing of c-secretase inhibitors and PS1 mutants This assay allows for the first time the selection of cell populations and single cells by FACS based on their differences in c-secretase activity that correlates with their level of fluorescence Therefore this assay could be applied to the screening of cDNA libraries to identify genes that modulate c-secretase activity Experimental procedures DNA constructs The APP-based substrate-activator plasmids: pcDNA3.1+/ SP-A4DCT-GV and pIRESpuro2/SP-A4DCT-GV Both constructs consisted of the signal peptide (SP) of APP and the APP695 (amino acids 597–653) sequence (A4DCT) in frame with the GAL4 (G) and VP16 (V) sequences SP-A4DCT (259 bp) was PCR amplified from pCEP4/ SP-A4CT (gift from S F Lichtenthaler, ZMBH, Germany), using primer (5¢-CCCAAGCTTGGGTGCCCCGCGC AGGGTCGCG-3¢) and primer (5¢-GTACTGTTTCTT CTTCAGCATCACC-3¢) The GAL4-VP16 DNA fragment (678 bp) was produced by PCR from pGAL4-VP16 [26] (a gift from G E O Muscat, University of Queensland, St Lucia, Australia) with primer 3a (5¢-GGTGATGCTG AAGAAGAAACAGTACATGAAGCTACTGTCTTC TATCG-3¢) and primer (5¢-GCTCTAGAGCTTCAC GGATGCATTATCGATGGGCTC-3¢) Both DNA fragments were mixed in equal molar concentrations for splice-overlap PCR and cloned into pCDNA3.1+ (Invitrogen) or into pIRESpuro2 (Clontech) to enable the control of gene transcription by adjusting the concentration of puromycin The Notch-based substrate-activator plasmid: pCDNA3.1+/SP-NOTL-GV PCR was performed with primer 3b (5¢-CCCAAGCTTATGAAGCTACTGTC TTCTATCG-3¢) and primer to amplify the GV-DNA from the pCDNA3.1/SP-A4D CT-GV activator construct The GV-DNA fragment was cloned into pBS-SP-NOTL, a Notch construct in pBS(SK+) that consisted of the signal peptide of APP and amino-acids 1648–1927 of human Notch-1 (containing the S1 and S2 cleavage sites, but not the entire N-terminal domain) This construct was kindly provided by C Bergmann and T Hartmann (ZMBH, Germany) The resulting SP-NOTL-GV was subsequently cloned into pCDNA3.1+ The reporter plasmid: pSP72/5GAL-E1b-EGFP The p5Gal-E1b-CAT plasmid ([27], kindly provided by G E O Muscat) served as a PCR template to obtain the 5GALE1b-TATA promotor region (214 bp) using primer (5¢-CCCAAGCTTGGGCATGCCTGCAGGTCGGAG-3¢) and primer (5¢-TTTAGCTTCCTTAGCTCCTGA-3¢) The EGFP-DNA (750 bp) was amplified from pSP64TK- EGFP (obtained from H Clarris, University of Melbourne, Parkville, Australia) with primer (5¢-TCAGGAGCTAA GGAAGCTAAAATGGTGAGCAAGGGCGAG-3¢) and primer (5¢-CCGCTCGAGTTACTTGTACAGCTCGT CCATGCC-3¢) The splice-overlap PCR-product was cloned into pUC18 (NEB) and subsequently cloned into pSP72 The hygromycin resistance gene was amplified from the pCEP4 plasmid (Invitrogen) with primer (5¢-GGACCAGACCCCACGCAACG-3¢) and primer 10 (5¢-GCCCTGCTTCATCCCCGTGG-3¢) and cloned into the pSP72/5GAL-E1bEGFP construct at the NdeI site The presenilin constructs, pIRESpuro2/PS1 WT, PS1 D257A, PS1 D385A, PS1 D257A/385 A and PS1 DE9 All PS1 constructs were cloned into the pIRESpuro2 plasmid To obtain PS1 WT, RNA was extracted from SH-SY5Y cells with TRIzol (Life Technologies), cDNA was produced with the RNA PCR Core kit from Perkin Elmer (Roche) and primers 11 (5¢-CTAGCTAGCATGACAGA GTTACCTGCACC-3¢) and 12 (5¢-ATAGTTTAGCG GCCGCTAGATATAAAATTGATGGAATGC-3¢) were used to amplify presenilin DNA DNA sequencing revealed that some clones contained the sequence for the four amino acids (VRSQ) in exon while some did not We used the PS1 WT containing the VRSQ sequence We used this construct to create the D385A mutation using the QuikChangeTM XL Site-Directed Mutagenesis Kit (Stratagene) PS1 D257A and PS1 D257A/D385A, were obtained from A Weidemann and F Reinhard (ZMBH, Heidelberg, Germany) [8] and transferred from pCEP4 into pIRESpuro2 The PS1 DE9 DNA, was PCR amplified with primers 11 and 12 from pCDNA3.1/PS1 DE9 with an N-terminal flag sequence (kindly provided by F Reinhard) and was cloned into pIRESpuro2 We thereby removed the N-terminal flag sequence The last three mutations did not contain the VRSQ-sequence and therefore their mutations would be at position D253A and D381A, but we have kept the nomenclature similar to what is published in the literature to avoid confusion Cell culture and transfection COS-7 cells were maintained in DMEM with high glucose (Life Technologies), and CHO cells were grown in RPMI1640 (ICN), supplemented with 10% (w/v) fetal bovine serum (FBS) (CSL, Parkville, Australia) and penicillin (50 mL)1)/streptomycin (50 lgỈmL)1) (Life Technologies) Substrate-activator and reporter plasmids were transfected in a : ratio, respectively, into COS-7 or CHO cells using Lipofectamine 2000 reagent (Life Technologies) according to the manufacturer’s protocol Stable transfected cell lines were obtained after selection with Hygromycin B (300 lgỈmL)1), Geneticin (500 lgỈmL)1) (Life Technologies) or Puromycin (2.5–12.5 lgỈmL)1) (Sigma) Antibodies The mouse monoclonal antibodies 1E8 [28], WO2, G2-10 (specific for Ab40) and G2-11 (Ab42) [29] were used for immunoprecipitation and Western blotting of Ab The rabbit polyclonals anti-Gal4 DNA binding region (Upstate Ó FEBS 2003 Biotechnology) and the anti-PS1 98/1 [30], were used for immunoprecipitation of lysates Sheep anti-mouse–horseradish peroxidase conjugate (Amersham) was used as secondary antibody in the blotting procedure Rabbit antimouse Igs (Dako, CA, USA) were used to link the 1E8 and G210 mAbs to the protein A Sepharose CL-4B (Pharmacia) Radiolabeling, immunoprecipitation, gel electrophoresis and Western blotting To analyze protein expression and processing, cells were starved for 45 in methionine- and cysteine-free medium (ICN), pulsed for 30 in medium containing mCiỈmL)1 35S translabel mix (ICN) and chased for 60 Cell lysis and immunoprecipitation were performed as described [31], with the modification that the samples were equalized for their radioactive incorporation and precleared twice with 100 lL formalin-fixed, heat-inactivated Staphylococcus aureus Cowan strain bacteria (Staph A, 10% v/v) before immunoprecipitation to reduce the background signal Proteins were separated on 12% Tris-Tricine gels and transferred to polyvinylidene fluoride membranes (Millipore) The membrane was either exposed to a phosphorimaging screen and analyzed with the MACBAS V 2.0 imaging software (Fuji) or exposed to BioMax MR-1 film (Kodak) and the density of the bands quantified using the NIH-IMAGE 1.60 software For Ab–Western blotting, the cell culture medium (1 mL) was harvested from 10 cm dishes seeded with similar number of cells (approximately 90% confluent) and Ab was immunoprecipitated with mAb WO2, 1E8, G210 and G211 The immunoprecipitates were resolved on 10–20% Tris-Tricine gels (Novex, Invitrogen) and transferred to nitrocellulose The membranes were boiled for min, blocked with 0.5% (w/v) casein, incubated with primary antibody WO2, and developed by chemiluminescence reaction (ECL, Amersham) Ab release from cells treated with inhibitors was determined from radiolabeled cells Cells were grown in 24 well plates and preincubated with the c-secretase inhibitors in starvation medium After one hour incubation the medium was replaced with labeling medium containing the inhibitors as described above and incubated for 17 h FACS analysis and sorting Cells were trypsinized and resuspended in NaCl/Pi containing 10 mM EDTA and 1–2% FBS Propidium iodide (50 lgỈmL)1) was added to stain dead cells Cells were kept on ice until analysis with FACScan, or sorting using MoFlo, Facs Star or FACS-II (Becton Dickinson) Analysis was performed using the computer software program WAESEL 1.2.1 (F Battye, Walter and Eliza Hall Institute, Parkville, Australia) Analysis of presenilin transfections Cells stable transfected with PS1 were plated in triplicate (in 12-well plates) After 24 h medium was immunoprecipitated with WO2 antibody to analyze Ab-secretion by Western blotting as described above Cells were washed and prepared for FACS analysis as described above The density Cell fluorescence c-secretase assay (Eur J Biochem 270) 497 of the Ab-bands was quantitated and Ab-secretion was calculated relative to the protein concentration of the lysates prepared from the cells in each well, as determined by BCA protein assay (Pierce) Protease inhibitor treatment Cells were plated into 12- or 24-well plates and incubated for 72 h with various concentrations of inhibitor in a final dimethylsulfoxide concentration of 0.5% After 24 h the medium was replaced with fresh medium containing inhibitor Inhibition of c-secretase activity was determined by FACS analysis of the cells, using fluorescence as an indication of GFP expression, and by immunoprecipitation of radiolabeled-Ab from the culture media (as described above) L-685,458 [32,33] and compound were obtained from M Shearman (Merck Sharp and Dohme, Terlings Park, UK) and MW167 [34] was purchased from Calbiochem E-64d (2S,3S)-trans-epoxysuccinyl-L-leucylamido-3-methyl-butane ethyl ester and lactacystin were from Sigma Calpain inhibitor I, N-acetyl-Leu-Leu-norleucinal (ALLN) and the caspase inhibitors Boc-D-FMK and z-DEVD-FMK were purchased from Calbiochem The signal peptide peptidase inhibitor (Z-LL)2 ketone [35], was kindly provided by M Bogyo (UCSF, San Francisco, CA, USA) Results Assay design This novel c-secretase assay involves cotransfection of a substrate-activator and a reporter gene into mammalian cells, as outlined in Fig 1A The substrate-activator construct mimics c-secretase substrates, either based on the APP or on the Notch sequence that are fused to the transcription activator factor Gal4-VP16 It is expressed with a signal peptide to ensure correct insertion and orientation into the membrane Proteolytic processing of the substrate-activator protein by c-secretase releases the activator domain into the cytosol, allowing it to promote expression of the enhanced green fluorescent protein (EGFP) reporter gene (Fig 1A) Therefore, cells cotransfected with the substrate-activator and reporter constructs can be distinguished for their c-secretase activity by their fluorescent appearance The APP substrate consists of the APP signal peptide followed by two extra amino acids, leucine and glutamate (LE), and the b-secretase C-terminal fragment of APP (A4CT) minus the cytoplasmic domain It has been shown that the SP-LE-A4CT construct is a suitable c-secretase substrate [36,37] Our rationale behind the design of the substrate-activator construct was to develop an assay to screen specifically for the modulators of c-secretase activity The cytoplasmic domain of APP was shown to be sensitive to caspase cleavage [38–40], thus we deleted most of the cytoplasmic domain from the SP-LE-A4CT construct but we retained the triple lysine, glutamine and tyrosine motif (KKKQY) [41] The Gal4-VP16 (GV) transcription factor [42] binds to the reporter construct that contains five Gal4 binding sites The herpes simplex virus protein VP16 promotes the expression of the EGFP reporter gene through 498 M F Sernee et al (Eur J Biochem 270) Ó FEBS 2003 empty plasmid and the reporter construct did not express GFP (Fig 1B, panel 2) whereas cells expressing SP-A4DCT-GV plus the reporter expressed GFP and were fluorescent (Fig 1B, panel 4) This demonstrates that expression of GFP is totally dependent upon the release of the activator domain (GV) from the SP-A4DCT-GV substrate Similarly, cells transfected with both SP-NOTLGV and the reporter displayed green fluorescence, indicating release of the activator domain into the cytosol (data not shown) c-Secretase activity correlates with GFP expression Fig The fluorescent reporter c-secretase assay (A) Principle of the assay Cells are cotransfected with a substrate-activator and a reporter cDNA constructs The substrates are based on APP and Notch1 sequences genetically fused to Gal4-VP16 transcription activators c-Secretase cleavage releases the activator domain in the cytosol, which can then traffic to the nucleus to initiate the transcription of the green fluorescence protein (GFP) gene by binding to the 5Gal-E1b domain of the GFP reporter construct (B) Transfection of COS-7 cells with both substrate-activator and reporter genes yielded fluorescent cells Double-transfected COS-7 cells were fixed and observed by phase (panels and 3) and fluorescence microscopy (panels and 4) Phase microscopy showed similar images of cells transfected with mock (1) or SP-A4DCT (3) activator constructs Fluorescence was observed in cells transfected with the c-secretase substrate (4) but not in cells containing the empty control plasmid (2) the E1b viral transcription initiation codon [27] This APPbased substrate-activator construct was named SP-A4DCTGV A similar Notch-construct, termed SP-NOTL-GV, was prepared that includes the APP signal peptide followed by the human Notch sequence (residues 1648–1927; including the S1, S2 and S3 cleavage sites for furin, TACE and c-secretase-like activity, respectively [21,23,43,44], fused to the GV domain Co-transfection of both substrate-activator (SP-A4DCTGV) and reporter (5Gal-E1b-EGFP) DNA constructs into COS-7 and CHO cells resulted in the expression of GFP positive cells Figure 1B shows phase (panels and 3) and fluorescence microscopy (panels and 4) of COS-7 cells transfected with both constructs (panels and 4) or with an empty pCDNA3.1+ plasmid plus the reporter (panels and 2) Control cells that were mock-transfected with the Correct membrane orientation and signal peptide cleavage of the SP-A4DCT-GV construct was confirmed using in vitro transcription/translation of the DNA constructs according to Bunnell et al [45] (data not shown) To characterize the expression of the SP-A4DCT-GV substrateactivator construct, metabolically labeled cells stably transfected with the SP-A4DCT-GV plus reporter plasmids were lysed and the proteins were immunoprecipitated with WO2 (anti-Ab) and anti-Gal Igs Both antibodies showed reactivity for a protein migrating at approximately 36 kDa, a molecular mass consistent with that expected for expression of the full length protein with glycosylation of the Gal4 binding domain (Fig 2A; lanes 2–4) Immunoprecipitation with WO2 depleted the anti-Gal4 reactive protein species from the lysate, as shown by a marked reduction of the signal in subsequent anti-Gal4 immunoprecipitation This result confirms that both antibodies target the same protein (compare Fig 2A; lanes 2–4) The 36 kDa protein was not immunoprecipitated from control cells that not express the A4DCT-GV protein (Fig 2A; lanes 1, and 6) Immunoprecipitation with anti-Gal yielded an additional band of 31 kDa that was not detected by WO2 and is thus N-terminally truncated From its electrophoretic mobility, this would correspond to the C-terminal fragment produced by c- or e-secretase cleavage (Fig 2A; lanes and 4) The 31 kDa band was subjected to automated Edman degradation Counting of the fractions revealed a radioactive signal in fractions and 2, suggesting the presence of Met at cycle or/and (data not shown) This data is consistent with recent reports showing that eCTF starts with Val50 and is sensitive to amino peptidase degradation [7,8,46–48] Immunoprecipitation of conditioned media from these cells with WO2 and 1E8 mAbs showed Ab secretion Immunoprecipitation with Ab C-terminal specific antibodies demonstrated that the predominant species secreted was Ab40 (immunoreactive to G2-10) whereas Ab42 (immunoreactive to G2-11) was undetectable (Fig 2B) Therefore correct metabolism of the A4DCT-GV construct into Ab was occurring Anti-Gal immunoprecipitations of lysates of cells stably transfected with Notch substrate-activator and reporter constructs detected full-length NOTL-GV as a 64-kDa species and a cleavage product migrating at 49-kDa, as expected for a site-3/c-secretase cleavage product (Fig 2A; lane 7) The doubly transfected cells that expressed GFP showed heterogeneity in their fluorescence intensity Therefore preparative FACS was used to sort stable low and high fluorescent populations for use in further experiments (Fig 2C) At least three rounds of FACS sorting were Ó FEBS 2003 Cell fluorescence c-secretase assay (Eur J Biochem 270) 499 performed to obtain cell populations with a GFP expression level that remained stable over time, as determined by measurement of fluorescence intensity To determine if the fluorescence intensity paralleled Ab secretion we immunoprecipitated Ab from the medium of metabolically labeled cells expressing low and high levels of GFP Figure 2C shows that cells with a high level of fluorescence (as determined by FACS) secrete more Ab than cells with low fluorescence This clearly shows that fluorescence is dependent on c-secretase cleavage and correlates with Ab production c-Secretase inhibitors decrease cell fluorescence Fig Characterization of the assay (A) The substrate-activator constructs are correctly expressed and proteolytically processed in mammalian cells COS-7 cells stably transfected with empty vector (–, lanes 1, and 6), SP-A4DCT-GV (A, lanes 2–4) or SP-NOTL-GV (N, lane 7) constructs were pulsed for 30 and chased for h Cell lysates were analyzed by immunoprecipitation (IP) with anti-Gal (lanes 1–3, and and 7) or anti-Ab (WO2, lanes and 6) Igs Both antibodies recognized the expected 36-kDa glycosylated protein A4DCT-GV (lanes 2–4), while anti-GAL4 also recognized the 31-kDa cleaved C-terminal fragment of A4DCT-GV (CTFc-GV) (lanes and 3) Lanes and correspond to cell lysates immunoprecipitated sequentially (seq-IP) with anti-Gal Ig after WO2; lanes and correspond to the WO2 IPs As expected, NOTL-GV is expressed as a 64-kDa protein and the anti-GAL4 reactive fragment of 49-kDa has the correct size to represent the N-terminally truncated NICD-GV product from site-3 cleavage (lane 7) (B) IP of the conditioned medium from cells transfected with SP-A4DCT-GV with anti-Ab Igs followed by Western blotting with WO2 detected the presence of Ab peptide (lanes 5–7) G2-10 (Ab40; lane 7) but not G2-11 (Ab42; lane 8) immunoprecipitated the 4-kDa species, indicating that the cells secreted mostly Ab40 Ab was undetectable in medium from mock-transfected cells (lanes 1–4) (C) Fluorescence intensity varied between individual cells, reflecting different levels of GFP expression Low and high GFPexpressing populations were isolated by preparative FACS A typical histogram is shown The dotted line are mock-transfected cells, the grey solid line represents the population sorted for low expression of GFP, while the black solid line are the cells expressing high levels of GFP Levels of secreted Ab were analyzed from these low and high fluorescent populations, which were grown overnight in six-well plates in medium containing mCiỈmL)1 35S using WO2 To confirm further the specificity of our assay, we tested the effect of specific c-secretase inhibitors on the doubly transfected cells After incubation for 72 h in the presence of inhibitors, the cells were analyzed by FACS for GFP expression Propidium iodide staining was used to gate for live cells In each sample we gated for the same number of live cells Quantitation was performed using the mean values of the fluorescence intensity of the gated cells and converted to percentages, to allow comparison between individual experiments Mock-transfected cells were considered as nonfluorescent (0%) and the test cells treated with 0.5% dimethylsulfoxide were regarded as 100% fluorescent (see Fig 3A) A dose-dependent reduction of GFP expression was observed with L-685,458, a potent inhibitor of c-secretase activity [32,33] Treatment of COS-7 cells expressing the APP substrate with lM L-685,458 resulted in a nearly total loss of fluorescence (Figs 3B–D) A concentration of lM of inhibitor was required to achieve similar results in the same cell line expressing the Notch substrate (Fig 3D) The control inactive compound had no effect A marked reduction of fluorescence was also observed when COS-7 cells expressing either substrate were incubated with the difluoroketone inhibitor MW167 [34], at 50 lM concentration (Fig 3D) To confirm that c-secretase inhibition paralleled the loss of fluorescence, the cell media were analyzed for Ab production Each inhibition experiment was initiated with the same number of cells, but we observed that after 72 h incubation the cells treated with MW167 were less confluent than the control cells or those incubated with L-685,458 Microscopic examination at 66 h confirmed that MW167 (‡ 50 lM) had a growth inhibiting/toxic effect on the cells as judged by their morphology and density (data not shown) Therefore, the effects of the inhibitors on Ab secretion and substrate cleavage were determined by immunoprecipitation after 17 h incubation in the presence of 35S label Ab secretion was decreased in a dose-dependent manner upon treatment with L-685,458 and was almost totally abolished at lM concentration (Fig 3B) MW167 also had a pronounced effect on Ab secretion at 50 lM, the same concentration that dramatically reduced the cell fluorescence As expected, an accumulation of APP substrate, which corresponds to bCTF, was observed upon inhibitor treatment (data not shown) The effect of the c-secretase inhibitors was also studied in CHO cells to confirm our findings in a different cell line The inhibitors were 2–10 times less potent in CHO cells 500 M F Sernee et al (Eur J Biochem 270) Ó FEBS 2003 transfected with the APP substrate than in COS-7 cells lM L-685,458 reduced the fluorescence levels nearly to zero, independent of the eukaryotic expression plasmid used (Fig 3C) MW167 also reduced the GFP expression, but was times less potent than L-685,458 Effect of c-secretase inhibitors on the fluorescence of cells expressing the Notch substrate Although it has been shown that a similar cleavage releases the intracellular domains of APP and Notch, it remains unclear whether the same proteolytic activity is involved Therefore we compared the effect of c-secretase inhibitors on both substrates The effect of the L-685,458 and MW167 was less pronounced on cells expressing the Notch substrate than on the cells expressing the APP substrate but the relative order of potency was conserved, i.e L-685,458 was fivefold more potent than MW167 (Fig 3D) A fivefold higher concentration of L-685,458 was required to reduce the level of fluorescence in the Notch-substrate transfected cells to the same level as in APP substrate transfected cells At all concentrations tested (0.1 lM, 0.5 lM and lM), L-685,458 caused a significant decrease in relative fluorescence, whereas the control inactive compound 2, had a very marginal effect (Fig 3D) Effect of cysteine protease, proteasome, caspase, and signal peptide peptidase inhibitors on GFP-expression The level of GFP expression could not be reduced to zero even after a 72-h incubation with the potent c-secretase inhibitor, L-685,458 This may reflect the stability of the GFP protein, which has a 24-h half-life Alternatively the activator domain could be released by more than one Fig Specific c-secretase inhibitors abolish cell fluorescence Stable populations of green-fluorescent cells expressing substrate-activator and reporter genes were incubated for 72 h in the presence of 0.5% dimethylsulfoxide containing various concentrations of c-secretase inhibitors then analyzed by FACS (A) Relative fluorescence was calculated as the ratio of mean linear fluorescence (MLF) of inhibitortreated cells (grey solid line) to the MLF of DMSO treated cells (black solid line) after subtraction of the MLF of the mock-transfected cells (dotted line) (B) Comparison of the effect of the c-secretase inhibitors on Ab secretion (open bars) and cell fluorescence (grey bars) Cells were metabolically labeled for 17 h in the presence of inhibitors Ab was immunoprecipitated from the media with WO2, resolved on 10–20% Tris-Tricine gels and analyzed by phosphoimaging using MACBAS2.0 software Relative c-secretase activity (Ab-secretion) was calculated for each experiment towards the signal obtained for cells treated with 0.5% dimethylsulfoxide only, after subtraction of the Ab-signal obtained for mock-transfected cells Relative fluorescence (relative c-secretase activity) was calculated as described in panel A (C) Effect of c-secretase inhibitors on fluorescence of CHO cells stably transfected with SP-A4DCT-GV cloned in pcDNA3.1 (open bars) or in pIRESpuro2 plasmids (grey bars) (D) Comparison of the effect of c-secretase inhibitors on APP c-secretase (AICD-release) (open bars) and Notch S3 cleavage (NICD-release) (grey bars) in the fluorescent reporter assays *P < 0.05, **P < 0.005, ***P < 0.001; n represents the number of individual experiments analyzed Ó FEBS 2003 Cell fluorescence c-secretase assay (Eur J Biochem 270) 501 Table Comparative effect of various protease inhibitors on the fluorescence of cells transfected with SPA4DCT-GAL-VP or SP-NOTLGVP plus the GFP reporter The number of independent experiments is indicated by n Relative fluorescence (%) Inhibitor A4DCT-GV NOTL-GV E-64d 10 lM lM 123 ± 10 (n ¼ 4)* 116 ± 19 (n ¼ 5) 150 ± 16 (n ¼ 3)* 137 ± 34 (n ¼ 3) N-Acetyl-Leu-Leu-norleucinal 10 lM 113 ± (n ¼ 4) lM 106 ± 10 (n ¼ 4) 149 ± 27 (n ¼ 3) 114 ± 12 (n ¼ 4) Lactacystin lM 0.5 lM 0.1 lM 62 ± 20 (n ¼ 4) 76 ± 24 (n ¼ 4) 115 ± 23 (n ¼ 2) 110 ± 39 (n ¼ 4) 97 ± 34 (n ¼ 4) 95 ± 20 (n ¼ 3) Boc-D-FMK 10 lM lM 96 ± (n ¼ 2) 97 ± (n ¼ 2) 97 ± (n ¼ 2) 97 ± (n ¼ 2) DEVD-FMK 10 lM lM 93 ± (n ¼ 2)* 93 ± (n ¼ 2)*** 97 ± (n ¼ 2) 96 ± (n ¼ 2) 132 ± 13 (n ¼ 2) 105 ± (n ¼ 2)*** 155 ± 26 (n ¼ 2) 98 ± (n ¼ 2) 109 ± (n ¼ 3) 110 ± (n ¼ 2) (Z-LL)2 10 lM lM lM *P < 0.05, ***P < 0.001 proteolytic activity [31] To test the latter hypothesis other inhibitors were also applied in the COS-7 cell fluorescence assay, including in particular proteasome and caspase inhibitors The inhibitors lactacystin (0.5 lM and lM), ALLN (10 lM) and MG132 (10 lM and 100 lM) had a toxic effect on the cells as determined by microscopic examination The dead cells were stained with propidium iodide and were excluded during FACS analysis Table summarizes the results of the inhibitor treatments Among the inhibitors tested only the caspase inhibitor DEVDFMK showed a significant, but very slight (7%) decrease in fluorescence in cells expressing the APP substrate Lactacystin and the other inhibitors did not decrease the fluorescence in cells transfected with the Notch substrate, confirming that the fluorescence observed was mostly due to c-secretase cleavage The cysteine protease inhibitor E-64d significantly increased the fluorescence, particularly in the cells expressing the Notch substrate As c-secretase cleavage resembles the cleavage of signal peptides by signal peptide peptidases (SPP), an inhibitor of SPP was also tested in our assay Both c-secretase and SPP cleave their substrates within the middle of the transmembrane region It was recently shown that a gene identified for its homology to presenilin and termed presenilin homologue (PSH3) [49] corresponds to SPP Thus the inhibitor of signal peptide peptidase-activity (Z-LL)2 ketone, was tested in our assay [35,50] This inhibitor showed no significant effect on the cell fluorescence at 1, and 10 lM on both APP and Notch substrates (Table 1) and did not affect Ab-secretion (data not shown) Effect of presenilin expression on fluorescence and Ab-secretion Presenilin is required for 40–42 cleavage, or c cleavage (for the release of Ab40)42), and 49 cleavage, or e cleavage, of APP The precise cleavage mechanism is unknown and data using PS1 dominant-negative aspartate mutations have been controversial We determined the effect of transfecting wild type (WT) PS1 and PS1 mutants (PS1 D257, PS1 D385A, PS1 D257/385) on the cell fluorescence in our APPbased assay We also tested the effect of the PS1 exon-9 deletion mutation (PS1 DE9) This mutation prevents PS1 endoproteolysis and causes an aggressive form of early onset AD with abundance of amyloid positive cotton-wool plaques [51,52] We compared the effect of these mutations on cell fluorescence and Ab-secretion For each PS1 mutant several transfections were performed and stable cell lines were obtained The cell lines with a high level of expression of PS1 were selected for the study (Fig 4A) Results of nine individual experiments show that transfection with PS1 WT resulted in a 2.2-fold increase in fluorescence as compared to mock (Fig 4B), which was similar to the effect seen on Ab-secretion (a 2.8-fold increase in Ab-secretion compared to mock) (Fig 4D) Transfection of cells with PS1 bearing the single (PS1 D257A or PS1 D385A) or the double aspartate mutations (PS1 D257A/D385A) caused a decrease in cell fluorescence as compared to cells transfected with PS1 WT (n ¼ 7) (Fig 4C) The level of fluorescence was below the level of mock-transfected cells, indicating displacement of endogenous PS1 The PS1 DE9 mutation caused an increase in fluorescence, but not to the same level as PS1 WT (n ¼ 7) (Fig 4C) We observed a significant reduction in Ab-secretion from the cells transfected with PS1 D257A and PS1 D385A as compared to those transfected with PS1 WT (Fig 4E) Expression of PS1 D257A/D385A and PS1 DE9 mutations did not change Ab-secretion significantly as compared to expression of PS1 WT (results from individual experiments) (Fig 4E) Discussion We have developed a novel GFP-based assay to characterize c-secretase The advantage of this assay over existing systems is that it allows the isolation of cells with stable differences in c-secretase activity We established that the differences in fluorescence correlated with Ab production with the high fluorescent cells expressing more Ab than the low fluorescent cells Therefore the release of the GAL4VP16 domain provides a direct measure of c-secretase activity This assay has a definite advantage over traditional Ab-antibody based assays, such as ELISA and immunoprecipitation, for measuring c-secretase activity by allowing a direct measure of c-secretase activity The Ab-antibody assays would be affected by factors which affect Ab turnover and clearance An alternative assay has recently been described that uses luciferase as the reporter molecule [53,54] The luciferase-based assay has the advantage over the GFP assay of being more quantitative, but it cannot compensate for dead cells that would clearly affect the 502 M F Sernee et al (Eur J Biochem 270) readout Furthermore, proteasome inhibitors can interfere directly with luciferase reporter enzymes [55] The GFP-assay was adapted for studying c-secretase cleavage of Notch Both cleavages of APP- and Notch-based Ó FEBS 2003 substrates were modulated by known c-secretase inhibitors We found that inhibition of Ab secretion correlated with the observed decrease in fluorescence determined by FACS analysis, but they were never identical (see Fig 3B) This discrepancy may reflect the different experimental conditions used (17 h vs 72 h incubation with inhibitors) and/or different methods of measurement (fluorescence assay, which measures expression of the GFP, as compared to immunoprecipitation of Ab secreted in the culture media) Our results suggest that the proteolytic activity required for cleavage at position Leu49 is not identical to that cleaving at position Val40 The fluorescent assay measures the release of the cytoplasmic domain into the cytosol, which we have shown is cleaved at Leu49 whereas the Ab assay measures a species that is cleaved at position 40 However, both methods clearly measured a dose-dependent decrease in c-secretase cleavage with specific c-secretase inhibitors and the relative potency of L-685,458 and MW167 (over 50-fold) was the same for both assays This is consistent with previous reports [32–34] and suggests that the same proteolytic machinery produces Ab and the C-terminal cytosolic fragment Differences in potency of the inhibitors in the alternative cell types might reflect differences in processing between cell lines as observed by other groups [32,56] Our results show an approximately 50-fold difference in potency between L-685,458 and MW167 which is consistent with a previous report using a luciferase reporter assay [53] These effective concentrations of both inhibitors on c-secretase activity also correspond to their potency as determined from Ab secretion [32,56,57] We observed a difference in potency of inhibition between Notch and APP substrates The effective concentrations from our data did not correspond to those obtained by Taniguchi and coworkers in HEK293 cells using a luciferase-based assay [54] This might reflect differences in cell lines and substrates, because they observed different effects of the L-685,458 inhibitor depending on the Notch substrate used (greater inhibition with Notch than Notch 1) Furthermore, they show that there is a Notch receptor cleavage that depends on, but is not directly executed by presenilins, and cannot be inhibited by Fig Effects of presenilin mutations on fluorescence and Ab-secretion Green fluorescent cells (transfected with the APP-based substrateactivator and reporter) were transfected with PS1 WT or mutants (A) Stable cell populations were produced and cell-lysates were analyzed for PS1 expression with the 98/1, anti-PS1-NTF, Igs (B) Analysis by FACS shows that transfection with PS1 WT increases the fluorescence by an average of 2.2-fold as compared to mock-transfection (n ¼ 9) (C) Results of seven individual experiments show that each PS1 mutation tested decreases the fluorescence significantly as compared to PS1 WT (right panel) (D) PS1 WT transfection increased the Ab secretion to 2.8-fold as compared to mock (average of five experiments) (E) PS1 D257A and PS1 D385A caused a significant reduction in Ab secretion as compared to PS1 WT PS1 D257A/D385A and PS1 DE9 had no significant effect on Ab secretion Conditioned medium was removed from the cells prior to FACS analysis and immunoprecipitated with WO2 Densitometry values were determined for each Ab band and standardized for amount of protein in each well The results of four individual experiments are shown **P < 0.005, ***P < 0.001 Ó FEBS 2003 c-secretase inhibitors and by immunoprecipitation with anti-PS Igs The signal peptide peptidase inhibitor (Z-LL)2-ketone, was unable to inhibit c-secretase activity when tested at 1, and 10 lM concentrations This could reflect the opposite membrane orientation of the active-site motifs YD and LGLGD in the predicted transmembrane and of this protein compared to these motifs in PS [50] The slight inhibitory effect of the caspase inhibitor DEVD-FMK shows that its contribution to the cell fluorescence is minor This result could explain why we never observed total loss of fluorescence of the cells even when Ab secretion was nil The increase in fluorescence observed with the E64-d inhibitor suggests that a cysteine protease degrades the Notch substrate, making less protein available for c-secretase cleavage The Notch substrate contains the entire cytosolic domain whereas the APP does not, thus it is likely that the protease inhibited by E-64d processes the Notch construct within the cytosolic domain Furthermore cysteine protease activity has been reported to remove PS1 fragments that are not incorporated into the complex as well as the holoprotein itself [58] and therefore inhibition of this activity could increase the levels of PS1 and therefore increase c-secretase activity To test whether the assay could identify differences in c-secretase activity due to changes in components of the c-secretase complex, we overexpressed WT PS1 and some PS1 mutations The original data by Wolfe and coworkers [18] that the aspartate residues were critical for PS-mediated cleavage of APP were reproduced in our GFP-based assay We were able to decrease the fluorescence levels below those of the mock-transfected cells, indicating some displacement of the endogenous PS However, we were unable to achieve complete inhibition of cell fluorescence by these mutants, as we were unable to replace all the endogenous PS with the exogenously expressed PS1 In PS1 D257A/D385A transfected cells we observed a decrease in fluorescence and therefore a decrease in AICD release, while the Ab levels remain unchanged Kim and coworkers [59] observed a similar decrease in intracellular domain release and no effect on Ab-secretion when they expressed PS1 D257A/D385A in N2A cells Together with Yu and coworkers [60,61] they also showed that aspartate mutations alter APP-trafficking Overexpression of PS1 DE9 resulted in only a 40% increase of fluorescence as compared to PS1 WT, but did not significantly alter Ab-levels Chen and coworkers recently reported that expression of PS1 DE9 increased Ab42 levels, but inhibited cleavage at the e-site and the release of AICD [62] Therefore our data provide further evidence that c- and e-cleavage can be differentially affected by PS1 mutations This strengthens the hypothesis that the c-secretase complex could have multiple active sites, multiple conformations or one active site and at least two different substrate binding sites for c- and e-cleavage [63,64] The PS1 DE9 deletion mutation, like the single aspartate mutations, affects the maturation of the high molecular weight complex components that constitute the c-secretase activity [60] These mutations could thus affect the components present in the complex PS1 DE9 overexpression results in normal Ab secretion, but reduced fluorescence, indicating reduced CTF release from the membrane even in the presence of Ab production This suggests that c-cleaved CTF remains Cell fluorescence c-secretase assay (Eur J Biochem 270) 503 anchored in the membrane and can therefore not activate the reporter gene transcription We are currently investigating the presence of membrane-anchored c-cleaved CTF in brain cortex of PS1 DE9 carriers, PS1 DE9 lymphocytes and other cell-models Alternatively the intracellular domain could be released in a different compartment, because of altered trafficking of the substrate caused by the PS1 mutation, and is either rapidly degraded or unable to reach the reporter gene In conclusion, these results show that our GFP reporter assays based on APP or Notch c-secretase substrates can be used to specifically study modulation of c-secretase activity in parallel in various cell types Results of the inhibitor study suggest possible differences in the proteolytic activities or pathways that cleave the APP and Notch constructs The use of these parallel assays could facilitate the search for compounds that target APP processing and have a lesser effect on Notch The variations we observed between cell types might reflect physiological differences in protein processing and should be taken into account during the development of therapeutics Our GFP assay allows for direct readout of c-secretase activity without the use of antibodies and could be further developed into high throughput screens These can also be applied to the study of other membrane protein substrates with cleavages regulated by presenilins, such as Erb-B4 [65,66], E-cadherin [67], LRP-receptor [68] and CD44 [69] An advantage of the GFP-based assay is that it facilitates the selection of different cell populations by FACS that vary in their fluorescence intensity This can be used to screen cDNA libraries for genes that modulate c-secretase activity Complete identification and further characterization of this activity is required for a better understanding of the development of Alzheimer’s disease in early and late onset cases Acknowledgments This study was supported by grants from the National Health and Medical Research Council of Australia, the Clive and Vera Ramaciotti Foundation and Merck Sharp and Dohme We thank Drs S Lichtenthaler, G Muscat, H Clarris, C Bergmann, T Hartmann, F Reinhard and A Weidemann for providing DNA-constructs and advice, and Ms F Katsis for protein sequencing We thank Dr M Shearman and Dr M Bogyo for providing inhibitors We thank Drs S Mok, A Hill and N Williamson for helpful discussions References Nunan, J & Small, D.H (2000) Regulation of APP cleavage by a-, b- and c-secretases FEBS Lett 483, 6–10 Selkoe, D.J (2001) Alzheimer’s disease: genes, proteins, and therapy Physiol Rev 81, 741–766 Evin, G & Weidemann, A (2002) Biogenesis and metabolism of Alzheimer’s disease Ab amyloid peptides Peptides 23, 1285–1297 De Strooper, B & Konig, G (1999) Alzheimer’s disease A firm base for drug development Nature 402, 471–472 McLendon, C., Xin, T., Ziani-Cherif, C., Murphy, M.P., Findlay, K.A., Lewis, P.A., Pinnix, I., Sambamurti, K., Wang, R., Fauq, A & Golde, T.E (2000) Cell-free assays for c-secretase activity FASEB J 14, 2383–2386 Pinnix, I., Musunuru, U., Tun, H., Sridharan, A., Golde, T., Eckman, C., Ziani-Cherif, C., Onstead, L & Sambamurti, K 504 M F Sernee et al (Eur J Biochem 270) 10 11 12 13 14 15 16 17 18 19 20 (2001) A novel c-secretase assay based on detection of the putative C-terminal fragment-c of amyloid b protein precursor J Biol Chem 276, 481–487 Yu, C., Kim, S.H., Ikeuchi, T., Xu, H., Gasparini, L., Wang, R & Sisodia, S.S (2001) Characterization of a presenilin-mediated amyloid precursor protein carboxyl-terminal fragment c Evidence for distinct mechanisms involved in c-secretase processing of the APP and Notch1 transmembrane domains J Biol Chem 276, 43756–43760 Weidemann, A., Eggert, S., Reinhard, F.B., Vogel, M., Paliga, K., Baier, G., Masters, C.L., Beyreuther, K & Evin, G (2002) A novel epsilon-cleavage within the transmembrane domain of the Alzheimer amyloid precursor protein demonstrates homology with Notch processing Biochemistry 41, 2825–2835 Lichtenthaler, S., Wang, R., Grimm, H., Uljon, S., Masters, C.L & Beyreuther, K (1999) Mechanism of the cleavage specificty of alzheimer’s disease c-secretase identified by phenylalanine-scanning mutagenesis of the transmembrane domain of the amyloid precursor protein Proc Natl Acad Sci USA 96, 3053–3058 Golde, T.E., Eckman, C.B & Younkin, S.G (2000) Biochemical detection of Ab isoforms: implications for pathogenesis, diagnosis, and treatment of Alzheimer’s disease Biochim Biophys Acta 1502, 172–187 Murphy, M.P., Hickman, L.J., Eckman, C.B., Uljon, S.N., Wang, R & Golde, T.E (1999) c-Secretase, evidence for multiple proteolytic activities and influence of membrane positioning of substrate on generation of amyloid b peptides of varying length J Biol Chem 274, 11914–11923 Fortini, M.E (2001) Notch and presenilin: a proteolytic mechanism emerges Curr Opin Cell Biol 13, 627–634 Esler, W.P., Kimberly, W.T., Ostaszewski, B.L., Ye, W., Diehl, T.S., Selkoe, D.J & Wolfe, M.S (2002) Activity-dependent isolation of the presenilin-c-secretase complex reveals nicastrin and a c substrate Proc Natl Acad Sci USA 99, 2720–2725 Steiner, H., Winkler, E., Edbauer, D., Prokop, S., Basset, G., Yamasaki, A., Kostka, M & Haass, C (2002) PEN-2 is an integral component of the c-secretase complex required for coordinated expression of presenilin and nicastrin J Biol Chem 277, 39062–39065 Goutte, C., Tsunozaki, M., Hale, V.A & Priess, J.R (2002) APH1 is a multipass membrane protein essential for the Notch signaling pathway in Caenorhabditis elegans embryos Proc Natl Acad Sci USA 99, 775–779 Francis, R., McGrath, G., Zhang, J., Ruddy, D.A., Sym, M., Apfeld, J., Nicoll, M., Maxwell, M., Hai, B., Ellis, M.C., Parks, A.L., Xu, W., Li, J., Gurney, M., Myers, R.L., Himes, C.S., Hiebsch, R., Ruble, C., Nye, J.S & Curtis, D (2002) aph-1 and pen-2 are required for Notch pathway signaling, c-secretase cleavage of bAPP, and presenilin protein accumulation Dev Cell 3, 85–97 Lee, S.F., Shah, S., Li, H., Yu, C., Han, W.G & Yu, G (2002) Mammalian APH-1 interacts with presenilin and nicastrin, and is required for intramembrane proteolysis of APP and Notch J Biol Chem 277, 45013–45019 Wolfe, M.S., Xia, W., Ostaszewski, B.L., Diehl, T.S., Kimberly, W.T & Selkoe, D.J (1999) Two transmembrane aspartates in presenilin-1 required for presenilin endoproteolysis and c-secretase activity Nature 398, 513–517 Steiner, H., Duff, K., Capell, A., Romig, H., Grim, M.G., Lincoln, S & Hardy, J., Yu, X., Picciano, M., Fechteler, K., Citron, M., Kopan, R., Pesold, B., Keck, S., Baader, M., Tomita, T., Iwatsubo, T., Baumeister, R & Haass, C (1999) A loss of function mutation of presenilin-2 interferes with amyloid b-peptide production and notch signalling J Biol Chem 274, 28669–28673 Levitan, D & Greenwald, I (1995) Facilitation of lin-12-mediated signalling by sel-12, a Caenorhabditis elegans S182 Alzheimer’s disease gene Nature 377, 351–354 Ó FEBS 2003 21 De Strooper, B., Annaert, W., Cupers, P., Saftig, P., Craessaerts, K., Mumm, J.S., Schroeter, E.H., Schrijvers, V., Wolfe, M.S., Ray, W.J., Goate, A & Kopan, R (1999) A presenilin-1-dependent gamma-secretase-like protease mediates release of Notch intracellular domain Nature 398, 518–522 22 Chan, Y.M & Jan, Y.N (1999) Presenilins, processing of betaamyloid precursor protein, and notch signaling Neuron 23, 201–204 23 Kopan, R & Goate, A (2000) A common enzyme connects notch signaling and Alzheimer’s disease Genes Dev 14, 2799– 2806 24 Okochi, M., Steiner, H., Fukumori, A., Tanii, H., Tomita, T., Tanaka, T., Iwatsubo, T., Kudo, T., Takeda, M & Haass, C (2002) Presenilins mediate a dual intramembranous gammasecretase cleavage of Notch-1 EMBO J 21, 5408–5416 25 Mumm, J.S & Kopan, R (2000) Notch signaling: from the outside in Dev Biol 228, 151–165 26 Muscat, G.E., Downes, M & Dowhan, D.H (1995) Regulation of vertebrate muscle differentiation by thyroid hormone: the role of the myoD gene family Bioessays 17, 211–218 27 Lillie, J.W & Green, M.R (1989) Transcription activation by the adenovirus E1a protein Nature 338, 39–44 28 Christie, G., Markwell, R.E., Gray, C.W., Smith, L., Godfrey, F., Mansfield, F., Wadsworth, H., King, R., McLaughlin, M., Cooper, D.G., Ward, R.V., Howlett, D.R., Hartmann, T., Lichtenthaler, S.F., Beyreuther, K., Underwood, J., Gribble, S.K., Cappai, R., Masters, C.L., Tamaoka, A., Gardner, R.L., Rivett, A.J., Karran, E.H & Allsop, D (1999) Alzheimer’s disease: correlation of the suppression of beta-amyloid peptide secretion from cultured cells with inhibition of the chymotrypsin-like activity of the proteasome J Neurochem 73, 195–204 29 Ida, N., Hartmann, T., Pantel, J., Schroder, J., Zerfass, R., Forstl, H., Sandbrink, R., Masters, C.L & Beyreuther, K (1996) Analysis of heterogeneous A4 peptides in human cerebrospinal fluid and blood by a newly developed sensitive Western blot assay J Biol Chem 271, 22908–22914 30 Culvenor, J.G., Evin, G., Cooney, M.A., Wardan, H., Sharples, R.A., Maher, F., Reed, G., Diehlmann, A., Weidemann, A., Beyreuther, K & Masters, C.L (2000) Presenilin expression in neuronal cells: induction during differentiation of embryonic carcinoma cells Exp Cell Res 255, 192–206 31 Nunan, J., Shearman, M.S., Checler, F., Cappai, R., Evin, G., Beyreuther, K., Masters, C.L & Small, D.H (2001) The C-terminal fragment of the Alzheimer’s disease amyloid protein precursor is degraded by a proteasome-dependent mechanism distinct from c-secretase Eur J Biochem 268, 5329–5336 32 Shearman, M.S., Beher, D., Clarke, E.E., Lewis, H.D., Harrison, T., Hunt, P., Nadin, A., Smith, A.L., Stevenson, G & Castro, J.L (2000) L-685,458, an aspartyl protease transition state mimic, is a potent inhibitor of amyloid b-protein precursor c-secretase activity Biochemistry 39, 8698–8704 33 Li, Y.M., Xu, M., Lai, M.T., Huang, Q., Castro, J.L., DiMuzioMower, J., Harrison, T., Lellis, C., Nadin, A., Neduvelil, J.G., Register, R.B., Sardana, M.K., Shearman, M.S., Smith, A.L., Shi, X.P., Yin, K.C., Shafer, J.A & Gardell, S.J (2000) Photoactivated c-secretase inhibitors directed to the active site covalently label presenilin Nature 405, 689–694 34 Wolfe, M.S., Citron, M., Diehl, T.S., Xia, W., Donkor, I.O & Selkoe, D.J (1998) A substrate-based difluoro ketone selectively inhibits Alzheimer’s c-secretase activity J Med Chem 41, 6–9 35 Weihofen, A., Lemberg, M.K., Ploegh, H.L., Bogyo, M & Martoglio, B (2000) Release of signal peptide fragments into the cytosol requires cleavage in the transmembrane region by a protease activity that is specifically blocked by a novel cysteine protease inhibitor J Biol Chem 275, 30951–30956 Ó FEBS 2003 36 Lichtenthaler, S.F., Multhaup, G., Masters, C.L & Beyreuther, K (1999) A novel substrate for analyzing Alzheimer’s disease c-secretase FEBS Lett 453, 288–292 37 Lichtenthaler, S.F., Beher, D., Grimm, H.S., Wang, R., Shearman, M.S., Masters, C.L & Beyreuther, K (2002) The intramembrane cleavage site of the amyloid precursor protein depends on the length of its transmembrane domain Proc Natl Acad Sci USA 99, 1365–1370 38 Pellegrini, L., Passer, B.J., Tabaton, M., Ganjei, J.K & D’Adamio, L (1999) Alternative, non-secretase processing of Alzheimer’s beta-amyloid precursor protein during apoptosis by caspase-6 and -8 J Biol Chem 274, 21011–21016 39 Weidemann, A., Paliga, K., Durrwang, U., Reinhard, F.B.M., Schuckert, O., Evin, G & Masters, C (1999) Proteolytic processing of the Alzheimer’s disease amyloid precursor protein within its cytoplasmic domain by caspase-like proteases J Biol Chem 274, 5823–5829 40 Gervais, F.G., Xu, D., Robertson, G.S., Vaillancourt, J.P., Zhu, Y., Huang, J., LeBlanc, A., Smith, D., Rigby, M., Shearman, M.S., Clarke, E.E., Zheng, H., Van Der Ploeg, L.H., Ruffolo, S.C., Thornberry, N.A., Xanthoudakis, S., Zamboni, R.J., Roy, S & Nicholson, D.W (1999) Involvement of caspases in proteolytic cleavage of Alzheimer’s amyloid-b precursor protein and amyloidogenic A beta peptide formation Cell 97, 395–406 41 Koo, E.H & Squazzo, S.L (1994) Evidence that production and release of amyloid b-protein involves the endocytic pathway J Biol Chem 269, 17386–17389 42 Sadowski, I., Ma, J., Triezenberg, S & Ptashne, M (1988) GAL4VP16 is an unusually potent transcriptional activator Nature 335, 563–564 43 Brown, M.S., Ye, J., Rawson, R.B & Goldstein, J.L (2000) Regulated intramembrane proteolysis: a control mechanism conserved from bacteria to humans Cell 100, 391–398 44 Mumm, J.S., Schroeter, E.H., Saxena, M.T., Griesemer, A., Tian, X., Pan, D.J., Ray, W.J & Kopan, R (2000) A ligand-induced extracellular cleavage regulates c-secretase-like proteolytic activation of Notch1 Mol Cell 5, 197–206 45 Bunnell, W.L., Pham, H.V & Glabe, C.G (1998) gamma-secretase cleavage is distinct from endoplasmic reticulum degradation of the transmembrane domain of the amyloid precursor protein J Biol Chem 273, 31947–31955 46 Gu, Y., Misonou, H., Sato, T., Dohmae, N., Takio, K & Ihara, Y (2001) Distinct intramembrane cleavage of the beta-amyloid precursor protein family resembling c-secretase-like cleavage of Notch J Biol Chem 276, 35235–35238 47 Sastre, M., Steiner, H., Fuchs, K., Capell, A., Multhaup, G., Condron, M.M., Teplow, D.B & Haass, C (2001) Presenilindependent c-secretase processing of b-amyloid precursor protein at a site corresponding to the S3 cleavage of Notch EMBO Rep 2, 835–841 48 Kimberly, W.T., LaVoie, M.J., Ostaszewski, B.L.Ye, W., Wolfe, M.S & Selkoe, D.J (2002) Complex N-linked glycosylated Nicastrin associates with active c-secretase and undergoes tight cellular regulation J Biol Chem 277, 35113–35117 49 Ponting, C.P., Hutton, M., Nyborg, A., Baker, M., Jansen, K & Golde, T.E (2002) Identification of a novel family of presenilin homologues Hum Mol Genet 11, 1037–1044 50 Weihofen, A., Binns, K., Lemberg, M.K., Ashman, K & Martoglio, B (2002) Identification of signal peptide peptidase, a presenilin-type aspartic protease Science 296, 2215–2218 51 Perez-Tur, J., Froelich, S., Prihar, G., Crook, R., Baker, M., Duff, K., Wragg, M., Busfield, F., Lendon, C., Clark, R.F.& et al (1995) A mutation in Alzheimer’s disease destroying a splice acceptor site in the presenilin-1 gene Neuroreport 7, 297–301 52 Steiner, H., Romig, H., Grim, M.G., Philipp, U., Pesold, B., Citron, M., Baumeister, R & Haass, C (1999) The biological and Cell fluorescence c-secretase assay (Eur J Biochem 270) 505 53 54 55 56 57 58 59 60 61 62 63 64 65 66 pathological function of the presenilin-1 Deltaexon mutation is independent of its defect to undergo proteolytic processing J Biol Chem 274, 7615–7618 Karlstrom, H., Bergman, A., Lendahl, U., Naslund, J & Lundkvist, J (2002) A sensitive and quantitative assay for measuring cleavage of presenilin substrates J Biol Chem 277, 6763– 6766 Taniguchi, Y., Karlstrom, H., Lundkvist, J., Mizutani, T., Otaka, A., Vestling, M., Bernstein, A., Donoviel, D., Lendahl, U & Honjo, T (2002) Notch receptor cleavage depends on but is not directly executed by presenilins, Proc Natl Acad Sci USA 99, 4014–4019 Deroo, B.J & Archer, T.K (2002) Proteasome inhibitors reduce luciferase and b-galactosidase activity in tissue culture cells J Biol Chem 277, 20120–20123 Wolfe, M.S., Xia, W., Moore, C.L., Leatherwood, D.D., Ostaszewski, B., Rahmati, T., Donkor, I.O & Selkoe, D.J (1999) Peptidomimetic probes and molecular modeling suggest that Alzheimer’s c-secretase is an intramembrane-cleaving aspartyl protease Biochemistry 38, 4720–4727 Beher, D., Wrigley, J.D., Owens, A.P & Shearman, M.S (2002) Generation of C-terminally truncated amyloid-beta peptides is dependent on c-secretase activity J Neurochem 82, 563–575 Steiner, H., Capell, A., Pesold, B., Citron, M., Kloetzel, P.M., Selkoe, D.J., Romig, H., Mendla, K & Haass, C (1998) Expression of Alzheimer’s disease-associated presenilin-1 is controlled by proteolytic degradation and complex formation J Biol Chem 273, 32322–32331 Kim, S.H., Leem, J.Y., Lah, J.J., Slunt, H.H., Levey, A.I., Thinakaran, G & Sisodia, S.S (2001) Multiple effects of aspartate mutant presenilin on the processing and trafficking of amyloid precursor protein J Biol Chem 276, 43343–43350 Yu, G., Chen, F., Nishimura, M., Steiner, H., Tandon, A., Kawarai, T., Arawaka, S., Supala, A., Song, Y.Q., Rogaeva, E., Holmes, E., Zhang, D.M., Milman, P., Fraser, P.E., Haass, C & George-Hyslop, P.S (2000) Mutation of conserved aspartates affects maturation of both aspartate mutant and endogenous presenilin and presenilin complexes J Biol Chem 275, 27348– 27353 Yu, G., Chen, F., Nishimura, M., Steiner, H., Tandon, A., Kawarai, T., Arawaka, S., Supala, A., Song, Y.Q., Rogaeva, E., Holmes, E., Zhang, D.M., Milman, P., Fraser, P., Haass, C & St George-Hyslop, P (2000) Mutation of conserved aspartates affect maturation of presenilin and presenilin complexes Acta Neurol Scand Suppl 176, 6–11 Chen, F., Gu, Y., Hasegawa, H., Ruan, X., Arawaka, S., Fraser, P., Westaway, D., Mount, H & St George-Hyslop, P (2002) Presenilin mutations activate c 42-secretase but reciprocally inhibit epsilon-secretase cleavage of APP and S3-cleavage of notch J Biol Chem 277, 36521–36526 Kulic, L., Walter, J., Multhaup, G., Teplow, D.B., Baumeister, R., Romig, H., Capell, A., Steiner, H & Haass, C (2000) Separation of presenilin function in amyloid b-peptide generation and endoproteolysis of Notch Proc Natl Acad Sci USA 97, 5913– 5918 Tian, G., Sobotka-Briner, C.D., Zysk, J., Liu, X., Birr, C., Sylvester, M.A., Edwards, P.D., Scott, C.D & Greenberg, B.D (2002) Linear non-competitive inhibition of solubilized human c-secretase by pepstatin A methylester, L-685458, sulfonamides and benzodiazepines J Biol Chem 277, 31499 Ni, C.Y., Murphy, M.P., Golde, T.E & Carpenter, G (2001) c-Secretase cleavage and nuclear localization of ErbB-4 receptor tyrosine kinase Science 294, 2179–2181 Lee, H.J., Jung, K.M., Huang, Y.Z., Bennett, L.B., Lee, J.S., Mei, L & Kim, T.W (2001) Presenilin-dependent c-secretase-like intramembrane cleavage of ErbB4 J Biol Chem 277, 6318–6323 506 M F Sernee et al (Eur J Biochem 270) 67 Marambaud, P., Shioi, J., Serban, G., Georgakopoulos, A., Sarner, S., Nagy, V., Baki, L., Wen, P., Efthimiopoulos, S., Shao, Z., Wisniewski, T & Robakis, N.K (2002) A presenilin-1/c-secretase cleavage releases the E-cadherin intracellular domain and regulates disassembly of adherens junctions EMBO J 21, 1948–1956 68 May, P., Reddy, Y.K & Herz, J (2002) Proteolytic processing of low density lipoprotein receptor-related protein mediates regu- Ó FEBS 2003 lated release of its intracellular domain J Biol Chem 277, 18736– 18743 69 Lammich, S., Okochi, M., Takeda, M., Kaether, C., Capell, A., Zimmer, A.K., Edbauer, D., Walter, J., Steiner, H & Haass, C (2002) Presenilin dependent intramembrane proteolysis of CD44 leads to the liberation of its intracellular domain and the secretion of an Ab-like peptide J Biol Chem 277, 44754–44759  ... E.H & Allsop, D ( 199 9) Alzheimer’s disease: correlation of the suppression of beta-amyloid peptide secretion from cultured cells with inhibition of the chymotrypsin-like activity of the proteasome... for 72 h with various concentrations of inhibitor in a final dimethylsulfoxide concentration of 0.5% After 24 h the medium was replaced with fresh medium containing inhibitor Inhibition of c-secretase. .. degradation [7,8,46–48] Immunoprecipitation of conditioned media from these cells with WO2 and 1E8 mAbs showed Ab secretion Immunoprecipitation with Ab C-terminal specific antibodies demonstrated