0

a recent dutch microorganism a j keij with the description of jankeijcythere new genus crustacea ostracoda

evolutionary biology of ostracoda

evolutionary biology of ostracoda

Sinh học

... Microorganism (A J Keij) , with the Description of Jankeijcgthere New Genus (Crustacea, Ostracoda) KENNETH MCKENZIE G Riverina-Murray Institute of Higher Education, Wagga Wagga, Australia ABSTRACT The ... Shizuoka, Japan Inoue, H., Tokyo, Japan Ishizaki, K., Sendai, Japan Iwasaki, Y., Kumamoto, Japan K Kaesler, R.L., Lawrence, Kansas, U.S .A Kamiya, T., Kanazawa, Japan Keen, M.C., Glasgow, Scotland, ... Shanghai, P.R China Participants A Abe, K., Tokyo, Japan Adachi, S., Tsukuba, Japan Adamczak, F J. , Stockholm, Sweden Al-Furaih, Ali A F., Riyadh, Saudi Arabia Athersuch, J. , Sunbury, England, U.K B...
  • 1,373
  • 2,110
  • 0
Cornell University Program on Breast Cancer and Environmental Risk Factors in New York State (BCERF) pptx

Cornell University Program on Breast Cancer and Environmental Risk Factors in New York State (BCERF) pptx

Sức khỏe giới tính

... on overall health are beneficial Does smoking marijuana affect breast cancer risk? The relationship between smoking marijuana and breast cancer risk has not been studied Marijuana smoke has been ... both increase and decrease breast cancer risk On one hand, tobacco smoke contains chemicals that can cause breast cancer in animals and could thus be associated with an increase in breast cancer ... smoking may lead to a temporary increase in breast cancer risk Most of the studies that have examined the breast cancer risk of women who have quit smoking have reported an increase in breast cancer...
  • 5
  • 443
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "EXPERT SYSTEMS AND OTHER NEW TECHNIQUES IN MT SYSTEMS " ppt

Báo cáo khoa học

... poisonous The analyzer takes "beaker" instead of" water" as antecedent of "which" The corrector may know that chlorine combines with water, and not with a beaker "La preparation d~gage la vapeur dangereuse ... constructions of the target language, with all other information contained in the dictionary constructed in a similar way for the target language For lack of space, we cannot include examples In his recent ... research in automatic program generation Starting from this analogy, a group of researchers at GETA have recently embarked on a project which could converge with still another line of software...
  • 4
  • 439
  • 0
STUDIES ON THE ECOLOGY AND CONSERVATION OF BUTTERFLIES IN EUROPE: Vol. 1: General Concepts and Case Studies pptx

STUDIES ON THE ECOLOGY AND CONSERVATION OF BUTTERFLIES IN EUROPE: Vol. 1: General Concepts and Case Studies pptx

Cao đẳng - Đại học

... have been located on the banks of lakes, 10(9%) on the coastal area of the Baltic Sea and all the rest (91; 78%) on the riparian areas of the rivers The dominating land cover type was meadow with ... records There are three main centres of Clouded Apollo in Estonia: the population of the island of Saaremaa, and the North-Estonian and the South-Estonian populations (Figure 1) The Saaremaa population ... types of habitats of Clouded Apollo was made on the basis of the digital cadastral map For analysis, only these data were used, where it was possible to determine the exact location of the Clouded...
  • 141
  • 558
  • 0
On the process and aesthetics of sampling in electronic music production* ppt

On the process and aesthetics of sampling in electronic music production* ppt

Chụp ảnh - Quay phim

... manufacturers (i.e Yamaha, E-mu, Akai) offer several samplers at a range of price points Software samplers tend to be priced lower, and, compared to their hardware competitors, emphasise visual ... He fails to acknowledge that sampling is a creative process, and that the so-called tactics of ‘stealing’ and ‘pastiche’ are musically and politically constructive, capable of encompassing a complex ... mixed with a totally unbounded frame of what you can make there, and I like that (Rodgers 200 2a) Perhaps the more important question, then, is what is at stake with perceived automation and loss of...
  • 8
  • 722
  • 0
báo cáo hóa học:

báo cáo hóa học: "The impact of regular physical activity on fatigue, depression and quality of life in persons with multiple sclerosis" pot

Hóa học - Dầu khí

... Alonso-Hernandez A, ValdesCanedo F, Rebollo-Alvarez P: Validity and reliability of the SF-36 questionnaire in patients on the waiting list for a kidney transplant and transplant patients Am J ... 15(4):412-421 Trojan D, Arnold D, Collet JP, Shapiro S, Bar-Or A, Robinson A, Le Cruguel JP, Ducruet T, Narayanan S, Arcelin K, Wong AN, Tartaglia MC, Lapierre Y, Caramanos Z, Da Costa D: Fatigue in ... eral assessment of fatigue Higher scores indicate that fatigue has a greater impact on the individual The MFIS has been suggested as a useful measure of fatigue in MS research and clinical practice...
  • 10
  • 683
  • 0
báo cáo hóa học:

báo cáo hóa học: " The effects of high frequency subthalamic stimulation on balance performance and fear of falling in patients with Parkinson''''s disease" docx

Điện - Điện tử

... in an armchair (seat height of 46 cm) with the back against the chair and arms resting on the chair's arms The instruction "Go'' initiates the subject to stand up and walk at a comfortable (preferred) ... the manuscript PAF participated in collecting posturographic data, assisted in data analysis and in drafting the manuscript GBJ participated in the design of the study and helped draft the manuscript ... as sampling of force platform data Calculations and Statistical analysis Group results are given as medians with the first and third quartiles (q1–q3), and/or ranges In order to investigate the...
  • 10
  • 487
  • 0
báo cáo hóa học:

báo cáo hóa học:" The impact of regular physical activity on fatigue, depression and quality of life in persons with multiple sclerosis" pdf

Hóa học - Dầu khí

... Alonso-Hernandez A, ValdesCanedo F, Rebollo-Alvarez P: Validity and reliability of the SF-36 questionnaire in patients on the waiting list for a kidney transplant and transplant patients Am J ... 15(4):412-421 Trojan D, Arnold D, Collet JP, Shapiro S, Bar-Or A, Robinson A, Le Cruguel JP, Ducruet T, Narayanan S, Arcelin K, Wong AN, Tartaglia MC, Lapierre Y, Caramanos Z, Da Costa D: Fatigue in ... eral assessment of fatigue Higher scores indicate that fatigue has a greater impact on the individual The MFIS has been suggested as a useful measure of fatigue in MS research and clinical practice...
  • 10
  • 440
  • 0
Section 1:Influence of harvesting time around grain maturity on rice cracking and head rice yield in the Mekong River Delta of Vietnam

Section 1:Influence of harvesting time around grain maturity on rice cracking and head rice yield in the Mekong River Delta of Vietnam " pdf

Báo cáo khoa học

... total mass of paddy rice The head rice is composed of grains which maintain at least 75% of their length after milling Statistical analysis Data were analysed by statistical software Statgraphics® ... during the collection of data was harvesting time- before and after grain maturity The objective of this experiment was to evaluate the effects of harvesting time of several rice varieties on the ... 1.4 7a 3.4 7a 0.6 7a 3.7 3a 2.5 3a 1.3 3a 6.5 0a 1.47b 0.4 0a 0.6 7a 2.0 0a 10.27b 1.7 3a 1.0 7a 3.73ab 0.1 3a 18.17bc 1.60b 1.2 0a 6.27b 3.6 0a 15.73bc 3.3 3a 1.4 7a 3.87ab 1.6 0a 16.44bc 1.07b 2.8 0a 2.0 0a 5.73a...
  • 12
  • 400
  • 0
EARTHQUAKE RESEARCH AND ANALYSIS – NEW FRONTIERS IN SEISMOLOGY pot

EARTHQUAKE RESEARCH AND ANALYSIS – NEW FRONTIERS IN SEISMOLOGY pot

Điện - Điện tử

... times larger than healing slip velocities Rake and spatial and temporal rake variations scale amplitudes as a function of azimuth and take-off angle Rake spatial and temporal variations over a fault ... ities are typically several times larger than healing slip velocities Rake and spatial and temporal rake variations scale amplitudes as a function of azimuth and take-off angle Rake spatial and ... a mathematical model that needs five parameters, called hereafter dilatancy parameters, to take into account this correlation These parameters represent the initial and final phases of dilatancy,...
  • 392
  • 181
  • 0
EARTHQUAKE RESEARCH AND ANALYSIS – NEW FRONTIERS IN SEISMOLOGY potx

EARTHQUAKE RESEARCH AND ANALYSIS – NEW FRONTIERS IN SEISMOLOGY potx

Điện - Điện tử

... times larger than healing slip velocities Rake and spatial and temporal rake variations scale amplitudes as a function of azimuth and take-off angle Rake spatial and temporal variations over a fault ... ities are typically several times larger than healing slip velocities Rake and spatial and temporal rake variations scale amplitudes as a function of azimuth and take-off angle Rake spatial and ... a mathematical model that needs five parameters, called hereafter dilatancy parameters, to take into account this correlation These parameters represent the initial and final phases of dilatancy,...
  • 392
  • 201
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Modulatory effects of chitosan adipate on the T and B lymphocyte subsets in mice" pps

Báo cáo khoa học

... erew sesac lla dna ,nairaniretev a yb noitatlucsua lanimodba nopu dnuos gnignip a yb desongaid saw tnemecalpsid lasamobA mutraptsop skeew nihtiw denrecnoc remraf eht ro/dna nairaniretev a yb devresbo ... laetul( kciht mm naht retaerg llaw a htiw ro )tsyc ralucillof( kciht mm naht ssel llaw a htiw retemaid lanretni mm 52 naht regral fo serutcurts nairavo no desab erew snoitaulave cihpargonosartlU ... ytilibitpecsus esaercni thgim ]02[ ytirap gnicnavda htiw detaicossa noitcnuf lihportuen fo tnemriapmi tneirutrapirep dnuoforp ,revoeroM gnidnif tnatropmi na sa slamina ytirap hgih ni atnecalp deniater a fo...
  • 6
  • 351
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Influence of marine salts on the localization and accumulation of surfactant in the needles of Pinus halepensis Mill" ppsx

Báo cáo khoa học

... foliage volume due to the early loss of leaves Typically, the leaf tips turn brown and a premature leaf abscission occurs on the seaward side of the trees Serious damage may lead to the death of ... total activity (%TA) incorporated into the different sampled fractions of the plant was calculated as follows: A coefficient of LABS accumulation in waxes, between epicuticular wax and water, was ... waxes and finally iv) diffusion across cell walls and accumulation in cytoplasm of epidermal cells The fraction of LABS found in the distilled water wash may be the fraction of LABS associated with...
  • 10
  • 399
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Influence of on cutting methods and dates stump sprouting in Holm oak (Quercus ilex L) coppice" pdf

Báo cáo khoa học

... shoots, mean shoot girth, mean shoot basal area, total basal area of the stool and length of longest shoot of the stool (table VI) Only data from chain saw at ground level cuttings were investigated ... not as individuals but as a part of a whole stool It was sometimes difficult to determine what stool a shoot belong to This may explain great data variability in the 2-way variance analysis (table ... time The studied stand is part of compartment 10 of this forest and has an area of 0.7 In 1985, the inventory revealed an average age of 30 years for the compartment Preceding coppicings, around...
  • 16
  • 281
  • 0
báo cáo khoa học:

báo cáo khoa học: " Effects of DNMT1 silencing on malignant phenotype and methylated gene expression in cervical cancer cells" pdf

Báo cáo khoa học

... R:5’CTGGTCCTGGTATGAAGAATG3’ F:5’GCGTAGAAATGCCCAAACC3’ R:5’TCCATCCAGCCCGAGTAGC3’ F:5’GGCCTCTTGATGTTGACTGTAA3’ R:5’GAGGGATGGGTGATGAGGA3’ 59 299 59 233 59 157 59 171 59 204 PAX1 F:5’GGTAGGAGTAGGGAGCACAGG3’ ... Product Size(bp) F:5’GAAAGCCATAGTGACAGTAACCC3’ R:5’AAAGCCAAAGATTGTGCGATT3’ 59 121 F:5’CTCCCGAGCCAGGGTTCT3’ R:5’CGTTCTCCCAACAGCCGC3’ 59 76 PTEN F:5’GAGCGAATGCAGTCCACG3’ R:5’AGGCAGGGTAGGCTGTTGT3’ 59 ... in RNA expression gene QPCR Sequences Tm (°C) Product Size(bp) F:5’GGGAAACTGTGGCGTGAT3’ R:5’GAGTGGGTGTCGCTGTTGA3’ F:5’GGAGATCAGAGGAGGAAATGG3’ R:5’GGGAGTTGGAGTGACCGAG3’ F:5’ACACGACGGGAAGACAAGTT3’...
  • 8
  • 494
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Influence of Ileo-Caecal Cannulation and Oxytetracycline on Ileo-Caecal and Rectal Coliform Populations in Pigs" potx

Báo cáo khoa học

... 3:30 pm The pigs were fed at a level of 4% of the mean live weight of the group Water was available ad libitum The health status of the animals was inspected at least twice daily and special attention ... (StresnilTM, Jansson & Cilag pharma, Wien, Austria) Within 30 anaesthesia was induced and maintained by inhalation of O2 and halothane Post surgery the pigs were intramuscularily injected once with a long ... Finland) after 4, 7, 24 and 48 h of incubation at 37°C The mean value of all readings was taken as the metabolic fingerprint for each isolate, and a dendrogram was constructed after pairwise comparison...
  • 6
  • 272
  • 0
Báo cáo y học:

Báo cáo y học: "Effects of simulated altitude (normobaric hypoxia) on cardiorespiratory parameters and circulating endothelial precursors in healthy subjects" potx

Báo cáo khoa học

... significant Blood sampling and analysis of Endothelial Precursors A 10 ml PB-sample was obtained from all subjects at each time studied: before (T0) and at the end of the experimental hypoxia (T1), and ... to the design of the research, analyzed data, and critically revised the paper; AP, MC, IS, EM, ER, MZ, and FG performed research; RP analyzed data, wrote and critically revised the paper; AC ... specimens at 400 × magnification, using an objective Plan APO VC (N .A 1.40) Analysis of the images was performed according to a previously described procedure [19] Statistical analysis Data obtained...
  • 8
  • 252
  • 0
Báo cáo y học:

Báo cáo y học: " Differential effects of cigarette smoke on oxidative stress and proinflammatory cytokine release in primary human airway epithelial cells and in a variety of transformed alveolar epithelial cells" potx

Báo cáo khoa học

... with no or little evidence of apoptosis in primary human small airway epithelial cells (SAEC) Primary human small airway epithelial cells (SAEC) were treated with media alone (control) and various ... on oxidative stress and proinflammatory cytokine release in primary human airway epithelial cells and in a variety of transformed alveolar epithelial cells Respir Res 2006, 7:132 Publish with Bio ... &LJDUHWWH VPRNH H[WUDFW Figure (SAEC) smoke extract caused necrosis with no or little evidence of apoptosis in primary human small airway epithelial cells Cigarette Cigarette smoke extract caused...
  • 3
  • 307
  • 0
Báo cáo y học:

Báo cáo y học: " Differential effects of cigarette smoke on oxidative stress and proinflammatory cytokine release in primary human airway epithelial cells and in a variety of transformed alveolar epithelial cells" pps

Báo cáo khoa học

... 111:476-494 Rahman I, Biswas SK, Kode A: Oxidant and antioxidant balance in the airways and airway diseases Eur J Pharmacol 2006, 533:222-239 Marwick JA, Kirkham PA, Stevenson CS, Danahay H, Giddings J, ... Cigarette smoke extract differentially caused cytotoxicity in a variety of alveolar epithelial cells and in primary human small airway epithelial cells A Various alveolar epithelial cells such as ... study along with the primary human small airway epithelial cells (SAEC) The sources of various cell lines were as follows: the human adenocarcinoma epithelial cells (A5 49) derived from lungs of adenocarcinoma...
  • 20
  • 478
  • 0
Báo cáo y học:

Báo cáo y học: "nfluence of atorvastatin on coronary calcifications and myocardial perfusion defects in systemic lupus erythematosus patients: a prospective, randomized, double-masked, placebo-controlled study" docx

Báo cáo khoa học

... interpretation of the data, and manuscript preparation KG, HD, LTP, and MK acquired and analyzed the data PP and JM were responsible for data interpretation and manuscript preparation All authors read ... atorvastatin group, but remained unchanged in the placebo group (Table 5) There was no change in the activity of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) nor creatine ... Abbreviations aCL: anticardiolipin antibodies; ANA: antinuclear antibodies; ALT: alanine aminotransferase; APS: antiphospholipid syndrome; AST: aspartate aminotransferase; CPK: creatine phosphokinase;...
  • 9
  • 262
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose