a quantitatively unstable model to evaluate the biological effects of mechanical forces on spine fusion
guide to the design, selection, and application of screw feeders
... valid design figures from a database The authentication of samples and their bounds of variation for a particular project of application is a crucial feature when contractual performance guarantees ... this condition of liquor content a portion of the voidage space is occupied by ambient gas, and the material may be compacted by the application of vibration and/or the application of external stresses ... special conditions apply to considerations of power, intermediate bearings, and the influence of apparently minor variations and features of construction Design variants can accommodate many of these...
- 178
- 524
- 0
báo cáo khoa học: " Inadvertent malposition of a permanent pacemaker ventricular lead into the left ventricle which was initially missed and diagnosed two years later: a case report" pptx
... in the absence of anticoagulation therapy [13] Case presentation A 60-year-old Caucasian man was admitted to hospital for new-onset of atrial fibrillation Normal sinus rhythm was achieved after ... ventricular pacing (A pace-V sense) because of programmed, managed ventricular pacing (AAI ↔ DDD) at a heart rate of 60 beats/min The patient was discharged to home and was prescribed warfarin therapy ... leave the pacing wire in place and continue lifelong warfarin therapy To date, 40 months after insertion of the pacemaker, the patient remains asymptomatic with no manifestations suggestive of...
- 5
- 235
- 0
A study on syntactic and pragmatic features of insertion sequence in english and vietnamese
... second parts of the pair must be appropriately matched to each other It means that all the pairs whether they are adjacency or insertion ones contribute to the coherence and make the conversation ... is a sequence of two utterances by different Sps in conversation The utterance of the first part immediately creates an expectation of the utterance of the second part of the same pair The second ... two persons talk to each other, one speaks after another and there is an exchange between their turns, which makes up a conversation, one of the most popular kinds of communication A speaker (Sp)...
- 26
- 1,297
- 4
Tài liệu BALL SCREW DRIVE SYSTEMS: EVALUATION OF AXIAL AND TORSIONAL DEFORMATIONS docx
... mode has axial and angular deformations, it is important to classify the vibration modes either as axial or torsional, according to the predominant deformation The knowledge of each mode character ... increases considerably, whereas the axial decreases and the axial displacement of the carriage is substantially lower Nevertheless, the axial mode function amplitude has a significant value This agrees ... as the transmission ratio increases a) Axial component b) Angular component Figure : Axial an Angular components of the mode functions Finally, in the fourth mode, the amplitude of the angular...
- 13
- 542
- 1
Tài liệu Báo cáo khoa học: Switching of the homooligomeric ATP-binding cassette transport complex MDL1 from post-translational mitochondrial import to endoplasmic reticulum insertion pptx
... Sitea p1(f) GGTACCACTAGTGCCGCCACCATGGTTGTAAGAAT GATACGTCTTTGTAAAGG GCCGCCACCATGCAATCAGACATTGCGCAAGGAAA GAAGTCC GCCGCCACCATGCACCATCACCATCACCATCACCAT CACCATCAATCAGACATTGCGCAAGGAAAGAAGTCC GGCCACTATCGATGCATCAGATG ... GCAACACTATTGTCC GCCACTAGTTGGAGCCCTTCC GGCACTAGTATGCAATCAGACATTGCG CCATCAGGAAGCGGCGCATCAACAATTG CGTCTTTG CTTATTTTAGATCAAGCAACCAGTGCC CTATATCAATTGCAGCGAGGCTTTCGACG AAATTGACTTCCGTAATGATG GGTGAACACGTTTCCGCTGTCGGTCCATCAGG ... GGCCACTATCGATGCATCAGATG CATCTGATGCATCGATAGTGGCC GTGTTTGGGCCGAGTGGGAT GCCATTGATTCGTCCGACTA TCTAGAAAGCTTTTATACTTCCCGGGCAACACTATT GTCC TCTAGAAAGCTTTTAGTGATGGTGATGGTGATGGTG ATGCCGCCCTTCGATGCCGCCGCCGCCTACTTCCCGG...
- 13
- 615
- 0
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc
... TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined), then a secondary amplification with primers 5¢-CACCAC CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢ ... Insertion of Chlamydomonas reinhardtii PSI-G into thylakoids (Lanes as in panel A) Alignment of the loop region of Arabidopsis and Chlamydomonas PSI-G Positively charged amino acids are shown in italics ... CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCG AAAAAGAAGCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined) and 5¢-GCGGCATGCTCATCCAAAGAAGC TTGGGTCG-3¢ The two amplified fragments were used as a combined...
- 9
- 422
- 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt
... that the conformational space of b-amino acids is larger than that of a- amino acids, but low-energy conformations of the b-amino acids backbone, corresponding to gauche rotamers around the Ca–Cb ... corresponding to h 180°, cannot overlap any conformation of a- amino acids In order to visualize on the potential energy surfaces the conformers of b-amino acids that fit with canonical conformations ... calculations the conformers of Ac-HGly-NHMe, Ac-b2-HAla-NHMe and Ac-b3-HAlaNHMe have been generated and compared to the canonical structures of the corresponding a- amino acid Ac-Gly-NHMe The corresponding...
- 11
- 860
- 0
Báo cáo khoa học: Secondary structure assignment of mouse SOCS3 by NMR defines the domain boundaries and identifies an unstructured insertion in the SH2 domain pdf
... phosphorylated peptide ligand J Biomol NMR 23, 77–78 28 Sasaki A, Inagaki-Ohara K, Yoshida T, Yamanaka A, Sasaki M, Yasukawa H, Koromilas AE & Yoshimura A (2003) The N-terminal truncated isoform of ... inhibit any prolonged activation and rapidly return to basal SOCS levels, ready for another round of stimulation There appear to be a number of features important for effective degradation of SOCS ... (1998) The crystal structure of the IkappaBalpha ⁄ NF-kappaB complex reveals mechanisms of NF-kappaB inactivation Cell 95, 759–770 Domain characterization of SOCS3 34 Almrud JJ, Oliveira MA, Kern AD,...
- 11
- 525
- 0
The turn of the screw
... Somebody w a s standing on the grass and staring up above me at the tower So there was another person out there, on the roof of the tower But the person in the garden was not the ghost of the woman It ... dictionary They are all in this part of the Affer you read Who says these words? Who are they talking to? s 'She was a lady and he was only a servant! b 'You were crying: c 'F wanted to be bad: ... the lake Now I had to look up A woman was standing on the other side of the lake - a dreadful woman, dressed in black She was smring at Flora I knew that she w a s the ghost of Miss Jessel, the...
- 26
- 434
- 1
Báo cáo khoa học: Atomic-resolution structure of reduced cyanobacterial cytochrome c6 with an unusual sequence insertion pot
... [16], and Cladophora glomerata [17]) have been determined, as has the structure of cytochrome c 6A from A thaliana [18] Together, these data represent a large volume of information about the sequences ... the Nd1H donor of the axial His18 and the carbonyl oxygen atom of Asn22 serves to maintain the required orientation of the His ring with respect to the heme plane Interestingly, this is the only ... generously allowed or unfavorable backbone dihedral angles, and that 87.1% of all residues are in the core region of the Ramachandran plot The statistics of the refinement are shown in Table Acknowledgements...
- 11
- 382
- 0
Báo cáo khoa học: "An Empirical Evaluation of Probabilistic Lexicalized Tree Insertion Grammars*" potx
... initial parameters associated with each rule are randomly generated subject to an admissibility constraint As long as all the rules have a non-zero probability, any string has a non-zero chance of ... splices the auxiliary tree into the target tree at a node labeled with the same nonterminal as the root and foot of the auxiliary tree By using a tree representation, LTAGs extend the domain of locality ... modeling of a context-free grammar to the level of N-grams without degrading the parsing accuracy In the future, we hope to continue to improve on the quality of parsing and language modeling by making...
- 7
- 331
- 0
Báo cáo khoa học: Altering the surface properties of baculovirus Autographa californica NPV by insertional mutagenesis of the envelope protein gp64 ppt
... 5-GATGACGAGCTCCTGCCGCTTCACCAACTCTTTG 5-GATGACGAGCTCGACAAATGGGCGACGGACGAGTGCCAGGTATAC 5-GATGACGAGCTCGTCGTCCTGGCACTCGAGC 5-GATGACGAGCTCGACAAATGGGCGAAAAATAACCCCGAGTCGGTG 5-GATGACGAGCTCGTCATCTTTAATGAGCAGACACG 5¢-GATGACGATTGCGGCCGCTTCGCCCATTTGTCGAGCTCCTTGACTCGGTGCTCGACTTTG ... 5-GATGACGAGCTCGGGCGGGGTAATGTCCAAG 5-GATGACGAGCTCGACAAATGGGCGTACAACGAAAACGTGATTATCGG 5-GATGACGAGCTCGTCCGTCTCCACGATGGTG 5-GATGACGAGCTCGACAAATGGGCGAATAACAATCACTTTGCGCACC 5-GATGACGAGCTCCTGCCGCTTCACCAACTCTTTG ... 5¢-GTTTTCGTACATCAGCTCCTC 5¢-CGGGTTGGCGGCCGCATCGTTGCTATGAACG 5¢-GATGACGAGCTCGACAAATGGGCGCCGTACAAGATTAAAAACTTGGAC 5¢-GATGACGAGCTCACCCGTCTTCATTTGCGCGTTGC 5-GATGACGAGCTCGACAAATGGGCGAAGGAAACGCTGCAAAAGGAC...
- 10
- 338
- 0
Báo cáo khoa học: Creating hybrid proteins by insertion of exogenous peptides into permissive sites of a class A b-lactamase doc
... anti-STa sera on the biological activity of native STa, 0.5 nmol of native STa was incubated with Peptide insertions in a class A b-lactamase various dilutions of the sera raised with the TEM195–STa ... that are essential to the toxicity of the peptide [15] When bound to the guanylin receptor of epithelial cells of the calf intestine, the toxin causes fluid accumulation as a consequence of the ... proteins allows analysis of the structural organization of the protein in conditions more similar to the native ones than the utilization of truncated proteins [4] Betton and co-workers have created...
- 11
- 358
- 0
Báo cáo khoa học: Effects of sphingomyelin, cholesterol and zinc ions on the binding, insertion and aggregation of the amyloid Ab1)40 peptide in solid-supported lipid bilayers ppt
... binding of the peptide to the bilayer as a function of added Ab concentration The binding constant was obtained by a hyperbolic fit to the data (solid line) with a KD value and total spectral shift as ... orifice in a Te on block, separating the silica surface of the PWR resonator from the aqueous compartment The hydrated silica surface attracts the polar head groups of the lipid to form a monolayer ... as a function of the concentration of Ab added to the PWR sample compartment The binding data were fit by a single hyperbola (solid line), and the binding affinity values and the magnitude of the...
- 14
- 532
- 0
Báo cáo khoa học: Preliminary Report on the Insertion of English Articles in RussianEnglish MT Output"" pdf
... Proceedings of the 1961 International Conference on Machine Translation of Languages and Applied Language Analysis (Teddington), Vol I, Her Majesty's Stationery Office, London, 1962, pp 111-121 Explanation: ... according to the pattern of article occurrence indicated for them in the tabulation This was regarded as encouraging because, first of all, three of the classes were quite small compared to the others, ... occurs as an alternative reading, an indication of the alternative article-less reading is to be printed along with the given article Unquestionably, the simplicity of the single major syntactic...
- 3
- 423
- 0
Báo cáo khoa học: Detection of nucleolar organizer and mitochondrial DNA insertion regions based on the isochore map of Arabidopsis thaliana ppt
... GCA GCG TGT TGC GAT GAC GAA GAG TTT TTC GGT GGC GGA GGG CAT CAC ATT ATC ATA AAA AAG TTA TTG CTT CTC CTA CTG ATG AAT AAC CCT CCC CCA CCG CAA CAG CGT CGC CGA CGG AGA AGG TCT TCC TCA TCG AGT AGC ACT ... except the mitochondrial DNA insertion isochore in chromosome II, all other regions in A thaliana belong to GC-poor families and most of the variation between two adjacent regions is less than 4% Analysis ... structure of A thaliana genome L.-L Chen and F Gao Table The codon usage, codon preference and amino acid usage of the genes in NOR, the mitochondrial DNA insertion isochore in chromosome II and the...
- 9
- 523
- 0
Báo cáo sinh học: " Construction and characterization of recombinant flaviviruses bearing insertions between E and NS1 genes" docx
... (5'CTCGGCATGG ACGAGCTGTACAAGAAGTTGTTCACTCAGACCATGAAAGGC 3') and RG331 (5'GCC AAAGTTGATGGCGCATCCTTGATCGGCGCCAACTCCTA GAGAC 3') This fragment included 24 nucleotides from the carboxi-terminal of the EGFP gene ... analysis of RT-PCR amplicons from viral RNA extracted from samples of the supernatant of cultures according to the passage numbering indicated on top of each lane The first lane corresponds to ... permeabilized and stained with a polyclonal antiserum against YF viral antigens (Fig 4A) The staining of YF antigens spread from the perinuclear region to a reticular network through the cytoplasm...
- 16
- 428
- 0
Báo cáo sinh học: " Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" pptx
... and may allow for correlation with efficacy and toxicity during clinical trials and treatment thus offering potential clinical translation of this dual therapy In order to take advantage of the ... after infection GFP expression was analyzed via a Becton-Dickinson FACScan Plus cytometer (Becton-Dickinson, San Jose, CA) Analysis was performed using CellQuest software (BectonDickinson) Page ... profile after its use as a live vaccine in the World Health Organization’s smallpox vaccination program makes it particularly attractive as an oncolytic agent and gene vector [2] © 2011 Haddad et al;...
- 14
- 490
- 0
báo cáo hóa học:" Treatment of neuromuscular scoliosis with posterior-only pedicle screw fixation" pptx
... Results The average age at the time of operation was 17.5 years (range – 44 years) and the average follow-up was 25 months (range, 18 – 52 months) (table 1) The average percentage of pre operative ... The average duration of Table 3: Values for duration of anesthesia, duration for operation, post operative ICU stay, ventilator support, hospital stay and documentation of infection No Diagnosis ... 16 Authors' contributions HNM has contributed in conception and design and acquisition of data, analysis and interpretation of data, drafting the manuscript and revising it critically, SWS has...
- 8
- 441
- 0
báo cáo hóa học:" Comparison of migration behavior between single and dual lag screw implants for intertrochanteric fracture fixation" pptx
... linked to stress concentration at the tip of the IM nail, stress concentration at the distal locking bolt, and reaming of the proximal femur to accommodate the increased proximal diameter of the nail ... to the anatomic axis of the femoral shaft (Figure 3b) The back plate of the femoral head steel shell had a 40 mm diameter hole to ensure unconstrained shear translation of the lag screw shaft ... result of dual lag screws is the substantial amount of axial medial migration of the inferior screw that was noted after 10,054 load cycles The axial migration of lag screws has been described as the...
- 9
- 470
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25