Altering the surface properties of baculovirus Autographa californica NPV by insertional mutagenesis of the envelope protein gp64 Alexandra Spenger, Reingard Grabherr, Lars To¨ llner, Hermann Katinger and Wolfgang Ernst Institute of Applied Microbiology, University of Agricultural Sciences, Vienna, Austria The envelope protein gp64 of the baculovirus Autographa californica nuclear polyhedrosis virus is essential for viral entry into insect cells, as the glycoprotein both mediates pH- dependent membrane fusion and binds to host cell receptors. Surface modification of baculovirus particles by genetic engineering of gp64 has been demonstrated by various strategies and thus has become an important and powerful tool in molecular biology. To improve further the presen- tation of peptides on the surface of baculovirus particles, several insertion sites within the gp64 envelope protein were selected by their theoretical maximum surface probability and investigated for efficient peptide presentation. The ELDKWA peptide of the gp41 of HIV-1, specific for the human mAb 2F5, was inserted into 17 different positions of the glycoprotein gp64. Propagation of viruses was successful in 13 cases, mutagenesis at four positions did not result in production of intact virus particles. Western blotting, FACS analysis and ELISA were used for characterization of the different binding properties of the mutants. Insertion of this peptide into the native envelope protein resulted in high avidity display on the surface of baculovirus particles. This approach offers the possibility of effective modification of surface properties in regard to host range specificity and antigen display. Keywords: Autographa californica nuclear polyhedrosis virus; baculovirus; ELDKWA epitope; gp64 envelope pro- tein; surface display. The baculovirus Autographa californica nuclear polyhedro- sis virus has been widely used as an expression system for eukaryotic proteins in insect cell culture [1,2], for surface display of various peptides and proteins [3,4], and more recently, for the transduction of mammalian cells [5–8]. Baculoviruses are large, enveloped, double-stranded DNA viruses that replicate in the nuclei of insect cells; their infection cycle has been studied in detail [9–12]. The major envelope protein gp64 consists of 512 amino acids [13] with a signal peptide at the N terminus, which is responsible for targeting the glycoprotein to the cell plasma membrane, and a hydrophobic transmembrane domain near the C terminus [14]. Transcription is regulated by a biphasic promoter, resulting in synthesis peaks 12 and 24 h post-infection [15,16]. After viral DNA replication and late gene expres- sion, nucleocapsids assemble in the nucleus and migrate through the cytoplasm to the plasma membrane, where gp64 is concentrated. The glycoprotein is then acquired by baculoviruses as they bud through the plasma membrane [17]. Gp64 forms typical peplomeric structures consisting of three homomeric polypeptide chains linked via disulfide bonds. Oligomerization occurs post-translationally inside the endoplasmic reticulum, and misfolded gp64 fails to accumulate at the cell surface. Glycosylation appears to occur cotranslationally and may be the rate-limiting step in the process of gp64 maturation and transport [16]. Gp64 is essential for viral entry into the host cell, as it mediates cell receptor-binding activity as well as pH-dependent mem- brane fusion [18–20]. It has further been shown that gp64 is required for cell-to-cell transmission of infection in cell culture and for efficient virion budding [19,21]. Although an oligomerization and a fusion domain [22] as well as a transmembrane domain [14] have been identified, no data about the X-ray crystal structure of gp64 exist. However, insights about the surface structure and function of the baculovirus major envelope protein are of high relevance as baculoviruses have been demonstrated to be a valuable tool for surface display techniques, providing novel strategies for ligand screening [23], antigen display [24] and altering the viral host range [25,26]. Besides the possibility to display proteins as fusions to a second copy of gp64 or its membrane anchor sequence, Ernst et al. [23] have described a novel strategy for efficient peptide display on the surface of baculoviruses by engineering peptides directly into the native envelope protein gp64. Thereby, no duplication of the gp64 is necessary to target the foreign peptide to the surface of baculoviruses because each copy of the gp64 contains the target sequence, providing high avidity of inserted peptide. By efficiently displaying specific epitopes on the viral surface, it becomes possible to modify baculoviral tropism, e.g. for specific mammalian cell transduction, and also to consider baculoviruses as an Correspondence to W. Ernst, Institute of Applied Microbiology, University of Agricultural Sciences, Muthgasse 18, A-1190 Vienna, Austria. Fax: +43 13697615, Tel.: +43 136006 6242, E-mail: W.Ernst@iam.boku.ac.at, URL: http://www.boku.ac.at/ iam/baculo/ Abbreviations:AcMNPV,Autographa californica multicapsid nuclear polyhedrosis virus; FCS, fetal calf serum; X-Gal, 5-bromo- 4-chloro-3-indolyl-b- D -galactoside; m.o.i., multiplicity of infection; d.p.i., days post-infection; h.p.i., hours post-infection; AP, alkaline phosphatase; PO, peroxidase; BCIP, 5-bromo-4-chloro-3-indolyl phosphate; NBT, nitro blue tetrazolium; FITC, fluorescein isothiocyanate. (Received 17 May 2002, revised 11 July 2002, accepted 25 July 2002) Eur. J. Biochem. 269, 4458–4467 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03135.x effective antigen presenting vehicle. To optimize further the presentation of foreign peptides on baculovirus particles we screened additional positions throughout the gp64 coding region for insertion of a specific peptide epitope, without removing virally encoded amino acid residues. We gener- ated mutations carrying the peptide ELDKWA [27], specific for the human mAb 2F5 [28,29], at positions with high theoretical maximum surface probability, as determined by computer analysis [30] (Figs 1 and 2). Propagation of viruses was successful in 13 out of 17 cases. Titres of recombinants ranged from 10 7 to 10 8 plaque forming units (p.f.u.)ÆmL )1 . In some cases we observed smaller plaque phenotypes indicating a decreased viability. Surface local- ization of the inserted peptide was demonstrated by flow cytometry, Western blot analysis and ELISA. By increasing the binding capacity of a foreign peptide to its ligand, we were successful in providing an improved tool for applica- tions, wherever modifications of the baculovirus surface properties are of importance. MATERIALS AND METHODS Construction of transfer plasmids Cloning procedures were performed according to Sam- brook et al. [31], restriction enzymes and other modifying enzymes were purchased either from Roche Diagnostics (Mannheim, Germany) or MBI Fermentas (St Leon-Rot, Germany) and used according to the manufacturer’s recommendations. For PCR we used the DyNAzyme TM EXT DNA polymerase from Finnzymes (Espoo, Finland). The plasmid used for homologous recombination at the gp64 locus was p64flank [23], which contains the 7.576-bp HindIII fragment A2 of Autographa californica multi- capsid nuclear polyhedrosis virus (AcMNPV) including the whole gp64 ORF (Entrez-Protein number NP_054158) [32]. For generation of mutant vectors with insertion of the ELDKWA motif at different positions in the gp64, different cloning strategies were developed. The peptides were inserted into the baculoviral envelope protein without removing viral residues. The plasmids pELD31, 43, 59, 148, 180, 234 were constructed by inserting an altered NotI fragment into the p64flank treated with NotI. The altered NotI fragments were produced by two PCR reactions, amplifying two fragments using 64-(-639)-NotI-back and a 64-ELD-SacI-for primer for one reaction and a 64-ELD-SacI-back and 64-993-for primer for the second, the template was p64flank in both cases. After digestion with SacI the two fragments were ligated and another PCR was carried out with the primers 64-(-639)-NotI-back and 64-939-for. The PCR product was digested with NotI and after agarose gel electrophoresis the insert was ligated into NotI-treated p64flank. Primers used for construction of pELD31, 43, 59, 148, 180 and 234 are listed in Table 1 (section A). Plasmid constructs for ELDKWA-epitope insertions at codon 277, 276, 275, 274, 271 of gp64, were made as described by Ernst et al. [23] for pELD278. PCRs were performed with 64-(-639)-NotI-back and primers 64-277- ELD-NotI-for, 64-276-ELD-NotI-for, 64-275-ELD-NotI- for, 64-274-ELD-NotI-for and 64-271-ELD-NotI-for, respectively (Table 1, section B). Purified NotI-digested fragments were inserted into the NotI-treated vector p64flank thereby substituting the excised fragment for the particular gp64 mutant construct (pELD277–pELD271). The inserts for pELD279, pELD280, pELD281, pELD282, pELD283, pELD290 were generated by ligation of two fragments made by PCR with primers 64-394-SacII- back and 64-ELD-SacI-for and 64-ELD-SacI-back and 64- 1536-BamHI-for (Table 1, section C). The two fragments were treated with SacI, ligated, and afterwards another PCR was carried out with the outer primers 64-SacII-394- back and 64-1536-BamHI-for. This PCR fragment was Fig. 1. Schematic map of the gp64 envelope protein. The AcMNPV gp64 ORF encodes a protein of 512 amino acids, with an N-terminal signal peptide (L), a hydrophobic transmembrane domain (TM) and a cytoplasmic tail domain at the C terminus (CTD). In addition two functional regions have been characterized, a fusion domain (F) and an oligomerization domain (O) within a helical region (Helix) [22]. Gp64 contains five predicted N-glycosylation sites (Y). The epitopes of two mAbs are indicated: B12D5 epitope from amino acid 277 to amino acid 287 [22,35] and AcV5 epitope from amino acid 431 to amino acid 439 [22,36]. Insertion of the ELDKWA peptide at different positions within the gp64 is indicated by numbers corresponding to the position of amino acids in the gp64 envelope protein. Modification at positions marked with asterisks did not succeed in production of progeny virus. Fig. 2. Amino acids of gp64 flanking the inserted peptide ELDKWA. Numbers correspond to the amino acid position in the gp64 envelope protein (Entrez-Protein number NP_054158) [32]. The peptide was inserted into the native envelope protein without the removal of viral amino acids. Ó FEBS 2002 Modification of the baculovirus envelope (Eur. J. Biochem. 269) 4459 digested with SacII and ApaI and inserted into p64flank treated with SacII and ApaI replacing the corresponding wild-type fragment in p64flank. The insertions into the gp64 sequence were confirmed by screening of bacterial colonies by PCR and subsequent analysis of the fragments by 1.5% agarose gel electrophor- esis. Primers used for amplification were 64-727-back and 64-939-for (for pELD271, pELD274, pELD275, pELD276, pELD277, pELD279, pELD280, pELD283, pELD290), 64- 53-back and 64-206-for (for pELD31, pELD43, pELD59), 64-422-back and 64-568-for (pELD148, pELD180), 64-639- back and 64-799-for (for pELD234) (Table 1, sectionD). All PCR fragments were compared to the corresponding wild- type fragment derived by amplifications using the above primer combinations and p64flank as template. In addition we sequenced 600-bp fragments of mutant p64flank, from Table 1. Primers used for construction of gp64 mutants. (A) Primers for mutagenesis at amino acids position 31, 43, 59, 148, 180 and 234. (B) Primers used for plasmids pELD271, pELD274, pELD275, pELD276 and pELD277. (C) Primers for plasmids pELD279, pELD280, pELD281, pELD282, pELD 283 and pELD290. (D) Primers used for screening and sequencing. A 64-939-for 5¢-GTTTTCGTACATCAGCTCCTC 64-(-639)-NotI-back 5¢-CGGGTTGGCGGCCGCATCGTTGCTATGAACG 64-31-ELD-SacI-back 5¢-GATGACGAGCTCGACAAATGGGCGCCGTACAAGATTAAAAACTTGGAC 64-31-ELD-SacI-for 5¢-GATGACGAGCTCACCCGTCTTCATTTGCGCGTTGC 64-43-ELD-SacI-back 5-GATGACGAGCTCGACAAATGGGCGAAGGAAACGCTGCAAAAGGAC 64-43-ELD-SacI-for 5-GATGACGAGCTCGGGCGGGGTAATGTCCAAG 64-59-ELD-SacI-back 5-GATGACGAGCTCGACAAATGGGCGTACAACGAAAACGTGATTATCGG 64-59-ELD-SacI-for 5-GATGACGAGCTCGTCCGTCTCCACGATGGTG 64-148-ELD-SacI-back 5-GATGACGAGCTCGACAAATGGGCGAATAACAATCACTTTGCGCACC 64-148-ELD-SacI-for 5-GATGACGAGCTCCTGCCGCTTCACCAACTCTTTG 64-180-ELD-SacI-back 5-GATGACGAGCTCGACAAATGGGCGACGGACGAGTGCCAGGTATAC 64-180-ELD-SacI-for 5-GATGACGAGCTCGTCGTCCTGGCACTCGAGC 64-234-ELD-SacI-back 5-GATGACGAGCTCGACAAATGGGCGAAAAATAACCCCGAGTCGGTG 64-234-ELD-SacI-for 5-GATGACGAGCTCGTCATCTTTAATGAGCAGACACG B 64-277-ELD-NotI-for 5¢-GATGACGATTGCGGCCGCTTCGCCCATTTGTCGAGCTCCTTGACTCGGTGCTCGACTTTG 64-276-ELD-NotI-for 5¢-GATGACGATTGCGGCCGCTTCTTCGCCCATTGTCGAGCTCGACTCGGTGCTCGACTTTGCG 64-275-ELD-NotI-for 5¢-GATGACGATTGCGGCCGCTTCTTGACCGCCCATTTGTCGAGCTCTCGGTGCTC GACTTTGCGTTTAATG 64-274-ELD-NotI-for 5¢-GATGACGATTGCGGCCGCTTCTTGACTCGCGCCCATTTGTCGAGCTCGTGCTC GACTTTGCGTTTAATGC 64-271-ELD-NotI-for 5¢-GATGACGATTGCGGCCGCTTCTTGACTCGGTGCTCGACCGCCCATTTGTC GAGCTCTTTGCGTTTAATGCATCTGTTAAAC C 64-394-SacII-back 5¢-AACGAGGGCCGCGGCCAGTG 64-1536-BamHI-for 5¢-GCGGGATCCTTATTAATATTGTCTATTACGGTTTCTAATC 64-279-ELD-SacI-back 5¢-GATGACGAGCTCGACAAATGGGCGCCGCCCACTTGGCGCCAC 64-279-ELD-SacI-for 5¢-GATGACGAGCTCCCGCTTCTTGACTCGGTGC 64-280-ELD-SacI-back 5¢-GATGACGAGCTCGACAAATGGGCGCCCACTTGGCGCCACAACG 64-280-ELD-SacI-for 5¢-GATGACGAGCTCCGGCCGCTTCTTGACTCGG 64-281-ELD-SacI-back 5¢-GATGACGAGCTCGACAAATGGGCGACTTGGCGCCACAACGTTAG 64-281-ELD-SacI-for 5¢-GATGACGAGCTCGGGCGGCCGCTTCTTGAC 64-282-ELD-SacI-back 5¢-GATGACGAGCTCGACAAATGGGCGTGGCGCCACAACGTTAGAGC 64-282-ELD-SacI-for 5¢ GATGACGAGCTCAGTGGGCGGCCGCTTCTTG 64-283-ELD-SacI-back 5¢-GATGACGAGCTCGACAAATGGGCGCGCCACAACGTTAGAGCCAAG 64-283-ELD-SacI-for 5¢-GATGACGAGCTCCCAAGTGGGCGGCCGCTTC 64-290-ELD-SacI-back 5¢-GATGACGAGCTCGACAAATGGGCGTACACAGAGGGAGACACTGC 64–290-ELD-SacI-for 5¢-GATGACGAGCTCCTTGGCTCTAACGTTGTGGC D 64-206-for 5¢-TTGTAGCCGATAATCACGTTTTCG 64-422-back 5¢-GCAAAGAGTTGGTGAAGCG 64-568-for 5¢-CCAAAATGTATACCTGGCACTC 64-639-back 5¢-CAAACAAAAGTCTACGTTCACC 64-799-for 5¢-ATCTGTTAAACTTGCAGTTCCAC 64-53-back 5¢-CCTTTGCGGCGGAGCACTG 64-939-for 5¢-GTTTTCGTACATCAGCTCCTC 64-727-back 5¢-CGCGAACACTGTTTGATTGAC 4460 A. Spenger et al. (Eur. J. Biochem. 269) Ó FEBS 2002 base pair 10 to 610 (for pELD31, pELD43, pELD59, pELD148, p180ELD) or from base pair 390 to 990 (for pELD234, pELD271, pELD274, pELD275, pELD276, pELD277, pELD279, pELD280, pELD283, pELD290). Cells and viruses Cell line Sf9 (Spodoptera frugiperda, CRL 1711; ATCC) and AcMNPV were propagated at 27 °CinIPL-41medium (Sigma-Aldrich) supplemented with yeastolate and a lipid/ sterol cocktail containing optional 3% or 10% fetal calf serum (FCS). Sf9 Op1D stable transfected cells [33] were cultivated in TNM-FH complete medium (Sigma-Aldrich) containing 10% FCS and were used for propagation of gp64 null virus (vAc64 – ) [19]. vAc64 – and the cell line Sf Op1D were both established in the laboratory of G. Blissard (Molecular Biology of Insect Viruses at the Boyce Thomp- son Institute, Cornell University, Ithaca, NY, USA) and kindly given to us. Viruses were isolated by plaque purification and amplified using standard procedures [1]. Budded viruses were prepared by ultracentrifugation of supernatants [harvested 5 days post-infection (d.p.i.)] over a 30% sucrose cushion. Pellets were resuspended in phosphate buffered saline (NaCl/Pi) (8 gÆL )1 NaCl, 0.2 gÆL )1 KCl, 1.44 gÆL )1 Na 2 HPO 4 , 0.24 gÆL )1 KH 2 PO 4 ,pH7.4). Generation of recombinant viruses Cloning procedures yielded a set of transfer plasmids that encoded mutant forms of the AcMNPV gp64 coding regions containing the sequence for the ELDKWA peptide at different positions. To generate recombinant viruses, Sf9 cells were plated in 25 mm 2 T-flasks (2 · 10 6 cells per flask) and cotransfected with 100 ng Ac64 – DNA and 500 ng transfer plasmid by liposome-mediated transfection [34] using the CellFECTIN TM transfection reagent (Life Tech- nologies). Ac64 – DNA, the parental viral DNA, lacking the entire gp64 reading frame (it is substituted by a lacZ expression cassette) was extracted and prepared from Sf Op1D -infected cells. Recombinant viruses were purified from the transfec- tion supernatant by plaque assay. After 5 days petridishes were overlaid with agarose containing 5-bromo-4-chloro- 3-indolyl-b- D -galactoside (X-Gal), for identification of viruses lacking the lacZ expression cassette. White plaques were amplified, and to confirm the insertions into the gp64 envelope protein, viral DNA was prepared from infected Sf9 cells. DNA fragments from base 53 to base 939 were amplified by PCR and sequence analyses were performed using primers 64-53-back and 64-939-for. Western blotting of infected cells and budded virions Samples were prepared for the Western blotting analysis in the following manner. Sf9 cells were infected with a multiplicity of infection (m.o.i.) of 10 and harvested 24 h post-infection (h.p.i.), washed with NaCl/P i and lysed in 1 · sample buffer (100 m M Tris/HCl pH 6.8, 4% SDS, 0.2% Bromophenol blue, 20% glycerol, 200 m M b-merca- ptoethanol) containing 2 · 10 5 cells per 10 l L . Budded virus preparations were also diluted and mixed with sample buffer resulting in 2 lgproteinper10l L (determined with a Bio-Rad Protein assay). Samples were heated to 95 °C for 10 min prior to SDS/PAGE (10% polyacrylamide). Proteins were transferred to a PVDF-Membrane (Bio- Rad) using a semidry transfer cell (Bio-Rad). Membranes were blocked with 3% BSA in NaCl/P i including 0.1% Tween-20 (TPBS) prior to gp64 and ELDKWA detection. The native and the mutant gp64 proteins were probed with B12D5 mAb [35] (1 : 1000) or with AcV5 mAb [36] (1 : 1000). After several washing steps with TPBS, mem- branes were incubated with goat anti-(mouse IgG) alkaline phosphatase (AP) conjugate (Sigma) diluted 1 : 1000. Reactive bands were detected by the addition of 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and Nitro blue tetrazolium (NBT) as substrate. The inserted epitope ELDKWA was detected by human mAb 2F5 (1 lgÆmL )1 ) and goat anti-(human IgG) AP conjugate (Sigma; 1 : 1000) followed by detection with BCIP and NBT. Molecular masses were estimated by comparing the reactive bands with the bands from a prestained high range molecular mass marker (Bio-Rad). FACS analysis of infected cells For FACS analysis 10 6 cells were infected in 6-well plates at an m.o.i. 10 and harvested 24 and 48 h.p.i. After washing with NaCl/P i cells were probed with specific antibodies B12D5 (1 : 100) and 2F5 (10 lgÆmL )1 ) diluted in NaCl/P i containing 10% FCS for 1 h at room temperature. Cells were washed with 1 mL NaCl/P i and after centrifugation cells were resuspended in goat anti-(mouse IgG) fluorescein isothiocyanate (FITC) conjugate (Sigma) (for B12D5 pre- treated samples) or goat anti-(human IgG) FITC conjugate (Sigma) (for 2F5-treated samples) diluted 1 : 50 in NaCl/P i containing 2% FCS. After 1 h of incubation with FITC conjugates cells were washed again and resuspended in 300 l L NaCl/P i containing propidium iodide (1 lgÆmL )1 ) for staining of dead cells. Labelled cells were analysed on a FACS Calibur (Becton Dickinson). Data were analysed with CELLQUEST software. ELISA of budded virions 96-well-plates MaxiSorp TM (Nunc) were pre-coated with 100 l L human mAb 2F5 (5 lgÆmL )1 ) in coating buffer (8.4 gÆL )1 NaHCO 3 ,4gÆL )1 Na 2 CO 3 , pH 9.6) overnight at 4 °C. The plates were washed with TPBS and preparations of budded viruses harvested at both 3 and 5 d.p.i. were added and serially diluted 1 : 2–1 : 128 starting with samples containing 2 lgÆmL )1 protein in dilution buffer (TPBS including 1% BSA). After incubation for 1 h at room temperature, the plates were washed with TPBS and 100 l L B12D5 mAb (1 : 1000 in dilution buffer) per well was added. After a further 1 h of incubation at room temperature, the plates were washed and goat anti-(mouse IgG) peroxidase (PO) conjugate (Sigma) was applied as second antibody. Plates were incubated for a further 1 h and after washing 100 l L of substrate (1 gÆL )1 1.2-o- phenylendiamindihydrochlorid in citrate buffer pH 5.0 containing 0.03% H 2 O 2 )wasaddedtoeachwell.The reaction was stopped by the addition of 1.25 M H 2 SO 4 and the product was measured at 492 nm in a multichannel photometer (EAR 400 AT, SLT). Ó FEBS 2002 Modification of the baculovirus envelope (Eur. J. Biochem. 269) 4461 RESULTS Construction of ELDKWA mutant viruses The peptide epitope ELDKWA [27] derived from the HIV-1 glycoprotein gp41 specifically binds to the human mAb 2F5 [28,29]. This ligand binding interaction served as a model to identify and compare several positions within the baculo- virus major envelope protein for surface accessibility (Figs 1 and 2). Recombinant viruses were generated by cotransfec- tion of Sf9 cells with transfer plasmids containing the modified gp64 coding sequence and Ac64 – DNA, a baculovirus mutant where gp64 had been deleted by insertion of a b-galactosidase expression cassette [19]. Thereby, only peptide insertions that maintained the functionality of gp64 and thus, had restored the deletion, produced virus progeny. Amplification of ELDKWA presenting viruses was successful in most cases. The four out of 17 positions that did not tolerate insertion of the short peptide were amino acids 31, 43, 59 and 148. The fact that no infectious virus could be generated in these four cases was tested by repeated cotransfection of viral Ac64 – DNA together with the corresponding transfer plasmid into Sf9 cells. In addition, subsequent amplification of transfec- tion supernatant did not lead to the production of virus progeny either. Visual examinations of Sf9 cells following transfection and amplification over a period of more than 14 days did not show any signs of virus growth. Successful virus propagation could be achieved for insertions at position 180, 234, 271, 274, 275, 276, 277, 279, 280, 281, 282, 283 and 290. These mutant viruses were amplified and characterized further. Virus growth After transfections, plaque assays were performed to isolate single virus clones. Mutants which had substituted the b-galactosidase expression cassette were identified by over- laying plates from plaque assays using X-Gal-containing agarose. Recombinants with a white phenotype were used for further amplification. Sequence analysis of PCR prod- ucts from these mutant viruses confirmed the correct insertion of the ELDKWA peptide into the gp64 gene. To observe the growth of viral mutants on Sf9 cells, viruses were amplified in two successive steps and subjected to plaque assay for determining plaque forming units per mL (p.f.u.ÆmL )1 ). Each viral stock was titrated twice and medians of these two analyses are shown in Table 2. Titres of the recombinants ranged from 5 · 10 6 to 1.7 · 10 8 p.f.u.ÆmL )1 . The lowest number of p.f.u. in viral stocks contained virus AcELD180; its titre was  30 times lower than wild-type virus titre. Most viruses reached titres of between 2 · 10 7 and 8 · 10 7 p.f.u.ÆmL )1 . Insertions at positions 234 and 275 had no effect on viral growth, their stocks showed titres like that of wild-type AcMNPV (1–2 · 10 8 p.f.u.ÆmL )1 ). In some cases we observed smaller plaque phenotypes, indicating a decreased viability [26]. Stability of AcELD283 Because the ELDKWA peptide is inserted into the native envelope protein gp64, all viruses produced contain the insertion in their envelope protein. In order to investigate the generation of progeny virions over multiple passages, we sequentially passed one representative mutant, AcELD283, through Sf9 cells by infection of 10 7 cells with 500 lLofthe previous virus stock and thereby produced five successive virus stocks. These stocks were examined for virus titre and surface expression of the ELDKWA peptide on infected cells using FACS (Fig. 3). For FACS, triplicate infections of 10 6 cells were performed, using 500 lL of each virus stock, which corresponds to an m.o.i. ranging from 10 (AcELD283 stock 5) to 20 (AcELD283 stock 2). Titres remained similar over five passages (Table 3); in addition, as concluded from FACS histograms the amount of ELDKWA on the surface of infected cells only varied slightly approving the stable insertion of the ELDKWA peptide into the native envelope protein gp64 (Fig. 3A). Staining with B12D5 mouse mAb showed no binding demonstrating the disruption of the epitope of this mouse mAb and the absence of any wild-type gp64 (Fig. 3B). Expression of recombinant gp64 in infected insect cells The expression levels of recombinant gp64 were first compared using Western blot analysis. Sf9 cells were infected at an m.o.i. of 10, harvested 24 h post-infection, and subjected to SDS/PAGE. After blotting, the membranes were probed either with the mouse mAb B12D5 specific for gp64 (Fig. 4A), or with the human mAb 2F5, which recognizes the ELDKWA epitope (Fig. 4B). It was shown that gp64 expression levels of recombinants were comparable to gp64 levels expressed by wild-type AcMNPV (Fig. 4A). Constructs with insertions at positions 279–283 showed no or only weak reactive bands indicating that modification at these positions leads to disruption of the specific epitope. Monsma and coworkers [22] have mapped the mouse mAb B12D5 epitope to 11 amino acids spanning positions 277–287 of the AcMNPV gp64 sequence. Our experiment revealed that amino acids 277 and 278 are not required for antibody binding. By using a Western blot stained with 2F5 we could demonstrate that all constructs that yielded infectious progeny showed a reactive band at 64 kDa confirming the successful insertion of the ELDKWA peptide into the native envelope protein (Fig. 4B). Table 2. Virus stock titres of recombinant viral mutants and wild type AcMNPV determined by plaque assay on Sf9 cells. Titer (p.f.u.ÆmL )1 ) AcELD180 6 · 10 6 AcELD234 1.7 · 10 8 AcELD271 3.8 · 10 7 AcELD274 1.6 · 10 7 AcELD275 1.1 · 10 8 AcELD276 1.7 · 10 7 AcELD277 1.0 · 10 7 AcELD278 2 · 10 7 AcELD279 2.2 · 10 7 AcELD280 6.2 · 10 7 AcELD281 6 · 10 7 AcELD282 3.2 · 10 7 AcELD283 8 · 10 7 AcELD290 4 · 10 7 AcMNPV 1 · 10 8 4462 A. Spenger et al. (Eur. J. Biochem. 269) Ó FEBS 2002 Presentation of the ELDKWA on surface of infected cells The presentation of the inserted epitope ELDKWA on the surface of infected cells was determined by FACS analysis 24 and 48 h.p.i. For this purpose Sf9 cells were infected three times, independently with an m.o.i. of 10 using 6-well plates and 10 6 cells per well. Fig. 5 shows ELDKWA detection using the human mAb 2F5 and goat anti-human IgG FITC conjugate. Nearly all constructs gave a higher fluorescence signal than the construct containing the insertion at position 278, previously described by Ernst et al. [23], indicating a better presentation or exposition of the inserted peptides. The relative fluorescence intensity determined by FACS was three to six times higher in the constructs AcELD180, AcELD271, AcELD274, AcELD283 and AcELD290. We also analysed cells 48 h.p.i. for ELDKWA expression (data not shown). Results were similar to analyses 24 h.p.i., confirming that viruses AcELD180, AcELD271, AcELD274, AcELD283 and AcELD290 were the best candidates for surface presentation of the ELDKWA peptide. gp64 levels were measured by FACS using the mouse mAb B12D5. Ac64 – , the gp64 knockout mutant served as negative control. These results showed that most viruses expressed comparable amounts of gp64. Lower binding capacity was detected for constructs AcELD279 and AcELD280. Viruses AcELD281, AcELD282 and Fig. 3. Stability of AcELD283. Virus AcELD283 was sequentially passed through Sf9 cells and thereby five successive virus stocks were produced (AcELD283/1– AcELD283/5). These stocks were investigated for ELDKWA expression and virus titre. ELDKWA expression of infected cells was investigated with FACS. (A) Staining with human mAb 2F5, specific for the ELDKWA and anti-human FITC conjugate (histogram 1–4). (B) staining with mouse mAb B12D5, which is specific for the viral glycoprotein gp64 and anti-mouse FITC conjugate (histogram 5–8). AcELD283 virus stocks are depicted in blue, the AcMNPV control virus is shown in black. Selected histograms are representative of three independent experiments. Table 3. Virus stock titres of recombinant viral mutants and wild type AcMNPV determined by plaque assay. Results shown are the means of two analyses. Depending on the virus titre m.o.i. ranged from 10 (AcELD283 stock 5) to 20 (AcELD283 stock 2). Titer (p.f.u.ÆmL )1 ) AcELD283/1 4.5 · 10 7 AcELD283/2 3.8 · 10 7 AcELD283/3 5.5 · 10 7 AcELD283/4 4.8 · 10 7 AcELD283/5 2.0 · 10 7 Ó FEBS 2002 Modification of the baculovirus envelope (Eur. J. Biochem. 269) 4463 AcELLD283 showed no binding to the mouse mAb B12D5 confirming the results obtained from Western blot analysis. Expression on viral particles Recombinant viral constructs which gave the highest signals of ELDKWA on the surface of virally infected Sf9 cells were selected for further investigations. These constructs were AcELD180, AcELD271, AcELD274, AcELD281, AcELD283 and AcELD290. The packaging and uptake of modified gp64 into the viral particle was investigated by immunoblot analysis of budded virus preparations. Blots were probed with the gp64-specific antibodies mouse mAb B12D5 and mouse mAb AcV5, and the ELDKWA specific human mAb 2F5 (Fig. 6A–C). AcMNPV served as positive control for gp64 detection. Corresponding to the results obtained from infected cells AcELD281 and AcELD283 showed no reactivity with mouse mAb B12D5, but gp64 could be detected by using mouse mAb AcV5 which binds to denatured gp64 recog- nizing amino acids 431–439 [22] (Fig. 6A and B). The binding capacity of ELDKWA was highest in viral constructs AcELD274, AcELD283 and AcELD290 (Fig. 6C). For further analysis, virus preparations were subjected to ELISA plates precoated with human mAb 2F5. Detection of bound virus was done using mouse mAb B12D5 and anti-mouse IgG PO conjugate. As mouse mAb B12D5 no longer recognized AcELD281 and AcELD283, these viruses could not be analysed. Highest binding capacity was detected for AcELD274 (Fig. 7). DISCUSSION Modification of virus envelope proteins often results in the loss of infection as envelope proteins are required for spread of infection. In the baculovirus AcMNPV, the envelope glycoprotein gp64 is responsible for viral entry into the host cell, has receptor binding activity and is required for efficient budding of viral particles. However, targeted surface modification of infectious particles is a desired goal in molecular biology, as this may result in novel presentation and delivery tools. Baculovirus surface display holds a great potential for drug screening, investigations of protein– protein interactions, antigen presentation and altering cell tropism. To exploit fully the possibilities of the baculovirus surface display system, it becomes necessary to understand and investigate the functional and structural domains of the baculovirus major envelope protein. Insertional mutagene- sis by Monsma and coworkers [22] have previously revealed an oligomerization domain, which is located within an alpha-helical region, and a fusion domain of gp64. Further, a transmembrane domain has been mapped to the C terminus of the glycoprotein [14]. Most attempts to display foreign proteins on the surface of baculovirus virions and infected insect cells were done by expressing the target protein as a N-terminal fusion to a second copy of gp64 [37– 39]. Boublik et al. [37] suggested that incorporation of the target protein was a result of co-oligomerization of the gp64 fusion proteins with wild-type gp64. Additionally, they Fig. 4. Western blot analysis of infected insect cells. (A) Immuno- staining of infected cells with mAb B12D5, which is specific for the envelope protein gp64: 2 · 10 5 infected cells were used per lane. Ac64 – the gp64 deletion mutant (lane 2) showed no reactivity with B12D5. Additionally, constructs AcELD279 to AcELD283 (lane 11, 12, 13, 15, 16) did not react with B12D5, indicating B12D5 epitope destruction by insertion of ELDKWA. Other recombinants (lane 3, 4, 5, 6, 7, 8, 9, 10, 17) and wild-type AcMNPV (lane 1, 14) showed binding to B12D5. (B) Detection of ELDKWA epitope in the gp64 envelope protein with human mAb 2F5: Reactive bands at 64 kDa confirm the expression of ELDKWA presenting envelope protein. AcMNPV and Ac64 – did not react with 2F5 antibody. Fig. 5. FACS analysis of ELDKWA epitope in infected insect cells. A total of 10 6 cells were infected with mutant viruses at an m.o.i. 10 and harvested 24 h.p.i. Three independent infections were made for each virus and stained separately with human mAb 2F5, which is specific for the ELDKWA epitope, and anti-human FITC conjugate. A total of 10 000 events were measured for FACS analysis. Dead cells stained with propidium iodide were gated out. Uninfected Sf9 cells and cells infected with AcMNPV served as negative control for ELDKWA detection. On the Y-axis the mean intensity of fluorescence for infected Sf9 cells, expressed as the median of fluorescence of three independent infections, is shown. Error bars correspond to the SD of the medians of three independent infections. 4464 A. Spenger et al. (Eur. J. Biochem. 269) Ó FEBS 2002 could not rule out the possibility that some fusions with gp64 may affect virus growth. These data suggest that levels displayed on the surface of viral particles depend on the amino acid sequence, the length of the insertion and secondary structure. If gp64 fusion proteins are not able to build a secondary structure that allows oligomerization with wild-type gp64, the viral particle presents only low levels or even fails to display the target protein on the viral surface; however, growth of the resulting viruses is not affected. To circumvent these problems of low level presentation on viral particles, we established a method for display of target peptides, that allows incorporation into the viral envelope only when modification does not inhibit functional homo- oligomerization of the gp64 envelope fusion protein [23], the main basis for viral infectivity. The strategy was to modify the native envelope protein itself so that only modifications which do not affect the essential functions of the glycopro- tein would result in production of viral particles. We could demonstrate that direct insertion into the native gp64 leads to high avidity display of short peptides on the surface of virions and infected cells [23]. To gain further insight into the structural properties of gp64 and to increase the accessibility of peptide insertions to their ligands, we inserted the peptide epitope ELDKWA, specific for the human mAb 2F5, at 17 different positions within the baculovirus major envelope protein. Of these, 13 positions yielded infectious virus progeny. Four insertions apparently were lethal, indicating that these positions (31, 43, 59 and 148) are located within an essential domain, that is either directly responsible for some specific interaction or is structurally important for the protein’s function. Presentation of the ELDKWA peptide was shown to be best in constructs modified at positions 274 and 283. In comparison, AcELD283 had better growth characteristics, as virus titres and plaque phenotypes were comparable to thoseofwild-typeAcMNPV.ThetitreofAcELD274was  10 times lower and plaques were considerably smaller. In conclusion, efficient surface display of desired epitopes on the surface of baculovirus particles can be achieved, however, for the price of somewhat slower growth and lower virus titres. N-terminal fusions into a second copy of gp64 have frequently been proven to be useful for efficient display of various proteins [37–39] on infected insect cells, however, N-terminal insertion into the singular wild-type copy of gp64 must not necessarily be expected to result in the production of infectious virus. In the course of our research we generated viruses containing a streptag peptide at the N terminus of the native envelope protein, which grew up to 2 · 10 7 p.f.u.ÆmL )1 , but ligand display on the virus surface was weaker than constructs containing the streptag Fig. 6. Western blot analysis of budded virions. (A) Immunoblotting of virus samples with gp64-specific mAb B12D5. Two lgprotein (determined with Bio-Rad Protein assay) were loaded per lane. For AcELD281 and AcELD283 (lane 6 and 7) no reactivity with B12D5 could be detected, confirming the disruption of the B12D5 epitope. (B) All recombinant viral mutants showed reactive bands at 64 kDa probed with mAb AcV5, which recognizes amino acids 431–439 within the gp64 envelope protein. (C) Detection of ELDKWA epitope in viral samples was carried out with human mAb 2F5. Lane 1 represents AcMNPV as control. Reactive bands of viral clones at 64 kDa are marked by arrows. Fig. 7. ELISA of mutant viruses. Purified ELDKWA-containing viri- ons (AcELD180, AcELD 271, AcELD274, AcELD278, AcELD281, AcELD283, AcELD290) and AcMNPV were applied to 2F5 pre- coated plates and bound virions were detected by the anti-gp64 specific mAb B12D5 and an anti-mouse peroxidase conjugate. Two virus preparations, harvested 3 and 5 d.p.i., were analysed independently. The mean optical density of these two analyses is plotted on the Y-axis. Error bars correspond to the SD. As the B12D5 has no reactivity with AcELD281 and AcELD283 ELDKWA surface levels of these con- structs could not be determined in this assay. Ó FEBS 2002 Modification of the baculovirus envelope (Eur. J. Biochem. 269) 4465 at position 278 (data not shown). Hence, in this study only insertions within the gp64 coding region and not a N-terminal fusion construct were taken into account and were investigated. The principle feasibility of linear peptide insertion could be successfully demonstrated in this approach. A general validity of this concept can be concluded from ongoing experiments where more complex structures were inserted into selected sites 274 and 283 which had been identified during the course of this project. Further examples include the insertion of a 17-amino acid epitope of mAb 3D6 [40], containing a loop structure between two cysteine residues, at position 274, and a 23-amino acid portion of the envelope protein of the Foot and mouth disease virus into site 283 of native gp64 (unpublished results). Both insertions were compatible with the function of the gp64 envelope protein as we concluded from viral titres and kinetics of recombin- ant peptide expression on the surface of infected Sf9 cells. Having identified sites within the baculovirus major envelope protein gp64, that allow insertions of target peptides and provide efficient surface presentation without loosing infectivity and/or normal propagation, these candi- dates may serve for various useful applications in molecular biology. Surface presentation of relevant epitopes for in vivo antigen presentation requires proper presentation and high accessibility. Peptides that bind certain mammalian cell receptors or mediate cell entry through the membrane may serve to improve baculoviral vectors for mammalian cell transduction. Evaluation of other peptides designed for specific functions, e.g. virus targeting to selected tissues, extension of host range or enhancement of transduction efficiency of nonpermissive cells are envisaged as future aims and therefore would go beyond the scope of this present study. Also larger proteins could be presented on the baculovirus surface, by fusion to protein which binds to the epitope present in the major envelope protein. Preliminary experiments have shown that this strategy leads to a drastic increase in avidity of proteins as compared to previously described methods (unpublished results). ACKNOWLEDGEMENTS The authors thank G. Blissard for providing the cell line Sf Op1D and gp64null virus vAc64 – . We thank R. Voglauer and N. Borth for FACS analysis. This project was funded by the FWF (Fonds zur Fo ¨ rderung der wissenschaftlichen Forschung) project Nr P14538 MOB. REFERENCES 1. O’Reilly, D.R., Miller, L.K. & Luckow, V.A. (1992) Baculovirus Expression Vectors. A Laboratory Manual. W.H. Freeman, New York. 2. Jones, I. & Morikawa, Y. (1996) Baculovirus vectors for expres- sion in insect cells. Curr. Opin. Biotechnol. 7, 512–516. 3. Grabherr, R., Ernst, W., Oker-Blom, C. & Jones, I. (2001) Developments in the use of baculoviruses for the surface display of complex eukaryotic proteins. Trends Biotechnol. 19, 231–236. 4. Grabherr, R. & Ernst, W. (2001) The baculovirus expression system as a tool for generating diversity by viral surface display. Comb Chem High Throughput Screen 4, 185–192. 5. Hofmann, C., Sandig, V., Jennings, G., Rudolph, M., Schlag, P. & Strauss, M. (1995) Efficient gene transfer into human hepatocytes by baculovirus vectors. Proc.NatlAcad.Sci.USA92, 10099– 10103. 6. Boyce, F.M. & Bucher, N.L. (1996) Baculovirus-mediated gene transfer into mammalian cells. Proc. Natl. Acad. Sci. USA 93, 2348–2352. 7. Condreay, J.P., Witherspoon, S.M., Clay, W.C. & Kost, T.A. (1999) Transient and stable gene expression in mammalian cells transduced with a recombinant baculovirus vector. Proc. Natl Acad. Sci. USA 96, 127–132. 8. Kost, T.A. & Condreay, J.P. (1999) Recombinant baculoviruses as expression vectors for insect and mammalian cells. Curr. Opin. Biotechnol. 10, 428–433. Review. 9. Volkman, L.E. (1986) The 64 k envelope protein of budded Autographa californica nuclear polyhedrosis virus. Curr. Topics Microbiol. Immunol. 131, 103–118. 10. Volkman, L.E., Summers, M.D. & Hsieh, C.H. (1976) Occluded and nonoccluded nuclear polyhedrosis virus grown in Trichoplusia ni: comparative neutralization, comparative infectivity, and in vitro growth studies. J. Virol. 63, 1393–1399. 11. Volkman, L.E. & Summers, M.D. (1977) Autographa californica nuclear polyhedrosis virus: comparative infectivity of the occluded, alkali-liberated, and nonoccluded forms. J. Invert. Pathol. 30, 102–103. 12. Keddie, B.A. & Volkman, L.E. (1985) Infectivity difference between the two phenotypes of Autographa californica nuclear polyhedrosis virus. Importance of the 64K envelope glycoprotein. J.Gen.Virol.66, 1195–1200. 13. Whitford, M., Stewart, S., Kuzio, J. & Faulkner, P. (1989) Iden- tification and sequence analysis of a gene encoding gp67, an abundant envelope glycoprotein of the Autographa californica nuclear polyhedrosis virus. J. Virol. 63, 1393–1399. 14. Blissard, G.W. & Rohrmann, G.F. (1989) Location, sequence, transcriptional mapping and temporal expression of the gp64 envelope glycoprotein gene of the Orgyia pseudotsugata multi- capsid nuclear polyhedrosis virus. Virology 170, 537–555. 15. Jarvis, D.L. & Garcia, A. Jr (1994) Biosynthesis and processing of the Autographa californica nuclear polyhedrosis virus gp64 pro- tein. Virology 205, 300–313. 16. Oomens, A.G., Monsma, S.A. & Blissard, G.W. (1995) The baculovirus GP64 envelope fusion protein: synthesis, oligomer- ization, and processing. Virology 209, 592–603. 17. Volkman, L.E., Goldsmith, P.A., Hess, R.T. & Faulkner, P. (1984) Neutralization of budded Autrographa californica NPV by a monoclonal antibody: identification of the target antigen. Virology 133, 354–362. 18. Blissard, G.W. & Wenz, J.R. (1992) Baculovirus gp64 envelope glycoprotein is sufficient to mediate pH-dependent membrane fusion. J. Virol. 66, 6829–6835. 19. Monsma, S.A., Oomens, A.G.P. & Blissard, G.W. (1996) The gp64 envelope fusion protein is an essential baculovirus protein required for cell-to-cell transmission of infection. J. Virol. 70, 4607–4616. 20. Hefferon, K.L., Oomens, A.G., Monsma, S.A., Finnerty, C.M. & Blissard, G.W. (1999) Host cell receptor binding by baculovirus GP64 and kinetics of virion entry. Virology 258, 455–468. 21. Oomens, A.G. & Blissard, G.W. (1999) Requirement for gp64 to drive efficient budding of Autographa californica multicapsid nucleopolyhedrosisvirus. Virology 254, 297–314. 22. Monsma, S.A. & Blissard, G.W. (1995) Identification of a membrane fusion domain and a oligomerization domain in the baculovirus gp64 envelope fusion protein. J. Virol. 69, 2583– 2595. 23. Ernst, W.J., Spenger, A., Toellner, L., Katinger, H. & Grabherr, R.M. (2000) Expanding baculovirus surface display. Modification of the native coat protein gp64 of Autographa californica NPV. Eur. J. Biochem. 267, 4033–4039. 24. Lindley, K.M., Su, J L., Hodges, P.K., Wisely, G.B., Bledsoe, R.K.,Condreay,J.P.,Winegar,D.A.,Hutchins,J.T.&Kost,T.A. (2000) Production of monoclonal antibodies using recombinant 4466 A. Spenger et al. (Eur. J. Biochem. 269) Ó FEBS 2002 baculovirus displaying gp64-fusion proteins. J. Immunol. Methods 234, 123–135. 25.Ojala,K.,Mottershead,D.G.,Suokko,A.&Oker-Blom,C. (2001) Specific binding of baculoviruses displaying gp64 fusion proteins to mammalian cells. Biochem. Biophys. Res. Commun. 284, 777–784. 26. Mangor, J.T., Monsma, S.A., Johnson, M.C. & Blissard, G.W. (2001) A gp64-null baculovirus pseudotyped with vesicular sto- matitis virus G protein. J. Virol. 75, 2544–2556. 27. Muster, T., Steindl, F., Purtscher, M., Trkola, A., Klima, A., Himmler, G., Ru ¨ ker, F. & Katinger, H. (1993) A conserved neutralizing epitope on gp41 of human immunodeficiency virus type 1. J. Virol. 67, 6642–6647. 28. Buchacher, A., Predl, R., Strutzenberger, K., Steinfellner, W., Trkola, A., Purtscher, M., Gruber, G., Tauer, C., Steindl, F., Jungbauer, A. & Katinger, H. (1994) Generation of human monoclonal antibodies against HIV-1 proteins; electrofusion and epstein-barr virus transformation for peripheral blood lymphocyte immortalization. AIDS Res. Hum. Retroviruses 10, 359–369. 29. Purtscher, M., Trkola, A., Gruber, G., Buchacher, A., Predl, R., Steindl,F.,Tauer,C.,Berger,R.,Barrett,N.,Jungbauer,A.& Katinger, H. (1994) A broadly neutralizing human monoclonal antibody against gp41 of human immunodeficiency virus type 1. AIDS Res. Hum. Retroviruses 10, 1651–1658. 30. Emini, E.A., Hughes, J.V., Perlow, D.S. & Boger, J. (1985) Induction of hepatitis A virus-neutralizing antibody by a virus- specific synthetic peptide. J. Virol. 55, 836–839. 31. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, Vol. 3, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. 32. Ayres, M.D., Howard, S.C., Kuzio, J., Lopez-Ferber, M. & Possee, R.D. (1994) The complete DNA sequence of Autographa californica nuclear polyhedrosis virus. Virology 202, 586–605. 33. Plonsky, I., Cho, M S., Oomens, A.G., Blissard, G. & Zimmer- berg, J. (1999) An analysis of the role of the target membrane on the gp64-induced fusion pore. Virology 253, 65–76. 34.Groebe,D.R.,Chung,A.E.&Ho,C.(1990)Cationic lipid-mediated co-transfection of insect cells. Nucl. Acids Res. 18, 4033. 35. Keddie, B.A., Aponte, G., W. & Volkman, L.E. (1989) The pathway of infection of Autographa californica nuclear poly- hedrosis virus: importance of the 64K envelope glycoprotein. J.Gen.Virol.66, 1195–1200. 36. Hohmann, A.W. & Faulkner, P. (1983) Monoclonal antibodies to baculovirus structural proteins: determination of specificities by western blot analysis. Virology 125, 432–444. 37. Boublik, Y., DiBonito, P. & Jones, I.M. (1995) Eukaryotic virus display: engineering the major surface glycoprotein of the Auto- grapha californica nuclear polyhedrosis virus (AcNPV) for the presentation of foreign proteins on the virus surface. Bio/Tech- nology 13, 179–184. 38. Grabherr, R.M., Ernst, W.J., Doblhoff-Dier, O., Sara, M. & Katinger, H. (1997) Expression of foreign proteins on the surface of Autographa californica nuclear polyhedrosis virus. Bio/Tech- niques 22, 730–735. 39. Mottershead, D., van der Linden, I., von Bonsdorff, C H., Keina ¨ nen, K. & Oker-Blom, C. (1997) Baculoviral display of the green fluorescent protein and rubella virus envelope proteins. Biochem. Biophys. Res. Commun. 238, 717–722. 40. Stigler, R D., Ru ¨ ker,F.,Katinger,D.,Elliott,G.,Hohne,W., Henklein, P., Ho, J.X., Keeling, K., Carter, D.C., Nugel, E., Kramer, A., Porstmann, T. & Schneider-Mergener, J. (1995) Interaction between a Fab fragment against gp41 of human immunodeficiency virus 1 and its peptide epitope: characterization using a peptide epitope library and molecular modeling. Protein Eng. 8, 471–479. Ó FEBS 2002 Modification of the baculovirus envelope (Eur. J. Biochem. 269) 4467 . Altering the surface properties of baculovirus Autographa californica NPV by insertional mutagenesis of the envelope protein gp64 Alexandra. display on the surface of baculoviruses by engineering peptides directly into the native envelope protein gp64. Thereby, no duplication of the gp64 is necessary